ID: 976608673

View in Genome Browser
Species Human (GRCh38)
Location 4:87007016-87007038
Sequence GCCCAGCAACAGCACAACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1241
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 1220}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976608673_976608680 9 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608680 4:87007048-87007070 GCGCCGGCGGTCTTCGAGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
976608673_976608682 11 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608682 4:87007050-87007072 GCCGGCGGTCTTCGAGCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
976608673_976608678 -7 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608678 4:87007032-87007054 GCTGGGCAGGCGTTGGGCGCCGG 0: 1
1: 0
2: 0
3: 28
4: 316
976608673_976608679 -4 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608679 4:87007035-87007057 GGGCAGGCGTTGGGCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 320
976608673_976608681 10 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 11
976608673_976608685 20 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608685 4:87007059-87007081 CTTCGAGCGTGGGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 38
976608673_976608684 12 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608684 4:87007051-87007073 CCGGCGGTCTTCGAGCGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976608673 Original CRISPR GCCCAGCAACAGCACAACGC GGG (reversed) Intronic
900700011 1:4041055-4041077 CGCCAGCAACAGAACAAAGCTGG + Intergenic
902144541 1:14387332-14387354 CACCAGCAACAGAACAAAGCTGG - Intergenic
903968776 1:27105876-27105898 GCCCAGCACCTGCACAAAGACGG + Exonic
904271242 1:29351538-29351560 GCCCGTCAGCAGCACAAAGCTGG + Intergenic
904425105 1:30417874-30417896 GCCCCTCAGCAGCACAAAGCTGG - Intergenic
904988230 1:34571098-34571120 CACCAGCAACAGAACAAAGCTGG - Intergenic
905331835 1:37208527-37208549 CACCAGCAACAGAACAAAGCTGG + Intergenic
905355367 1:37380066-37380088 CGCCAGCAACAGAACAAAGCTGG - Intergenic
905740445 1:40365824-40365846 CACCAGCAACAGAACAAAGCTGG + Intronic
906363144 1:45181056-45181078 CACCAGCAACAGAACAAAGCTGG + Intronic
906714579 1:47957327-47957349 CACCAGCAACAGAACAAAGCTGG + Intronic
906909828 1:49935959-49935981 CCCCAGCAATGGAACAACGCTGG + Intronic
907631877 1:56090631-56090653 CACCAGCAACAGAACAAAGCTGG + Intergenic
907780848 1:57564408-57564430 CGCCAGCAACAGAACAAAGCTGG + Intronic
907876145 1:58490064-58490086 CACCAGCAACAGAACAAAGCTGG + Intronic
908111964 1:60906731-60906753 GCCCAGCAAGATCACACAGCTGG - Intronic
908284579 1:62581271-62581293 GCCCAGAAACAGGACAGCACAGG + Intronic
908584065 1:65549832-65549854 CACCAGCAACAGAACAAAGCTGG - Intronic
908717228 1:67083915-67083937 CACCAGCAACAGAACAAAGCCGG - Intergenic
908881545 1:68739129-68739151 CACCAGCAACAGAACAAAGCTGG - Intergenic
908915298 1:69119506-69119528 CACCAGCAACAGAACAAAGCTGG - Intergenic
909114314 1:71514696-71514718 CACCAGCAACAGAACAAAGCTGG + Intronic
909216719 1:72899752-72899774 CACCAGCAACAGAACAAAGCTGG + Intergenic
909548947 1:76877145-76877167 GCCCAGTAACAGCAAAAGGAGGG + Intronic
909557542 1:76970169-76970191 CGCCAGCAACAGAACAAAGCTGG + Intronic
909886068 1:80944258-80944280 CACCAGCAACAGAACAAAGCTGG - Intergenic
910067288 1:83168540-83168562 CACCAGCAACAGAACAAAGCTGG + Intergenic
910068536 1:83183159-83183181 CACCAGCAACAGAACAAAGCTGG + Intergenic
910082241 1:83355457-83355479 CACCAGCAACAGAACAAAGCTGG - Intergenic
910143910 1:84057401-84057423 CACCAGCAACAGAACAAAGCTGG - Intergenic
910304754 1:85749505-85749527 CACCAGCAACAGAACAAAGCTGG + Intronic
910311505 1:85829942-85829964 CACCAGCAACAGAACAAAGCTGG - Intronic
910319591 1:85928054-85928076 CACCAGCAACAGAACAAAGCTGG + Intronic
910386020 1:86684105-86684127 CACCAGCAACAGAACAAAGCTGG - Intergenic
910786028 1:90998671-90998693 CGCCAGCAACAGAACAAAGCTGG + Intronic
910815498 1:91287635-91287657 CACCAGCAACAGAACAAAGCTGG + Intronic
911074229 1:93856844-93856866 CACCAGCAACAGAACAAAGCTGG + Intergenic
911128895 1:94369296-94369318 CTCCAGCAACAGAACAAAGCTGG - Intergenic
911290953 1:96056597-96056619 CACCAGCAACAGAACAAAGCTGG - Intergenic
911492737 1:98589634-98589656 CACCAGCAACAGAACAAAGCTGG + Intergenic
911676808 1:100667997-100668019 CACCAGCAACAGAACAAAGCTGG - Intergenic
911700678 1:100949049-100949071 CACCAGCAACAGAACAAAGCTGG - Intronic
911996659 1:104775271-104775293 CACCAGCAACAGAACAAAGCTGG - Intergenic
912002161 1:104848858-104848880 CACCAGCAACAGAACAAAGCTGG - Intergenic
912285308 1:108363335-108363357 CACCAGCAACAGAACAAAGCTGG - Intergenic
912303711 1:108542972-108542994 ACCCAGCAACAGAACAAAGCTGG + Intergenic
912751198 1:112289100-112289122 CACCAGCAACAGAACAAAGCTGG + Intergenic
912888192 1:113498185-113498207 CACCAGCAACAGAACAAAGCTGG + Intronic
912933288 1:113982723-113982745 GCCCTGCAGGAGCACAACGCTGG - Intergenic
913123480 1:115763629-115763651 GCCCAGCAAGAGCATAGCTCTGG - Intronic
913151977 1:116053029-116053051 CACCAGCAACAGAACAAAGCTGG + Intronic
913285111 1:117218701-117218723 CACCAGCAACAGAACAAAGCTGG + Intergenic
913299630 1:117357583-117357605 CACCAGCAACAGAACAAAGCTGG - Intergenic
913363027 1:118003841-118003863 TACCAGCAACAGAACAAAGCTGG - Intronic
913385147 1:118251220-118251242 GCCCAGCATCAGCACAAACCAGG - Intergenic
913388207 1:118281871-118281893 CACCAGCAACAGAACAAAGCTGG + Intergenic
913394370 1:118349870-118349892 CACCAGCAACAGAACAAAGCTGG + Intergenic
913407924 1:118516800-118516822 CGCCAGCAACAGAACAAAGCTGG - Intergenic
913418621 1:118638861-118638883 CACCAGCAACAGAACAAAGCTGG + Intergenic
913436621 1:118853336-118853358 CACCAGCAACAGAACAAAGCTGG + Intergenic
913526244 1:119696407-119696429 CACCAGCAACAGAACAAAGCTGG - Intronic
913716197 1:121537254-121537276 CACCAGCAACAGAACAAAGCTGG - Intergenic
914336695 1:146722211-146722233 CACCAGCAACAGAACAAAGCTGG - Intergenic
914375017 1:147065033-147065055 CACCAGCAACAGAACAAAGCTGG + Intergenic
914410710 1:147424200-147424222 CACCAGCAACAGAACAAAGCTGG + Intergenic
914683354 1:149957059-149957081 CACCAGCAACAGAACAAAGCTGG - Intronic
914996991 1:152552809-152552831 CACCAGCAACAGAACAAAGCTGG - Intronic
915180880 1:154058607-154058629 GTCCAGCAACAGCCCACCTCAGG - Exonic
916032895 1:160893627-160893649 TGCCAGCAACAGAACAAAGCTGG + Intergenic
916596376 1:166248078-166248100 CACCAGCAACAGAACAAAGCTGG - Intergenic
916596712 1:166251093-166251115 CACCAGCAACAGAACAAAGCTGG - Intergenic
917207796 1:172596306-172596328 CGCCAGCAACAGAACAAAGCTGG - Intronic
917396036 1:174595374-174595396 CACCAGCAACAGAACAAAGCTGG - Intronic
917827506 1:178838636-178838658 TGCCAGCAACAGAACAAAGCTGG + Intronic
918035885 1:180871836-180871858 CACCAGCAACAGAACAAAGCTGG - Intronic
918397985 1:184135587-184135609 GACCAGCAACGGAACAAAGCTGG - Intergenic
918468586 1:184846596-184846618 CACCAGCAACAGAACAAAGCTGG + Intronic
918483331 1:185002516-185002538 CACCAGCAACAGAACAAAGCTGG + Intergenic
918593036 1:186261610-186261632 CACCAGCAACAGAACAAAGCTGG - Intergenic
918680565 1:187348789-187348811 CACCAGCAACAGAACAAAGCTGG - Intergenic
919065392 1:192687746-192687768 CACCAGCAACAGAACAAAGCTGG - Intergenic
919152866 1:193722887-193722909 CACCAGCAACAGAACAAAGCTGG - Intergenic
919335328 1:196224395-196224417 CACCAGCAACAGAACAAAGCTGG - Intergenic
919446252 1:197708700-197708722 CACCAGCAACAGAACAAAGCTGG + Intronic
920836483 1:209515442-209515464 CAGCAGCAACAGCACAACGTTGG - Intergenic
920884978 1:209918817-209918839 CACCAGCAACAGAACAAAGCTGG - Intergenic
920971535 1:210747307-210747329 GCCGAGCAGCTGCACAACCCAGG - Intronic
921679473 1:218014247-218014269 CACCAGCAACAGAACAAAGCTGG - Intergenic
921890501 1:220348529-220348551 GCCCAGAGACAGGACAACTCAGG - Intergenic
921915916 1:220610577-220610599 TGCCAGCAACAGAACAAAGCTGG - Intronic
921981344 1:221262512-221262534 CGCCAGCAACAGAACAAAGCTGG - Intergenic
922826580 1:228525709-228525731 CACCAGCAACAGAACAAAGCTGG - Intergenic
923194360 1:231651090-231651112 CGCCAGCAACAGAACAAAGCTGG - Intronic
923781014 1:237024490-237024512 CACCAGCAACAGAACAAAGCTGG - Intergenic
923786915 1:237076248-237076270 CACCAGCAACAGAACAAAGCTGG + Intronic
924285549 1:242482180-242482202 CACCAGCAACAGAACAAAGCTGG + Intronic
924857891 1:247893340-247893362 CACCAGCAACAGAACAAAGCTGG - Intergenic
1063339184 10:5246339-5246361 CACCAGCAACAGAACAAAGCTGG + Intergenic
1063480751 10:6374660-6374682 CACCAGCAACAGAACAAAGCTGG - Intergenic
1063528650 10:6809164-6809186 CACCAGCAACAGAACAAAGCTGG - Intergenic
1064840483 10:19586245-19586267 CACCAGCAACAGAACAAAGCTGG - Intronic
1064919438 10:20500647-20500669 CACCAGCAACAGAACAAAGCTGG - Intergenic
1065254847 10:23856030-23856052 TACCAGCAACAGAACAAAGCTGG - Intronic
1065397197 10:25252333-25252355 CACCAGCAACAGAACAAAGCTGG - Intronic
1065418898 10:25520393-25520415 CACCAGCAACAGAACAAAGCTGG - Intronic
1065606135 10:27419369-27419391 CACCAGCAACAGAACAAAGCTGG + Intergenic
1066239028 10:33515870-33515892 CACCAGCAACAGAACAAAGCTGG - Intergenic
1066274182 10:33852765-33852787 CACCAGCAACAGAACAAAGCTGG - Intergenic
1066696213 10:38080223-38080245 GACCAGCAGCATCACAACCCTGG - Intergenic
1066701481 10:38134313-38134335 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1066822240 10:39509115-39509137 CACCAGCAACAGAACAAAGCTGG + Intergenic
1067063217 10:43088870-43088892 GAGCAGCAACAGCACAGGGCCGG - Intronic
1067249122 10:44572399-44572421 GCCCAGCAACGGCCCAACCAAGG - Intergenic
1067999809 10:51319405-51319427 ACCCAACAATAGCACAAAGCAGG - Intronic
1068609427 10:59042878-59042900 CACCAGCAACAGAACAAAGCTGG - Intergenic
1069066707 10:63949664-63949686 CACCAGCAACAGAACAAAGCTGG - Intergenic
1069110541 10:64441388-64441410 CACCAGCAACAGAACAAAGCTGG - Intergenic
1069148473 10:64925215-64925237 CACCAGCAACGGCACAAAGCTGG + Intergenic
1069325982 10:67231647-67231669 CACCAGCAACAGAACAAAGCTGG + Intronic
1070343541 10:75520707-75520729 CGCCAGCAACAGAACAAAGCAGG - Intronic
1070455424 10:76609619-76609641 CACCAGCAACAGAACAAAGCTGG + Intergenic
1070851960 10:79571485-79571507 CACCAGCAACAGAACAAAGCAGG + Intergenic
1071247965 10:83786078-83786100 CACCAGCAACAGAACAAAGCTGG - Intergenic
1071748135 10:88444443-88444465 CACCAGCAACAGAACAAAGCTGG + Intronic
1071763293 10:88633619-88633641 CACCAGCAACAGAACAAAGCTGG - Intergenic
1071912516 10:90251599-90251621 CACCAGCAACAGAACAAAGCTGG + Intergenic
1071922792 10:90370840-90370862 CACCAGCAACAGAACAAAGCTGG - Intergenic
1072029465 10:91504249-91504271 CACCAGCAACAGAACAAAGCTGG + Intronic
1072287391 10:93928757-93928779 CTCCAGCAACAGAACAAAGCTGG + Intronic
1072364660 10:94696602-94696624 CACCAGCAACAGAACAAAGCTGG + Intronic
1072399280 10:95080199-95080221 CACCAGCAACAGAACAAAGCTGG + Intergenic
1072774959 10:98182038-98182060 TGCCAGCAACAGAACAAAGCTGG - Intronic
1072842235 10:98787964-98787986 CACCAGCAACAGAACAAAGCTGG - Intronic
1072874173 10:99153724-99153746 CACCAGCAACAGAACAAAGCTGG + Intronic
1073587457 10:104724995-104725017 CACCAGCAACAGAACAAAGCTGG - Intronic
1073647758 10:105323623-105323645 CACCAGCAACAGAACAAAGCTGG - Intergenic
1073653036 10:105382371-105382393 CACCAGCAACAGAACAAAGCTGG - Intergenic
1073688287 10:105780544-105780566 CACCAGCAACAGAACAAAGCTGG - Intergenic
1073925066 10:108505504-108505526 CCCCAGCAACAGAACAAAGCTGG + Intergenic
1074027733 10:109653468-109653490 CACCAGCAACAGAACAAAGCTGG + Intergenic
1074043645 10:109817450-109817472 CACCAGCAACAGAACAAAGCTGG - Intergenic
1074240964 10:111638216-111638238 CACCAGCAACAGAACAAAGCTGG + Intergenic
1075638083 10:124044041-124044063 GCCAAGGAACAGCACAGAGCAGG + Intronic
1078595012 11:12678350-12678372 GCCCAGCAGCAGCACAGCCTAGG - Intronic
1078695538 11:13628106-13628128 CACCAGCAACAGAACAAAGCTGG - Intergenic
1078726658 11:13938387-13938409 CACCAGCAACAGAACAAAGCTGG - Intergenic
1078951801 11:16142474-16142496 CACCAGCAACAGAACAAAGCTGG + Intronic
1079037450 11:17033521-17033543 CACCAGCAACAGAACAAAGCTGG - Intergenic
1079629054 11:22651938-22651960 CACCAGCAACAGAACAAAGCTGG - Intronic
1079683049 11:23322072-23322094 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1079760959 11:24328935-24328957 CACCAGCAACAGAACAAAGCTGG + Intergenic
1080211885 11:29795583-29795605 CACCAGCAACAGAACAAAGCTGG + Intergenic
1080345550 11:31320674-31320696 CACCAGCAACAGAACAAAGCTGG - Intronic
1080366038 11:31574903-31574925 CGCCAGCAACAGAACAAAGCTGG + Intronic
1080818090 11:35778483-35778505 TGCCAGCAACAGAACAAAGCTGG - Intronic
1080907005 11:36556630-36556652 CACCAGCAACAGAACAAAGCTGG - Intronic
1080968774 11:37245717-37245739 CACCAGCAACAGAACAAAGCTGG - Intergenic
1081039509 11:38192857-38192879 CACCAGCAACAGAACAAAGCTGG + Intergenic
1081086899 11:38812302-38812324 CACCAGCAACAGAACAAAGCTGG + Intergenic
1081169353 11:39847641-39847663 CACCAGCAACAGAACAAAGCTGG + Intergenic
1081172693 11:39888359-39888381 CACCAGCAACAGAACAAAGCTGG + Intergenic
1082124375 11:48415094-48415116 CACCAGCAACAGAACAAAGCTGG - Intergenic
1082232079 11:49780143-49780165 CACCAGCAACAGAACAAAGCTGG - Intergenic
1082602226 11:55172515-55172537 CACCAGCAACAGAACAAAGCTGG - Intergenic
1082613739 11:55334307-55334329 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1082634361 11:55578271-55578293 CACCAGCAACAGAACAAAGCTGG + Intergenic
1082970613 11:59016349-59016371 TCACAGCAACAGAACAAAGCTGG + Intronic
1083124583 11:60551485-60551507 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1083513621 11:63235663-63235685 CACCAGCAACAGAACAAAGCTGG - Intronic
1083522935 11:63333150-63333172 TGCCAGCAACAGAACAAAGCTGG - Intronic
1083530814 11:63419826-63419848 CACCAGCAACAGAACAAAGCAGG + Intergenic
1083531980 11:63431411-63431433 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1083861156 11:65421002-65421024 GCCCAGAAACAGCACTACAGCGG + Intergenic
1083895488 11:65617821-65617843 GCCCAGCCACAGCAGCACACTGG - Intronic
1084421756 11:69063891-69063913 GGCCAGCAGCAGCCCGACGCTGG - Exonic
1085162549 11:74361520-74361542 TGCCAGCAACAGAACAAAGCTGG + Intronic
1085417285 11:76327867-76327889 GCCCAGCACCAGCCCAGCTCTGG - Intergenic
1085536453 11:77223243-77223265 TGCCAGCAACAGAACAAAGCTGG - Intronic
1085693257 11:78682797-78682819 CACCAGCAACAGAACAAAGCTGG - Intronic
1086015071 11:82156844-82156866 CACCAGCAACAGAACAAAGCTGG + Intergenic
1086024858 11:82278446-82278468 CACCAGCAACAGAACAAAGCTGG + Intergenic
1086489454 11:87345054-87345076 CACCAGCAACAGAACAAAGCTGG - Intergenic
1086523934 11:87703089-87703111 CACCAGCAACAGAACAAAGCTGG - Intergenic
1086544420 11:87951413-87951435 CACCAGCAACAGAACAAAGCTGG - Intergenic
1086586870 11:88462864-88462886 CACCAGCAACAGAACAAAGCTGG - Intergenic
1086744177 11:90405092-90405114 CACCAGCAACAGAACAAAGCTGG - Intergenic
1086786023 11:90971295-90971317 CACCAGCAACAGAACAAAGCTGG - Intergenic
1086868966 11:92014542-92014564 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1086976416 11:93137627-93137649 CACCAGCAACAGAACAAAGCTGG + Intergenic
1087001209 11:93421961-93421983 CACCAGCAACAGAACAAAGCTGG + Intronic
1087072820 11:94099032-94099054 AGCCAGCAACAGAACAAAGCTGG - Intronic
1087210020 11:95437200-95437222 CACCAGCAACAGAACAAAGCTGG + Intergenic
1087547467 11:99603070-99603092 CACCAGCAACAGAACAAAGCTGG + Intronic
1087580040 11:100039988-100040010 CACCAGCAACAGAACAAAGCTGG - Intronic
1087794382 11:102439665-102439687 CGCCAGCAACAGAACAAAGCTGG + Intronic
1087824185 11:102746459-102746481 CACCAGCAACAGAACAAAGCTGG - Intergenic
1087878825 11:103391516-103391538 TACCAGCAACAGAACAAAGCTGG - Intronic
1087916685 11:103819826-103819848 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1088004546 11:104925355-104925377 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1088309207 11:108441939-108441961 TGCCAGCAACAGAACAAAGCTGG + Intronic
1088379939 11:109182519-109182541 CACCAGCAACAGAACAAAGCTGG - Intergenic
1088852121 11:113713684-113713706 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1088948008 11:114534407-114534429 CACCAGCAACAGAACAAAGCTGG + Intronic
1088957732 11:114626644-114626666 CACCAGCAACAGAACAAAGCTGG + Intergenic
1089886051 11:121824700-121824722 CACCAGCAACAGAACAAAGCTGG + Intergenic
1090216572 11:124971395-124971417 CGCCAGCAACAGAACAAAGCTGG + Intronic
1090290356 11:125537596-125537618 CACCAGCAACAGAACAAAGCTGG + Intergenic
1091627624 12:2135326-2135348 CACCAGCAACAGAACAAAGCTGG - Intronic
1091824786 12:3504221-3504243 CACCAGCAACAGAACAAAGCTGG - Intronic
1092309012 12:7331905-7331927 CACCAGCAACAGAACAAAGCTGG + Intergenic
1092517039 12:9225727-9225749 CACCAGCAACAGAACAAAGCTGG - Intergenic
1093179165 12:15948718-15948740 CGCCAGCAACAGAACAAAGCTGG - Intronic
1093660075 12:21746533-21746555 TGCCAGCAACAGAACAAAGCTGG - Intronic
1093781961 12:23146952-23146974 CACCAGCAACAGAACAAAGCTGG + Intergenic
1093986329 12:25537695-25537717 CACCAGCAACAGAACAAAGCTGG + Intronic
1093998189 12:25665452-25665474 CACCAGCAACAGAACAAAGCTGG - Intergenic
1094430653 12:30366374-30366396 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1095065145 12:37762815-37762837 CACCAGCAACAGAACAAAGCTGG + Intergenic
1095151129 12:38797671-38797693 CACCAGCAACAGAACAAAGCTGG + Intronic
1095388106 12:41673430-41673452 CACCAGCAACAGAACAAAGCTGG + Intergenic
1095591398 12:43907468-43907490 CACCAGCAACAGAACAAAGCTGG + Intronic
1095609658 12:44113227-44113249 CACCAGCAACAGAACAAAGCTGG - Intronic
1095802693 12:46284607-46284629 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1096036485 12:48475367-48475389 CACCAGCAACAGAACAAAGCTGG + Intergenic
1096241765 12:49963491-49963513 GCTCAACAACAACACAACGCAGG + Exonic
1096433365 12:51567654-51567676 CACCAGCAACAGAACAAAGCTGG - Intergenic
1096891729 12:54777863-54777885 CACCAGCAACAGAACAAAGCTGG + Intergenic
1096892891 12:54789556-54789578 CACCAGCAACAGAACAAAGCTGG + Intergenic
1096922337 12:55101276-55101298 CACCAGCAACAGAACAAAGCTGG - Intergenic
1096926734 12:55156464-55156486 CACCAGCAACAGAACAAAGCTGG - Intergenic
1096957854 12:55545399-55545421 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1097515094 12:60594591-60594613 GCCCAGCACTAGCAGAAGGCAGG + Intergenic
1097917374 12:65035474-65035496 CACCAGCAACAGAACAAAGCCGG - Intergenic
1098015424 12:66099749-66099771 CACCAGCAACAGAACAAAGCTGG - Intergenic
1098372778 12:69778434-69778456 CACCAGCAACAGAACAAAGCTGG - Intronic
1098675792 12:73288676-73288698 CACCAGCAACAGAACAAAGCTGG - Intergenic
1098722933 12:73925253-73925275 CGCCAGCAACAGAACAAAGCAGG + Intergenic
1098794864 12:74875858-74875880 CACCAGCAACAGAACAAAGCTGG + Intergenic
1099086878 12:78257180-78257202 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1099266428 12:80453385-80453407 CACCAGCAACAGAACAAAGCTGG - Intronic
1099267240 12:80462989-80463011 CACCAGCAACAGAACAAAGCTGG + Intronic
1099428178 12:82550212-82550234 CCCCAGCAACAGAACAAAACTGG - Intergenic
1099512552 12:83555559-83555581 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1099521783 12:83674105-83674127 CACCAGCAACAGAACAAAGCTGG - Intergenic
1099773868 12:87099388-87099410 CACCAGCAACAGAACAAAGCTGG + Intergenic
1099779226 12:87172533-87172555 AGCCAGCAACAGAACAAAGCTGG + Intergenic
1099795557 12:87395031-87395053 CACCAGCAACAGAACAAAGCTGG + Intergenic
1099999016 12:89811597-89811619 CACCAGCAACAGAACAAAGCTGG - Intergenic
1100248560 12:92790247-92790269 CGCCAGCAACAGAACAAAGCTGG + Intronic
1100259263 12:92916716-92916738 CACCAGCAACAGAACAAAGCTGG + Intronic
1100563936 12:95776283-95776305 CACCAGCAACAGAACAAAGCTGG + Intronic
1100579812 12:95928558-95928580 CACCAGCAACAGAACAAAGCTGG - Intronic
1100919371 12:99464414-99464436 CACCAGCAACAGAACAAAGCTGG + Intronic
1101189072 12:102312778-102312800 CACCAGCAACAGAACAAAGCTGG - Intergenic
1101282959 12:103278545-103278567 GCCCAGCCACAGCCCAGTGCAGG - Intronic
1101401652 12:104393579-104393601 CACCAGCAACAGAACAAAGCTGG - Intergenic
1101524763 12:105518883-105518905 CACCAGCAACAGAACAAAGCTGG - Intergenic
1101768238 12:107723202-107723224 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1102240525 12:111321951-111321973 GCACAGCAACAGCACATGGCAGG + Intronic
1102309458 12:111834182-111834204 CACCAGCAACAGAACAAAGCTGG - Intergenic
1104173306 12:126304035-126304057 CACCAGCAACAGAACAAAGCTGG - Intergenic
1104472576 12:129042568-129042590 CACCAGCAACAGAACAAAGCTGG - Intergenic
1104474570 12:129060924-129060946 CACCAGCAACAGAACAAAGCTGG - Intergenic
1105311428 13:19215740-19215762 CACCAGCAACAGAACAAAGCTGG - Intergenic
1105906041 13:24811661-24811683 CACCAGCAACAGAACAAAGCGGG - Intronic
1106335891 13:28783225-28783247 CCCCAGCAACAGAACAAAACTGG - Intergenic
1106427537 13:29646731-29646753 CACCAGCAACAGAACAAAGCTGG - Intergenic
1106613309 13:31303299-31303321 CACCAGCAACAGAACAAAGCTGG + Intronic
1106771122 13:32961469-32961491 GCACAGCAACAGCACATGGGAGG + Intergenic
1106913163 13:34485287-34485309 CACCAGCAACAGAACAAAGCTGG - Intergenic
1107162846 13:37251332-37251354 CACCAGCAACAGAACAAAGCTGG + Intergenic
1107639405 13:42425866-42425888 CACCAGCAACAGAACAAAGCTGG + Intergenic
1107971421 13:45646020-45646042 CACCAGCAACAGAACAAAGCTGG + Intergenic
1108445775 13:50508053-50508075 CACCAGCAACAGAACAAAGCTGG - Intronic
1108607578 13:52054921-52054943 CACCAGCAACAGAACAAAGCTGG + Intronic
1108720347 13:53125294-53125316 GCCCAACAATGGCACAATGCTGG - Intergenic
1108988877 13:56629810-56629832 CGCCAGCAACAGAACAAAGCAGG + Intergenic
1109358657 13:61267539-61267561 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1109566294 13:64120512-64120534 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1110344276 13:74427313-74427335 CACCAGCAACAGAACAAAGCTGG + Intergenic
1110415336 13:75246183-75246205 CACCAGCAACAGAACAAAGCTGG - Intergenic
1110532909 13:76617844-76617866 CACCAGCAACAGAACAAAGCTGG - Intergenic
1110698320 13:78518226-78518248 CACCAGCAACAGAACAAAGCTGG - Intergenic
1110767892 13:79301019-79301041 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1110919737 13:81069107-81069129 CACCAGCAACAGAACAAAGCTGG - Intergenic
1111130041 13:83963511-83963533 CACCAGCAACAGAACAAAGCTGG - Intergenic
1111778194 13:92690586-92690608 CACCAGCAACAGAACAAAGCTGG - Intronic
1111967132 13:94871886-94871908 CACCAGCAACAGAACAAAGCTGG + Intergenic
1112060940 13:95739831-95739853 CACCAGCAACAGAACAAAGCTGG - Intronic
1112075437 13:95907862-95907884 CGCCAGCAACAGAACAAAGCTGG + Intronic
1112178609 13:97054149-97054171 CACCAGCAACAGAACAAAGCTGG - Intergenic
1112318790 13:98388769-98388791 GCACAGCAATAGCACAGCTCAGG - Intronic
1112490385 13:99857690-99857712 TCCCAGCAACAAGACAACCCAGG - Intronic
1112899866 13:104345371-104345393 CACCAGCAACAGAACAAAGCTGG - Intergenic
1113300860 13:109017991-109018013 CACCAGCAACAGAACAAAGCAGG - Intronic
1114003704 14:18288857-18288879 CACCAGCAACAGAACAAAGCTGG - Intergenic
1114034398 14:18609024-18609046 CACCAGCAACAGAACAAAGCTGG - Intergenic
1114079204 14:19188201-19188223 CACCAGCAACAGAACAAAGCTGG - Intergenic
1114124245 14:19705985-19706007 CACCAGCAACAGAACAAAGCTGG + Intergenic
1114240377 14:20861220-20861242 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1114801035 14:25776337-25776359 CACCAGCAACAGAACAAAGCTGG - Intergenic
1114801770 14:25783874-25783896 CACCAGCAACAGAACAAAGCTGG - Intergenic
1115034997 14:28846339-28846361 TACCAGCAACAGAACAAAGCTGG + Intergenic
1115123041 14:29960400-29960422 TGCCAGCAACAGAACAAAGCTGG - Intronic
1115158314 14:30364522-30364544 CACCAGCAACAGAACAAAGCTGG + Intergenic
1115186084 14:30689830-30689852 CACCAGCAACAGAACAAAGCTGG - Intronic
1115827584 14:37294431-37294453 CACCAGCAACAGAACAAAGCTGG + Intronic
1115943680 14:38635932-38635954 CACCAGCAACAGAACAAAGCTGG + Intergenic
1116138055 14:40953928-40953950 CACCAGCAACAGAACAAAGCTGG - Intergenic
1116156631 14:41214355-41214377 CACCAGCAACAGAACAAAGCTGG - Intergenic
1116401672 14:44515211-44515233 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1116404990 14:44556656-44556678 CACCAGCAACAGAACAAAGCTGG - Intergenic
1116431803 14:44854535-44854557 CACCAGCAACAGAACAAAGCTGG + Intergenic
1116482879 14:45412518-45412540 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1116488701 14:45482161-45482183 CACCAGCAACAGAACAAAGCTGG - Intergenic
1116489073 14:45485656-45485678 CACCAGCAACAGAACAAAGCTGG - Intergenic
1116696835 14:48188068-48188090 CACCAGCAACAGAACAAAGCTGG + Intergenic
1117081782 14:52158880-52158902 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1117204274 14:53424877-53424899 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1117489284 14:56229713-56229735 CACCAGCAACAGAACAAAGCTGG + Intronic
1117856672 14:60041769-60041791 CGCCAGCAACAGAACAAAGCTGG - Intronic
1117952497 14:61097286-61097308 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1118053056 14:62050491-62050513 CACCAGCAACAGAACAAAGCTGG - Intronic
1118095929 14:62536812-62536834 CACCAGCAACAGAACAAAGCTGG + Intergenic
1118144496 14:63121731-63121753 CACCAGCAACAGAACAAAGCTGG - Intergenic
1118415106 14:65527582-65527604 GGCCAGCAACAGAACAAAGCTGG - Intronic
1118958232 14:70502422-70502444 CACCAGCAACAGAACAAAGCTGG + Intergenic
1119224948 14:72937866-72937888 GCTCAGCACCAGCAAAAGGCTGG - Intronic
1119642673 14:76326935-76326957 GCCCAGCACCAGCACAGCCTCGG + Intronic
1120002013 14:79313955-79313977 CACCAGCAACAGAACAAAGCTGG - Intronic
1120084201 14:80250704-80250726 CACCAGCAACAGAACAAAGCTGG - Intronic
1120552291 14:85886580-85886602 CACCAGCAACAGAACAAAGCTGG + Intergenic
1120569583 14:86101036-86101058 AACCAGCAACAGAACAAAGCTGG - Intergenic
1121759579 14:96433698-96433720 TGCCAGCAACAGAACAAAGCTGG - Intronic
1122288966 14:100669227-100669249 GCCCAGCACCAGCACCTGGCAGG - Intergenic
1122771274 14:104099008-104099030 GCCCAGCACCAGCACTGGGCAGG - Intronic
1122871602 14:104641290-104641312 GCCCAGCCCCAGCACAGCCCTGG - Intergenic
1123157944 14:106247936-106247958 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1202928100 14_KI270725v1_random:11512-11534 CACCAGCAACAGAACAAAGCTGG + Intergenic
1202932677 14_KI270725v1_random:53481-53503 CACCAGCAACAGAACAAAGCTGG - Intergenic
1123790558 15:23715055-23715077 CACCAGCAACAGAACAAAGCTGG + Intergenic
1124569894 15:30853625-30853647 CACCAGCAACAGAACAAAGCTGG - Intergenic
1125055603 15:35356302-35356324 CACCAGCAACAGAACAAAGCTGG - Intronic
1125226702 15:37404481-37404503 CACCAGCAACAGAACAAAGCTGG - Intergenic
1125412742 15:39421549-39421571 CACCAGCAACAGAACAAAGCTGG + Intergenic
1126255044 15:46615417-46615439 CACCAGCAACAGAACAAAGCTGG + Intergenic
1126265060 15:46744505-46744527 CACCAGCAACAGAACAAAGCTGG - Intergenic
1126395509 15:48211398-48211420 GCACAGCTACAGCACATTGCAGG - Intronic
1126505245 15:49396969-49396991 CACCAGCAACAGAACAAAGCTGG + Intronic
1126707712 15:51422240-51422262 CACCAGCAACAGAACAAAGCTGG - Intergenic
1126854554 15:52825084-52825106 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1127037130 15:54931093-54931115 CACCAGCAACAGAACAAAGCTGG - Intergenic
1127138106 15:55945127-55945149 CGCCAGCAACAGAACAAAGCTGG + Intronic
1127524921 15:59783690-59783712 TGCCAGCAACAGGACAAAGCTGG - Intergenic
1127945163 15:63744292-63744314 GCACAGCACCAGCACAGCACTGG + Intronic
1128696690 15:69770131-69770153 CGCCAGCAACAGTACAAAGCTGG + Intergenic
1128827197 15:70730114-70730136 CACCAGCAACAGAACAAAGCTGG + Intronic
1128872759 15:71175109-71175131 CACCAGCAACAGAACAAAGCTGG + Intronic
1129574352 15:76724945-76724967 CACCAGCAACAGAACAAAGCTGG - Intronic
1129588072 15:76888294-76888316 CACCAGCAACAGAACAAAGCTGG + Intronic
1129796411 15:78380971-78380993 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1129905850 15:79186652-79186674 GCCCAGCAACAGAGCAGAGCAGG - Intergenic
1129940280 15:79490808-79490830 CACCAGCAACAGAACAAAGCTGG - Intergenic
1130190596 15:81731266-81731288 GACCAGCAACGGAACAAAGCTGG + Intergenic
1130205564 15:81871653-81871675 CACCAGCAACAGAACAAAGCTGG + Intergenic
1130326762 15:82887914-82887936 CACCAGCAACAGAACAAAGCTGG - Intronic
1130391040 15:83455828-83455850 CACCAGCAACAGAACAAAGCTGG - Intronic
1130798309 15:87234770-87234792 CACCAGCAACAGAACAAAGCTGG - Intergenic
1130800153 15:87254763-87254785 CACCAGCAACAGAACAAAGCTGG - Intergenic
1130802521 15:87280336-87280358 GACCAGCAACGGAACAAAGCTGG - Intergenic
1130822629 15:87510874-87510896 CACCAGCAACAGAACAAAGCTGG + Intergenic
1131331319 15:91501606-91501628 CACCAGCAACAGAACAAAGCTGG + Intergenic
1131584299 15:93676385-93676407 CACCAGCAACAGAACAAAGCTGG + Intergenic
1132602880 16:781777-781799 GCCCAGCAGCAGCAGGACGGGGG - Intronic
1132884928 16:2178424-2178446 GCCCTGCAGAAGCACAACTCCGG - Exonic
1133801802 16:9091200-9091222 GCCCAGCGACCGCACCCCGCGGG - Intergenic
1133860340 16:9589515-9589537 CACCAGCAACAGAACAAAGCTGG - Intergenic
1134264623 16:12682526-12682548 GCTCAGCAACAGCAGAACTGAGG - Intronic
1134775005 16:16845561-16845583 CACCAGCAACAGAACAAAGCTGG - Intergenic
1136780031 16:32892294-32892316 CACCAGCAACAGAACAAAGCTGG + Intergenic
1136889353 16:33957602-33957624 CACCAGCAACAGAACAAAGCTGG - Intergenic
1136890579 16:33969233-33969255 CACCAGCAACAGAACAAAGCTGG - Intergenic
1136908798 16:34129151-34129173 CACCAGCAACAGAACAAAGCTGG - Intergenic
1136983126 16:35075896-35075918 CACCAGCAACAGAACAAAGCTGG + Intergenic
1137041029 16:35613500-35613522 CACCAGCAACAGAACAAAGCTGG - Intergenic
1137383430 16:48020483-48020505 CACCAGCAACAGAACAAAGCTGG - Intergenic
1138076054 16:54043079-54043101 CACCAGCAACAGAACAAAGCTGG + Intronic
1138162347 16:54766113-54766135 TCCCAGCAACTGCACAAAGAGGG - Intergenic
1138357259 16:56392336-56392358 CACCAGCAACAGAACAAAGCTGG + Intronic
1138782933 16:59810408-59810430 TGCCAGCAACAGAACAATGCTGG + Intergenic
1139105362 16:63820781-63820803 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1139271882 16:65690984-65691006 CACCAGCAACAGAACAAAGCTGG + Intergenic
1139298974 16:65927806-65927828 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1139376062 16:66497090-66497112 CACCAGCAACAGAACAAAGCTGG + Intronic
1139464749 16:67148505-67148527 TCCCAGCAACAGCACATGGCAGG - Exonic
1139683950 16:68588498-68588520 CACCAGCAACAGAACAAAGCTGG - Intergenic
1140054038 16:71510202-71510224 GGCCAGCAACAGAACAAAGCTGG - Intronic
1141387823 16:83638250-83638272 CACCAGCAACAGAACAAAGCTGG + Intronic
1203082452 16_KI270728v1_random:1154381-1154403 CACCAGCAACAGAACAAAGCTGG + Intergenic
1142936878 17:3342292-3342314 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1144448681 17:15355769-15355791 CACCAGCAACAGAACAAGGCTGG + Intergenic
1146312701 17:31781504-31781526 CACCAGCAACAGAACAAAGCTGG + Intergenic
1146562022 17:33878230-33878252 CACCAGCAACAGAACAAAGCTGG + Intronic
1146908299 17:36631976-36631998 GCCAAGCTACAGAACAACCCAGG + Intergenic
1146938193 17:36825676-36825698 GCCCAGCCAAGGCACAGCGCGGG + Intergenic
1147764347 17:42823838-42823860 GTCCAACAACAGCACCATGCAGG - Exonic
1148950426 17:51306060-51306082 CACCAGCAACAGAACAAAGCTGG + Intergenic
1149323180 17:55502696-55502718 CACCAGCAACAGAACAAAGCTGG + Intergenic
1149886104 17:60341929-60341951 CGCCAGCAACAGAACAAAGCAGG - Intronic
1150595541 17:66601604-66601626 CACCAGCAACAGAACAAAGCTGG - Intronic
1150811840 17:68362978-68363000 GCACAGCACCAGCACATCACTGG - Intronic
1151008031 17:70459941-70459963 CACCAGCAACAGAACAAAGCTGG + Intergenic
1151015572 17:70549836-70549858 CACCAGCAACAGAACAAAGCTGG - Intergenic
1152828144 17:82480345-82480367 GACCAGCAACAGCTCCACGCCGG + Intronic
1153058867 18:975876-975898 CACCAGCAACAGAACAAAGCTGG - Intergenic
1153429986 18:5005115-5005137 CACCAGCAACAGAACAAAGCTGG + Intergenic
1153494720 18:5685653-5685675 CACCAGCAACAGAACAAAGCTGG + Intergenic
1153553102 18:6282969-6282991 GCCCATCAGCAGCACAAGCCAGG - Intronic
1153790830 18:8578240-8578262 CACCAGCAACAGAACAAAGCTGG - Intergenic
1154364178 18:13690871-13690893 CACCAGCAACAGGACAAAGCTGG + Intronic
1154414041 18:14163761-14163783 CACCAGCAACAGAACAAAGCTGG + Intergenic
1156308223 18:35898587-35898609 CACCAGCAACAGAACAAAGCTGG + Intergenic
1156433540 18:37101139-37101161 CACCAGCAACAGAACAAAGCTGG + Intronic
1156531491 18:37820723-37820745 CACCAGCAACAGAACAAAGCTGG + Intergenic
1156855463 18:41776001-41776023 CACCAGCAACAGAACAAAGCTGG + Intergenic
1157039649 18:44023822-44023844 CACCAGCAACAGAACAAAGCAGG - Intergenic
1157658976 18:49421618-49421640 CGCCAGCAACAGAACAAAGCTGG + Intronic
1158168920 18:54574518-54574540 CACCAGCAACAGAACAAAGCTGG - Intergenic
1158271366 18:55720521-55720543 CACCAGCAACAGAACAAAGCTGG - Intergenic
1158469259 18:57720218-57720240 CACCAGCAACAGAACAAAGCTGG + Intronic
1158994827 18:62907278-62907300 CACCAGCAACAGAACAAAGCTGG + Intronic
1159631220 18:70751574-70751596 CACCAGCAACAGAACAAAGCTGG - Intergenic
1159633487 18:70777907-70777929 GCTCAGCAATAGCACAACATAGG - Intergenic
1159810983 18:73017543-73017565 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1160093446 18:75847837-75847859 CACCAGCAACAGAACAAAGCTGG + Intergenic
1160260551 18:77290373-77290395 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1160485606 18:79289631-79289653 CACCAGCAACAGAACAAAGCTGG - Intronic
1161195554 19:2984264-2984286 GCCCAGCAGCAGCAAATCCCAGG - Intronic
1161453942 19:4361098-4361120 GCCCATCACCAGCACCAGGCTGG + Exonic
1162580799 19:11529092-11529114 GCCCAGCAACAAGACAGAGCTGG - Exonic
1163002397 19:14376231-14376253 GCCCAGCACCCGCACAAGCCTGG - Intergenic
1163972180 19:20808818-20808840 CACCAGCAACAGAACAAAGCTGG + Intronic
1163974986 19:20842112-20842134 AACCAGCAACAGAACAAAGCTGG + Intronic
1164248513 19:23456765-23456787 CTCCAGCAACAGAACAAAGCTGG - Intergenic
1164294190 19:23895450-23895472 CACCAGCAACAGAACAAAGCTGG - Intergenic
1164555486 19:29247970-29247992 ACACAGAAACAGCACCACGCTGG - Intergenic
1165270706 19:34705401-34705423 CACCAGCAACAGAACAAAGCTGG - Intergenic
1165563508 19:36702944-36702966 CACCAGCAACAGAACAAAGCTGG - Intronic
1165607445 19:37117593-37117615 CACCAGCAACAGAACAAAGCTGG + Intronic
1165957038 19:39507462-39507484 GACCAGCAAGAGCGCAGCGCCGG - Exonic
1166156312 19:40913780-40913802 CACCAGCAACAGAACAAAGCTGG + Intergenic
1167618270 19:50548075-50548097 TCACAGCAACACCTCAACGCAGG + Intronic
1168269972 19:55244503-55244525 GCCCAGCAATAGCACAGGCCAGG + Intronic
1168670101 19:58234445-58234467 ACCCAGCAAGGGCACAACCCTGG - Intronic
925431563 2:3799387-3799409 CACCAGCAACAGAACAAAGCTGG - Intronic
925520172 2:4734714-4734736 CACCAGCAACAGAACAAAGCTGG + Intergenic
926068314 2:9862065-9862087 CACCAGCAACAGAACAAAGCTGG + Intronic
926230587 2:11001129-11001151 CACCAGCAACAGAACAAAGCTGG - Intergenic
926568661 2:14506474-14506496 CGCCAGCAACAGAACAAAGCTGG - Intergenic
926793387 2:16598751-16598773 CACCAGCAACAGAACAAAGCTGG - Intronic
926925964 2:17988139-17988161 CACCAGCAACAGAACAAAGCAGG - Intronic
927575438 2:24198434-24198456 CACCAGCAACAGAACAAAGCTGG - Intronic
928390423 2:30905183-30905205 CACCAGCAACAGAACAAAGCTGG + Intergenic
928487771 2:31749631-31749653 CACCAGCAACAGAACAAAGCTGG + Intergenic
928818161 2:35324774-35324796 CACCAGCAACAGAACAAAGCTGG - Intergenic
928837746 2:35568074-35568096 CACCAGCAACAGAACAAAGCTGG - Intergenic
928882846 2:36117530-36117552 CGCCAGCAACAGAACAAAGCTGG - Intergenic
930150806 2:48057912-48057934 CGCCAGCAACAGAACAAAGCTGG - Intergenic
930268875 2:49232689-49232711 CGCCAGCAACAGAACAAAGCTGG - Intergenic
930868066 2:56142156-56142178 CACCAGCAACAGAACAAAGCTGG - Intergenic
931048697 2:58386558-58386580 CACCAGCAACAGAACAAAGCTGG - Intergenic
931130246 2:59327415-59327437 CACCAGCAACAGAACAAAGCTGG + Intergenic
931204561 2:60135225-60135247 CACCAGCAACAGAACAAAGCTGG - Intergenic
931530778 2:63211582-63211604 TGCCAGCAACAGAACAAAGCTGG + Intronic
931698840 2:64892128-64892150 CACCAGCAACAGAACAAAGCTGG + Intergenic
931759577 2:65404868-65404890 CCCCAACAACAGCACACCCCTGG + Intronic
931885643 2:66614628-66614650 CGCCAGCAACAGAACAAAGCTGG - Intergenic
931887362 2:66632104-66632126 CACCAGCAACAGAACAAAGCTGG - Intergenic
932483534 2:72064953-72064975 CACCAGCAACAGAACAAAGCTGG + Intergenic
932540246 2:72643913-72643935 TGCCAGCAACAGAACAAAGCTGG + Intronic
932581699 2:72996307-72996329 GCCCAGCAAGAGCTCAGCTCTGG + Intronic
933018621 2:77162941-77162963 CACCAGCAACAGAACAAAGCTGG + Intronic
933050330 2:77593802-77593824 CACCAGCAACAGAACAAAGCTGG + Intergenic
933366613 2:81361983-81362005 TGCCAGCAACAGAACAAAGCTGG - Intergenic
933499176 2:83089786-83089808 CACCAGCAACAGAACAAAGCTGG + Intergenic
933519162 2:83348460-83348482 CACCAGCAACAGAACAAAGCTGG + Intergenic
933879956 2:86660262-86660284 CACCAGCAACAGAACAAAGCTGG - Intronic
934531711 2:95093848-95093870 CGCCAGCAACAGAACAAAGCTGG + Intronic
934627225 2:95870637-95870659 CACCAGCAACAGAACAAAGCTGG + Intronic
934806336 2:97230658-97230680 CACCAGCAACAGAACAAAGCTGG - Intronic
935256766 2:101316460-101316482 TGCCAGCAACAGAACAAAGCTGG + Intergenic
935392784 2:102571379-102571401 CACCAGCAACAGAACAAAGCTGG - Intergenic
935604628 2:104958636-104958658 CACCAGCAACAGAACAAAGCTGG - Intergenic
935938490 2:108213573-108213595 CACCAGCAACAGAACAAAGCTGG - Intergenic
936172963 2:110192129-110192151 CACCAGCAACAGAACAAAGCTGG + Intronic
936267866 2:111023956-111023978 GCCCAGCACTAGCAAAACACTGG - Intronic
936436174 2:112508834-112508856 CACCAGCAACAGAACAAAGCTGG - Intronic
936457836 2:112688836-112688858 GCCCACCAACAGCAGAATCCTGG - Intergenic
936782760 2:116053960-116053982 CACCAGCAACAGAACAAAGCTGG - Intergenic
936873129 2:117157009-117157031 CACCAGCAACAGAACAAAGCTGG + Intergenic
936909984 2:117580351-117580373 TGCCAGCAACAGAACAAAGCTGG + Intergenic
936930114 2:117779276-117779298 CACCAGCAACAGAACAAAGCTGG + Intergenic
937452930 2:122017698-122017720 CACCAGCAACAGAACAAAGCTGG - Intergenic
937592400 2:123629701-123629723 CACCAGCAACAGAACAAAGCTGG + Intergenic
937780089 2:125826641-125826663 CACCAGCAACAGAACAAAGCTGG + Intergenic
937809376 2:126183056-126183078 CACCAGCAACAGAACAAAGCTGG - Intergenic
938205303 2:129416395-129416417 CACCAGCAACAGAACAAAGCTGG - Intergenic
938233901 2:129686028-129686050 CACCAGCAACAGAACAAAGCTGG - Intergenic
938498266 2:131815543-131815565 CACCAGCAACAGAACAAAGCTGG + Intergenic
938854524 2:135296599-135296621 CACCAGCAACAGAACAAAGCTGG - Intronic
938862310 2:135381965-135381987 CACCAGCAACAGAACAAAGCTGG + Intronic
938987898 2:136597160-136597182 CACCAGCAACAGAACAAAGCTGG + Intergenic
939346318 2:140970540-140970562 CGCCAGCAACAGAACAAAGCTGG - Intronic
939544984 2:143541396-143541418 CACCAGCAACAGAACAAAGCTGG - Intronic
939572969 2:143861942-143861964 CACCAGCAACAGAACAAAGCTGG + Intergenic
939893776 2:147767628-147767650 CACCAGCAACAGAACAAAGCTGG + Intergenic
939927295 2:148189728-148189750 CACCAGCAACAGAACAAAGCTGG + Intronic
939939089 2:148327860-148327882 CACCAGCAACAGAACAAAGCTGG - Intronic
940380710 2:153012791-153012813 CACCAGCAACAGAACAAAGCTGG - Intergenic
940417358 2:153438839-153438861 CACCAGCAACAGAACAAAGCTGG - Intergenic
940573577 2:155471640-155471662 CACCAGCAACAGAACAAAGCTGG - Intergenic
940741707 2:157516129-157516151 CACCAGCAACAGAACAAAGCTGG + Intergenic
940745960 2:157567338-157567360 CACCAGCAACAGAACAAAGCTGG + Intronic
940827960 2:158434590-158434612 CACCAGCAACAGAACAAAGCTGG + Intronic
940836111 2:158523604-158523626 CACCAGCAACAGAACAAAGCTGG + Intronic
940919777 2:159294128-159294150 CACCAGCAACAGAACAAAGCTGG - Intergenic
941458303 2:165736687-165736709 CACCAGCAACAGAACAAAGCTGG - Intergenic
941550738 2:166912627-166912649 CGCCAGCAACAGAACAAAGCTGG - Intronic
941553052 2:166940465-166940487 CGCCAGCAACAGAACAAAGCTGG - Intronic
941556590 2:166989444-166989466 CACCAGCAACAGAACAAAGCTGG + Intronic
941767387 2:169313230-169313252 CACCAGCAACAGAACAAAGCTGG - Intronic
941895725 2:170627570-170627592 CACCAGCAACAGAACAAAGCTGG - Intronic
941896198 2:170631022-170631044 TGCCAGCAACAGAACAAAGCTGG + Intronic
942000904 2:171646297-171646319 CACCAGCAACAGAACAAAGCTGG - Intergenic
942065696 2:172269721-172269743 CGCCAGCAACAGAACAAAGCTGG - Intergenic
942071161 2:172316252-172316274 CACCAGCAACAGAACAAAGCTGG + Intergenic
942285186 2:174409478-174409500 CACCAGCAACAGAACAAAGCTGG - Intronic
942390401 2:175486990-175487012 CACCAGCAACAGAACAAAGCTGG - Intergenic
942416114 2:175760580-175760602 CACCAGCAACAGAACAAAGCTGG + Intergenic
942467393 2:176223279-176223301 CGCCAGCAACAGAACAAAGCTGG - Intergenic
942633264 2:177974059-177974081 CACCAGCAACAGAACAAAGCTGG + Intronic
942731532 2:179066191-179066213 CACCAGCAACAGAACAAAGCTGG - Intergenic
942790610 2:179756982-179757004 TGCCAGCAACAGAACAAAGCTGG - Intronic
942879181 2:180838684-180838706 CACCAGCAACAGAACAAAGCTGG - Intergenic
943147573 2:184065174-184065196 CCCCAGCAAGAGCACAAAACTGG - Intergenic
943549426 2:189320288-189320310 CACCAGCAACAGAACAAAGCTGG + Intergenic
943558314 2:189431308-189431330 CACCAGCAACAGAACAAAGCTGG + Intergenic
943583626 2:189712737-189712759 TGCCAGCAACAGAACAAAGCTGG + Intronic
943710901 2:191093703-191093725 TGCCAGCAACAGAACAAAGCTGG + Intronic
943866434 2:192930200-192930222 GGCCAGCAATAGAACAAAGCTGG - Intergenic
943886009 2:193217441-193217463 CACCAGCAACAGAACAAAGCTGG - Intergenic
943929871 2:193835888-193835910 CACCAGCAACAGAACAAAGCTGG - Intergenic
944030549 2:195229421-195229443 CACCAGCAACAGAACAAAGCTGG + Intergenic
944182144 2:196906573-196906595 CACCAGCAACAGAACAAAGCTGG + Intronic
944196898 2:197063425-197063447 CGCCAGCAACAGAACAAAGCTGG + Intronic
944257556 2:197639759-197639781 CACCAGCAACAGAACAAAGCTGG - Intronic
944266264 2:197729935-197729957 CACCAGCAACAGAACAAAGCTGG + Intronic
944599824 2:201291648-201291670 CGCCAGCAACAGAACAAAGCTGG + Intronic
944612902 2:201429869-201429891 CGCCAGCAACAGAACAAAGCTGG - Intronic
945481626 2:210351730-210351752 CACCAGCAACAGAACAAAGCTGG + Intergenic
945597366 2:211812052-211812074 CACCAGCAACAGAACAAAGCTGG - Intronic
945669551 2:212786234-212786256 CACCAGCAACAGAACAAAGCTGG + Intergenic
945677833 2:212876802-212876824 CGCCAGCAACAGAACAAAGCTGG + Intergenic
945733712 2:213572257-213572279 CACCAGCAACAGAACAAAGCTGG - Intronic
945788724 2:214277314-214277336 CACCAGCAACAGAACAAAGCTGG - Intronic
945873633 2:215254077-215254099 GACCAGCAACTGAACAAAGCTGG + Intergenic
946172727 2:217905219-217905241 TCCCAGAAACATCACAAAGCGGG + Intronic
946294371 2:218772304-218772326 TGCCAGCAACAGAACAAAGCTGG - Intergenic
946468396 2:219932804-219932826 CACCAGCAACAGAACAAAGCTGG + Intergenic
946787031 2:223258423-223258445 CACCAGCAACAGAACAAAGCTGG - Intergenic
947242122 2:228006559-228006581 CACCAGCAACAGAACAAAGCTGG - Intronic
947262016 2:228234049-228234071 CACCAGCAACAGAACAAAGCTGG - Intergenic
947290597 2:228569246-228569268 CACCAGCAACAGAACAAAGCTGG + Intergenic
947306825 2:228756680-228756702 CACCAGCAACAGAACAAAGCTGG + Intergenic
947348445 2:229218492-229218514 TGCCAGCAACAGCACAAGGCAGG + Intronic
947465496 2:230341511-230341533 CACCAGCAACAGAACAAAGCTGG - Intronic
947692657 2:232154222-232154244 CACCAGCAACAGAACAAAGCTGG - Intronic
947736075 2:232456210-232456232 GCCCAGCAGCAGCAGCACCCAGG - Exonic
948864272 2:240767538-240767560 GCCCACCAACAGCAGCAGGCCGG + Intronic
948894143 2:240920493-240920515 GCCCAGCACTGGCACAAAGCTGG + Intronic
1169589125 20:7121206-7121228 CACCAGCAACAGAACAAAGCTGG - Intergenic
1169672055 20:8113907-8113929 CACCAGCAACAGAACAAAGCTGG - Intergenic
1170002855 20:11633760-11633782 CACCAGCAACAGAACAAAGCTGG + Intergenic
1170049665 20:12128707-12128729 CACCAGCAACAGAACAAAGCTGG - Intergenic
1170082587 20:12492708-12492730 CACCAGCAACAGAACAAAGCTGG + Intergenic
1170111136 20:12806040-12806062 CACCAGCAACAGAACAAAGCTGG - Intergenic
1170719722 20:18866232-18866254 CACCAGCAACAGAACAAAGCTGG - Intergenic
1170826086 20:19797116-19797138 TCCCAGCATCAGCATAACGCAGG + Intergenic
1171054088 20:21888641-21888663 CACCAGCAACAGAACAAAGCTGG + Intergenic
1171224223 20:23427093-23427115 CACCAGCAACAGAACAAAGCTGG + Intergenic
1171776221 20:29371076-29371098 CACCAGCAACAGAACAAAGCTGG - Intergenic
1171814188 20:29768808-29768830 CACCAGCAACAGAACAAAGCTGG + Intergenic
1171941494 20:31333819-31333841 CACCAGCAACAGAACAAAGCTGG + Intergenic
1173543748 20:43876156-43876178 CACCAGCAACAGAACAAAGCTGG - Intergenic
1174166647 20:48588245-48588267 CACCAGCAACAGAACAAAGCTGG + Intergenic
1174223965 20:48982008-48982030 CCCCAGCAACAGAACAAAGATGG - Intronic
1175022032 20:55860549-55860571 CACCAGCAACAGAACAAAGCTGG + Intergenic
1175026151 20:55905264-55905286 CACCAGCAACAGAACAAAGCCGG - Intergenic
1175512093 20:59536797-59536819 CACCAGCAACAGAACAAAGCTGG - Intergenic
1176858991 21:13994488-13994510 CACCAGCAACAGAACAAAGCTGG - Intergenic
1179301061 21:40110538-40110560 CACCAGCAACAGAACAAAGCTGG + Intronic
1179766656 21:43578774-43578796 GCCCAGAAACAGCACAGGGTAGG - Intronic
1180428218 22:15219660-15219682 CACCAGCAACAGAACAAAGCTGG - Intergenic
1180458519 22:15536071-15536093 CACCAGCAACAGAACAAAGCTGG - Intergenic
1181353705 22:22281810-22281832 TACCAGCAACAGAACAAAGCTGG - Intergenic
1182209690 22:28664269-28664291 CACCAGCAACAGAACAAAGCTGG + Intronic
1182982074 22:34682387-34682409 CACCAGCAACAGAACAAAGCTGG - Intergenic
1184524196 22:45012040-45012062 GCCCAGCAAAAGCACTAAGGAGG - Intergenic
1184662789 22:45973024-45973046 GCTCAGCACCAGCACAAGGCTGG - Intronic
1184886649 22:47350562-47350584 CACCAGCAACAGAACAAAGCTGG - Intergenic
1185123602 22:48990786-48990808 CACCAGCAACAGAACAAAGCTGG - Intergenic
949224953 3:1682767-1682789 CACCAGCAACAGAACAAAGCTGG + Intergenic
949527365 3:4917521-4917543 CACCAGCAACAGAACAAAGCTGG + Intergenic
949632464 3:5943577-5943599 CGCCAGCAACAGAACAAAGCTGG - Intergenic
949816790 3:8067645-8067667 CGCCAGCAACAGAACAAAGCTGG - Intergenic
950302717 3:11895284-11895306 CGCCAGCAACAGAACAAAGCTGG + Intergenic
951086397 3:18517066-18517088 CACCAGCAACAGAACAAAGCTGG + Intergenic
951121605 3:18935514-18935536 CACCAGCAACAGAACAAAGCTGG - Intergenic
951386722 3:22052518-22052540 CACCAGCAACAGAACAAAGCTGG - Intronic
951493667 3:23301303-23301325 CACCAGCAACAGAACAAAGCTGG - Intronic
951592412 3:24280559-24280581 CACCAGCAACAGAACAAAGCTGG + Intronic
951751495 3:26041639-26041661 CACCAGCAACAGAACAAAGCCGG - Intergenic
951784489 3:26403042-26403064 CACCAGCAACAGAACAAAGCTGG - Intergenic
951964632 3:28369178-28369200 CACCAGCAACGGAACAACGCTGG - Intronic
952319590 3:32263572-32263594 CACCAGCAACAGAACAAAGCTGG + Intronic
952437393 3:33286057-33286079 TGCCAGCAACAGAACAAAGCTGG - Intronic
952513896 3:34084737-34084759 CACCAGCAACAGAACAAAGCTGG - Intergenic
952517590 3:34121596-34121618 CGCCAGCAACAGAACAAAGCTGG - Intergenic
952547117 3:34432756-34432778 CACCAGCAACAGAACAAAGCTGG - Intergenic
952680323 3:36083841-36083863 CACCAGCAACAGAACAAAGCTGG + Intergenic
952709389 3:36414688-36414710 TACCAGCAACAGAACAAAGCTGG - Intronic
952884389 3:38003560-38003582 GCCCAGGACCAGGACAATGCAGG - Intronic
953359887 3:42286942-42286964 CACCAGCAACAGAACAAAGCTGG - Intergenic
953894697 3:46788131-46788153 CACCAGCAACAGAACAAAGCTGG - Intronic
954572040 3:51648917-51648939 TGCCAGCAACAGAACAAAGCTGG + Intronic
954943776 3:54399337-54399359 CACCAGCAACAGAACAAAGCTGG - Intronic
955282534 3:57607363-57607385 CACCAGCAACAGAACAAAGCTGG + Intergenic
955464805 3:59225856-59225878 CGCCAGCAACAGAACAAAGCTGG - Intergenic
955504241 3:59614948-59614970 CACCAGCAACAGAACAAAGCTGG + Intergenic
955854354 3:63256691-63256713 CACCAGCAACAGAACAAAGCTGG + Intronic
956265791 3:67394144-67394166 CACCAGCAACAGAACAAAGCTGG + Intronic
956993395 3:74795226-74795248 CACCAGCAACAGAACAAAGCTGG + Intergenic
957101720 3:75836777-75836799 CACCAGCAACAGAACAAAGCTGG - Intergenic
957250730 3:77768702-77768724 CACCAGCAACAGAACAAAGCTGG - Intergenic
958011340 3:87883437-87883459 TGCCAGCAACAGAACAAAGCTGG + Intergenic
958134080 3:89465850-89465872 CACCAGCAACAGAACAAAGCTGG - Intronic
958171342 3:89944109-89944131 CACCAGCAACAGAACAAAGCTGG - Intergenic
958185062 3:90110012-90110034 TCCCAGCAACGGAACAAAGCTGG - Intergenic
958190143 3:90174592-90174614 CACCAGCAACAGAACAAAGCTGG - Intergenic
958202233 3:90335057-90335079 CACCAGCAACAGAACAAAGCTGG + Intergenic
958496199 3:94847014-94847036 CACCAGCAACAGAACAAAGCTGG + Intergenic
958873591 3:99589984-99590006 CGCCAGCAACAGAACAAAGCTGG + Intergenic
959353504 3:105297205-105297227 CACCAGCAACAGAACAAAGCTGG + Intergenic
959554042 3:107697217-107697239 CACCAGCAACAGAACAAAGCTGG - Intronic
959607598 3:108258664-108258686 CACCAGCAACAGAACAAAGCTGG + Intergenic
959651008 3:108750379-108750401 CACCAGCAACAGAACAAAGCTGG + Intronic
959667777 3:108941000-108941022 GCCCAGCAACAGGAGAGTGCAGG - Intronic
959691334 3:109200857-109200879 CACCAGCAACAGAACAAAGCTGG + Intergenic
959953821 3:112212328-112212350 CACCAGCAACAGAACAAAGCCGG + Intronic
960153889 3:114277871-114277893 CACCAGCAACAGAACAAAGCTGG + Intronic
960331077 3:116360981-116361003 CACCAGCAACAGAACAAAGCTGG + Intronic
960565906 3:119131166-119131188 TGCCAGCAACAGAACAAAGCTGG + Intronic
960612467 3:119568190-119568212 TACCAGCAACAGAACAAAGCTGG - Intergenic
960763106 3:121095805-121095827 CACCAGCAACAGAACAAAGCTGG - Intronic
960890757 3:122445018-122445040 CGCCAGCAACAGAACAAAGCTGG + Intronic
961012850 3:123447928-123447950 GCCCAGGGACAGCACCGCGCCGG + Exonic
961330015 3:126132867-126132889 GCCCAGCTCCAGCACAGCACTGG + Intronic
961376388 3:126468861-126468883 GACCAGCAACAGCACAGTGGGGG - Intronic
961940162 3:130629019-130629041 CACCAGCAACAGAACAAAGCTGG + Intronic
962156095 3:132951029-132951051 CACCAGCAACAGAACAAAGCTGG - Intergenic
962180267 3:133199306-133199328 CGCCAGCAACAGAACAAAGCTGG - Intronic
962397520 3:135030243-135030265 CACCAGCAACAGAACAAAGCTGG - Intronic
962466036 3:135659589-135659611 CACCAGCAACAGAACAAAGCTGG + Intergenic
962524574 3:136225407-136225429 CACCAGCAACAGAACAAAGCTGG + Intergenic
962548704 3:136466125-136466147 CACCAGCAACAGAACAAAGCTGG + Intronic
962656084 3:137544812-137544834 TGCCAGCAACAGAACAAAGCTGG + Intergenic
962690960 3:137897714-137897736 CACCAGCAACAGAACAAAGCTGG + Intergenic
962834045 3:139171496-139171518 CGCCAGCAACAGAACAAAGCTGG - Intronic
963070380 3:141300558-141300580 CGCCAGCAACAGAACAAAGCTGG - Intergenic
963435125 3:145257638-145257660 CACCAGCAACAGAACAAAGCTGG - Intergenic
963484522 3:145919010-145919032 CACCAGCAACAGAACAAAGCTGG + Intergenic
963485405 3:145928759-145928781 CACCAGCAACAGAACAAAGCTGG + Intergenic
963595113 3:147316655-147316677 CACCAGCAACAGAACAAAGCTGG - Intergenic
964563221 3:158020662-158020684 CACCAGCAACAGAACAAAGCTGG + Intergenic
964659056 3:159100388-159100410 CACCAGCAACAGAACAAAGCTGG - Intronic
964959987 3:162410889-162410911 CACCAGCAACAGAACAAAGCTGG - Intergenic
965021568 3:163237921-163237943 CACCAGCAACAGAACAAAGCTGG + Intergenic
965161499 3:165139398-165139420 TGCCAGCAACAGAACAAAGCTGG - Intergenic
965271177 3:166618545-166618567 CACCAGCAACAGAACAAAGCTGG + Intergenic
965382913 3:168012014-168012036 CACCAGCAACAGAACAAAGCTGG + Intronic
965522365 3:169680472-169680494 CACCAGCAACAGAACAAAGCTGG + Intergenic
965999172 3:174925829-174925851 TGCCAGCAACAGAACAAAGCTGG + Intronic
966150500 3:176862397-176862419 CACCAGCAACAGAACAAAGCTGG + Intergenic
966335301 3:178860934-178860956 CACCAGCAACAGAACAAAGCTGG + Intergenic
967199191 3:187057330-187057352 CGCCAGCAACAGAACAAAGCTGG - Intronic
967857725 3:194130926-194130948 GCCCAGAAACAGCACATTCCAGG - Intergenic
967985131 3:195088648-195088670 CACCAGCAACAGAACAAAGCTGG + Intronic
968156068 3:196381603-196381625 TGCCAGCAACGGAACAACGCTGG + Intronic
968750886 4:2388389-2388411 GACTATCAACAGCACAACGAGGG + Intronic
969988535 4:11236213-11236235 CACCAGCAACAGAACAAAGCTGG + Intergenic
970020164 4:11558559-11558581 CACCAGCAACAGAACAAAGCTGG + Intergenic
970241508 4:14014478-14014500 CACCAGCAACAGAACAAAGCTGG - Intergenic
970308425 4:14756098-14756120 CACCAGCAACAGAACAAAGCTGG + Intergenic
970414482 4:15842532-15842554 CACCAGCAACAGAACAAAGCTGG + Intronic
970474322 4:16407412-16407434 CACCAGCAACAGAACAAAGCTGG - Intergenic
970527172 4:16943759-16943781 CACCAGCAACAGAACAAAGCTGG + Intergenic
970901093 4:21160375-21160397 CACCAGCAACAGAACAAAGCTGG + Intronic
971113478 4:23615758-23615780 CACCAGCAACAGAACAAAGCTGG + Intergenic
971463071 4:26923348-26923370 CACCAGCAACAGAACAAAGCTGG + Intronic
972388260 4:38588515-38588537 CCCCAGCACCAGAACAATGCTGG - Intergenic
972677552 4:41275439-41275461 CACCAGCAACAGAACAAAGCTGG - Intergenic
973137640 4:46727650-46727672 TGCCAGCAACAGAACAAAGCTGG - Intergenic
973600718 4:52539455-52539477 CACCAGCAACAGAACAAAGCTGG + Intergenic
973630727 4:52817442-52817464 CACCAGCAACAGAACAAAGCTGG + Intergenic
973704275 4:53565620-53565642 CACCAGCAACAGAACAAAGCTGG + Intronic
973984349 4:56336256-56336278 CACCAGCAACAGAACAAAGCTGG - Intergenic
974023785 4:56713736-56713758 CACCAGCAACAGAACAAAGCTGG + Intergenic
974114808 4:57567340-57567362 CACCAGCAACAGAACAAAGCTGG - Intergenic
974228536 4:59079831-59079853 CACCAGCAACAGAACAAAGCTGG + Intergenic
974238102 4:59207567-59207589 CACCAGCAACAGAACAAAGCTGG + Intergenic
974371235 4:61019122-61019144 TGCCAGCAACAGTACAAAGCTGG + Intergenic
974503095 4:62731971-62731993 CACCAGCAACAGAACAAAGCTGG - Intergenic
974690584 4:65293257-65293279 CACCAGCAACAGAACAAAGCTGG - Intergenic
974954368 4:68619870-68619892 CACCAGCAACAGAACAAAGCTGG + Intronic
975034353 4:69661916-69661938 TGCCAGCAACAGAACAAAGCTGG + Intergenic
975085086 4:70329261-70329283 CACCAGCAACAGAACAAAGCTGG + Intergenic
975295689 4:72731485-72731507 CACCAGCAACAGAACAACACTGG + Intergenic
975348489 4:73320508-73320530 CACCAGCAACAGAACAAAGCTGG + Intergenic
975364865 4:73517857-73517879 CACCAGCAACAGAACAAAGCTGG - Intergenic
975522414 4:75314537-75314559 CGCCAGCAACAGAACAAAGCTGG + Intergenic
975805425 4:78106720-78106742 CACCAGCAACAGAACAAAGCTGG + Intronic
975828994 4:78348965-78348987 CACCAGCAACAGAACAAAGCTGG + Intronic
975963297 4:79938702-79938724 CACCAGCAACAGAACAAAGCTGG + Intronic
975965511 4:79967891-79967913 CACCAGCAACAGAACAAAGCTGG + Intronic
976158841 4:82176510-82176532 CACCAGCAACAGAACAAAGCTGG + Intergenic
976371988 4:84299764-84299786 CACCAGCAACAGAACAAAGCTGG + Intergenic
976451404 4:85195506-85195528 CACCAGCAACAGAACAAAGCTGG - Intergenic
976506369 4:85852475-85852497 CGCCAGCAACAGAACAAGGCTGG - Intronic
976524832 4:86075413-86075435 CACCAGCAACAGAACAAAGCTGG - Intronic
976532336 4:86169186-86169208 CACCAGCAACAGAACAAAGCTGG + Intronic
976608673 4:87007016-87007038 GCCCAGCAACAGCACAACGCGGG - Intronic
976642275 4:87352140-87352162 CACCAGCAACAGAACAAAGCTGG - Intronic
976939361 4:90680751-90680773 CACCAGCAACAGAACAAAGCTGG - Intronic
976974796 4:91153537-91153559 TGCCAGCAACAGGACAAAGCTGG - Intronic
977004164 4:91544330-91544352 TGCCAGCAACAGAACAAAGCAGG - Intronic
977023850 4:91791049-91791071 CACCAGCAACAGAACAAAGCTGG - Intergenic
977038064 4:91979197-91979219 CACCAGCAACAGAACAAAGCTGG + Intergenic
977159244 4:93613331-93613353 CACCAGCAACAGAACAAAGCTGG - Intronic
977161661 4:93643332-93643354 CACCAGCAACAGAACAAAGCTGG - Intronic
977353392 4:95915745-95915767 CACCAGCAACAGAACAAAGCTGG + Intergenic
977567603 4:98597456-98597478 CACCAGCAACAGAACAAAGCTGG - Intronic
977630591 4:99238611-99238633 TGCCAGCAACAGAACAAAGCTGG - Intergenic
977906087 4:102479005-102479027 CGCCAGCAACAGAACAAAGCTGG + Intergenic
978020829 4:103809846-103809868 CGCCAGCAACAGAACAAAGCTGG - Intergenic
978140426 4:105312259-105312281 CACCAGCAACAGAACAAAGCTGG - Intergenic
978243096 4:106540128-106540150 TGCCAGCAACAGAACAAAGCTGG - Intergenic
978246243 4:106576066-106576088 CACCAGCAACAGAACAAAGCTGG - Intergenic
978517689 4:109586479-109586501 CACCAGCAACAGAACAAAGCTGG - Intronic
978719917 4:111895785-111895807 CACCAGCAACAGAACAAAGCTGG + Intergenic
978736285 4:112087453-112087475 CACCAGCAACAGAACAAAGCTGG + Intergenic
978756499 4:112308767-112308789 CTCCAGCAACAGAACAAAGCTGG - Intronic
978782994 4:112576400-112576422 CACCAGCAACAGAACAAAGCTGG + Intronic
979112727 4:116780052-116780074 CACCAGCAACAGAACAAAGCTGG - Intergenic
979317204 4:119279120-119279142 CACCAGCAACAGAACAAAGCTGG - Intronic
979376557 4:119953751-119953773 CACCAGCAACAGAACAAAGCTGG - Intergenic
979445067 4:120802829-120802851 TGCCAGCAACAGAACAAAGCTGG + Intronic
979599670 4:122574204-122574226 CACCAGCAACGGCACAAAGCTGG - Intergenic
979634742 4:122944655-122944677 CACCAGCAACAGAACAAAGCTGG - Intronic
979640047 4:123003324-123003346 CACCAGCAACAGAACAAAGCTGG - Intronic
979659675 4:123238800-123238822 TGCCAGCAACAGAACAAAGCTGG + Intronic
979706167 4:123722498-123722520 CACCAGCAACAGAACAAAGCTGG + Intergenic
979739375 4:124130834-124130856 CACCAGCAACAGAACAAAGCTGG - Intergenic
979948720 4:126865874-126865896 CACCAGCAACAGAACAAAGCTGG - Intergenic
979953936 4:126929241-126929263 CACCAGCAACAGAACAAAGCTGG + Intergenic
979999800 4:127473788-127473810 CACCAGCAACAGAACAAAGCTGG + Intergenic
980205999 4:129720503-129720525 CGCCAGCAACAGAACAAAGCTGG - Intergenic
980691242 4:136298542-136298564 CACCAGCAACAGAACAAAGCTGG - Intergenic
980781519 4:137497252-137497274 CACCAGCAACAGAACAAAGCTGG + Intergenic
981293334 4:143101245-143101267 CACCAGCAACAGAACAAAGCTGG + Intergenic
981514800 4:145596331-145596353 CGCCAGCAACAGAACAAAGCTGG - Intergenic
981668338 4:147256150-147256172 CACCAGCAACAGAACAAAGCTGG + Intergenic
982328016 4:154149601-154149623 CACCAGCAACAGAACAAAGCTGG - Intergenic
982684237 4:158468542-158468564 CACCAGCAACAGAACAAAGCTGG - Intronic
982785571 4:159533065-159533087 CGCCAGCAACAGAACAAAGCTGG - Intergenic
983349663 4:166570961-166570983 CACCAGCAACAGAACAAAGCTGG + Intergenic
983362506 4:166744600-166744622 CACCAGCAACAGAACAAAGCTGG + Intronic
983363444 4:166756863-166756885 CACCAGCAACAGAACAAAGCTGG + Intronic
983407434 4:167348536-167348558 CACCAGCAACAGAACAAAGCTGG - Intergenic
983594414 4:169449792-169449814 TGCCAGCAACAGAACAAAGCTGG + Intronic
983598686 4:169499421-169499443 CACCAGCAACAGAACAAAGCTGG - Intronic
983600352 4:169520526-169520548 CACCAGCAACAGAACAAAGCTGG - Intronic
983687890 4:170432407-170432429 CACCAGCAACAGAACAAAGCTGG + Intergenic
983799090 4:171904116-171904138 CACCAGCAACAGAACAAAGCTGG + Intronic
983879174 4:172913355-172913377 CGCCAGCAACAGAACAAAGCTGG + Intronic
984696328 4:182784073-182784095 CACCAGCAACAGAACAAAGCTGG - Intronic
985357659 4:189138063-189138085 CACCAGCAACAGAACAAAGCTGG + Intergenic
985794880 5:1954551-1954573 GGCCAGCAACAGAACAAAGCTGG + Intergenic
986090610 5:4501365-4501387 CACCAGCAACAGAACAAAGCTGG - Intergenic
986530547 5:8731963-8731985 CACCAGCAACAGAACAAAGCTGG + Intergenic
986750345 5:10781041-10781063 CACCAGCAACAGAACAAAGCTGG + Intergenic
986978332 5:13417483-13417505 CACCAGCAACAGAACAAAGCTGG + Intergenic
987232656 5:15911544-15911566 CACCAGCAACAGAACAAAGCTGG - Intronic
987273393 5:16336395-16336417 CACCAGCAACAGAACAAAGCTGG + Intergenic
987279635 5:16399982-16400004 TGCCAGCAACAGAACAAAGCTGG - Intergenic
988003852 5:25383551-25383573 CACCAGCAACAGAACAAAGCTGG - Intergenic
988086119 5:26477027-26477049 CACCAGCAACAGAACAAAGCTGG + Intergenic
988621202 5:32825027-32825049 CACCAGCAACAGAACAAAGCTGG + Intergenic
988746925 5:34148828-34148850 CACCAGCAACAGAACAAAGCTGG + Intergenic
988782714 5:34538028-34538050 GCTCGGGAACAGCAGAACGCAGG - Intergenic
988887376 5:35573241-35573263 CACCAGCAACAGAACAAAGCTGG - Intergenic
989449407 5:41569552-41569574 CACCAGCAACAGAACAAAGCTGG - Intergenic
989522362 5:42417442-42417464 TGCCAGCAACAGAACAAAGCTGG - Intergenic
989653506 5:43718937-43718959 CACCAGCAACAGAACAAAGCTGG + Intergenic
989674165 5:43953991-43954013 CACCAGCAACAGAACAAAGCTGG + Intergenic
989794160 5:45446010-45446032 CACCAGCAACAGAACAAAGCTGG + Intronic
989804340 5:45585544-45585566 CACCAGCAACAGAACAAAGCTGG - Intronic
989820248 5:45787250-45787272 CACCAGCAACAGAACAAAGCTGG + Intergenic
989968088 5:50489003-50489025 CACCAGCAACAGAACAAAGCTGG - Intergenic
990142222 5:52718866-52718888 CACCAGCAACAGAACAAAGCTGG + Intergenic
990179292 5:53142181-53142203 CACCAGCAACAGAACAAAGCTGG + Intergenic
990234428 5:53751613-53751635 CGCCAGCAACAGAACAAAGCTGG + Intergenic
990478728 5:56186818-56186840 GCCCAGAAACAGGACAAAGATGG + Intronic
990713207 5:58607028-58607050 TGCCAGCAACAGAACAAAGCTGG + Intronic
990783720 5:59395704-59395726 CACCAGCAACAGAACAAAGCTGG + Intronic
991167701 5:63582906-63582928 CACCAGCAACAGAACAAAGCTGG + Intergenic
991535503 5:67665854-67665876 CACCAGCAACAGAACAAAGCTGG - Intergenic
992576572 5:78119312-78119334 CACCAGCAACAGAACAAAGCTGG + Intronic
992580829 5:78174210-78174232 CACCAGCAACAGAACAACGCTGG - Intronic
992928576 5:81617074-81617096 CACCAGCAACAGAACAAAGCTGG + Intronic
993043995 5:82847067-82847089 CACCAGCAACAGGACAAAGCTGG - Intergenic
993324083 5:86511675-86511697 CACCAGCAACAGAACAAAGCTGG + Intergenic
993341530 5:86730852-86730874 CACCAGCAACAGAACAAAGCTGG - Intergenic
993366630 5:87042056-87042078 TGCCAGCAACAGAACAAAGCTGG - Intergenic
993370426 5:87085528-87085550 CACCAGCAACAGAACAAAGCTGG + Intergenic
993577753 5:89622641-89622663 CACCAGCAACAGAACAAAGCTGG + Intergenic
993619198 5:90147868-90147890 TGCCAGCAACAGAACAAAGCTGG + Intergenic
994143430 5:96366847-96366869 CACCAGCAACAGAACAAAGCTGG - Intergenic
994160994 5:96556332-96556354 CACCAGCAACAGAACAAAGCTGG + Intronic
994224724 5:97239287-97239309 CACCAGCAACAGAACAAAGCTGG - Intergenic
994230463 5:97305985-97306007 CGCCAGCAACAGAACAAAGCTGG - Intergenic
994280984 5:97902168-97902190 CACCAGCAACAGAACAAAGCTGG - Intergenic
994538387 5:101060782-101060804 CACCAGCAACAGAACAAAGCTGG - Intergenic
994618242 5:102132342-102132364 CACCAGCAACAGAACAAAGCTGG + Intergenic
994623516 5:102190467-102190489 CACCAGCAACAGAACAAAGCTGG + Intergenic
994636673 5:102352413-102352435 TGCCAGCAACAGAACAAAGCTGG + Intergenic
994811035 5:104519571-104519593 CACCAGCAACAGAACAAAGCTGG + Intergenic
994826382 5:104718199-104718221 CACCAGCAACAGAACAAAGCCGG + Intergenic
994882655 5:105518267-105518289 CACCAGCAACAGAACAAAGCTGG - Intergenic
995184831 5:109260372-109260394 CACCAGCAACAGAACAAAGCTGG + Intergenic
995467438 5:112465753-112465775 CACCAGCAACAGAACAAAGCTGG - Intergenic
995676863 5:114671857-114671879 CACCAGCAACAGAACAAAGCTGG + Intergenic
995699637 5:114919831-114919853 CACCAGCAACAGAACAAAGCTGG + Intergenic
996162316 5:120181048-120181070 CACCAGCAACAGAACAAAGCTGG - Intergenic
996455753 5:123679577-123679599 CACCAGCAACAGAACAAAGCTGG - Intergenic
996609643 5:125364021-125364043 CACCAGCAACAGAACAAAGCTGG - Intergenic
996753035 5:126908840-126908862 CACCAGCAACAGAACAAAGCTGG - Intronic
996964321 5:129290250-129290272 CACCAGCAACAGAACAAAGCTGG - Intergenic
997094388 5:130894363-130894385 CGCCAGCAACAGAACAAAGCTGG + Intergenic
997134549 5:131311963-131311985 CACCAGCAACAGAACAAAGCTGG - Intronic
997398695 5:133584253-133584275 CACCAGCAACAGAACAAAGCTGG + Intronic
997432783 5:133852333-133852355 CCCCAGCAACAGAACAAAGCTGG + Intergenic
997849091 5:137314804-137314826 GCTCAGCACCAGCACCAAGCAGG + Intronic
997861572 5:137422804-137422826 CACCAGCAACAGAACAAAGCTGG - Intronic
998877072 5:146610469-146610491 CACCAGCAACAGAACAAAGCTGG + Intronic
999493925 5:152077823-152077845 CACCAGCAACAGAACAAAGCTGG + Intergenic
999568352 5:152891479-152891501 CACCAGCAACAGAACAAAGCTGG - Intergenic
999899018 5:156066956-156066978 CACCAGCAACAGAACAAAGCTGG - Intronic
1000033711 5:157425441-157425463 CACCAGCAACAGAACAAAGCTGG + Intronic
1000144771 5:158443818-158443840 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1000204602 5:159046936-159046958 AGCCAGCTACAGCACAACACTGG + Intronic
1000390065 5:160714634-160714656 CACCAGCAACAGAACAAAGCTGG - Intronic
1000597971 5:163237279-163237301 CACCAGCAACAGAACAAAGCTGG + Intergenic
1000835103 5:166144704-166144726 CACCAGCAACAGAACAAAGCTGG - Intergenic
1000906505 5:166971804-166971826 CACCAGCAACAGAACAAAGCTGG - Intergenic
1001262597 5:170244799-170244821 CACCAGCAACAGAACAAAGCTGG - Intronic
1001359059 5:171063179-171063201 CACCAGCAACAGAACAAAGCTGG - Intronic
1001544671 5:172563598-172563620 CCCCAGCAGCAGCACATCCCAGG + Intergenic
1001662663 5:173407821-173407843 CACCAGCAACAGAACAAAGCTGG - Intergenic
1002216480 5:177638560-177638582 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1002232096 5:177773231-177773253 CACCAGCAACAGAACAAAGCTGG + Intronic
1002657401 5:180761688-180761710 CACCAGCAACAGAACAAAGCTGG - Intergenic
1003010479 6:2422796-2422818 CACCAGCAACAGAACAAAGCTGG - Intergenic
1003726856 6:8775511-8775533 CACCAGCAACAGAACAAAGCTGG - Intergenic
1004643330 6:17536389-17536411 CCCCAGCAAGAGCACAATACCGG - Intronic
1005337972 6:24816700-24816722 CACCAGCAACAGAACAAAGCTGG - Intronic
1005663242 6:28021872-28021894 CACCAGCAACAGAACAAAGCTGG + Intergenic
1007845207 6:44748559-44748581 CACCAGCAACAGAACAAAGCTGG + Intergenic
1007860322 6:44901145-44901167 CACCAGCAACAGAACAAAGCTGG + Intronic
1008281367 6:49599663-49599685 CACCAGCAACAGAACAAAGCTGG + Intergenic
1008349996 6:50478632-50478654 CACCAGCAACAGGACAAAGCTGG + Intergenic
1008470203 6:51875735-51875757 CACCAGCAACAGAACAAAGCTGG + Intronic
1008825264 6:55685643-55685665 CACCAGCAACAGAACAAAGCTGG + Intergenic
1008978516 6:57456807-57456829 CACCAGCAACAGAACAAAGCTGG - Intronic
1009191449 6:60634807-60634829 CACCAGCAACAGAACAAAGCTGG - Intergenic
1009410868 6:63363316-63363338 CACCAGCAACAGAACAAAGCTGG + Intergenic
1009712974 6:67348160-67348182 TCCAAGCAACAGCAGTACGCTGG - Intergenic
1009917246 6:70011332-70011354 CACCAGCAACAGAACAAAGCTGG + Intronic
1009988017 6:70805528-70805550 CGCCAGCAACAGAACAAAGCTGG - Intronic
1010003982 6:70975265-70975287 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1010172857 6:72993679-72993701 CACCAGCAACAGAACAAAGCTGG - Intronic
1010279900 6:74012190-74012212 CACCAGCAACAGAACAAAGCTGG - Intergenic
1010282131 6:74034704-74034726 CACCAGCAACAGAACAAAGCAGG - Intergenic
1010361921 6:75004808-75004830 CACCAGCAACAGAACAAAGCTGG + Intergenic
1010511721 6:76728908-76728930 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1010688427 6:78878614-78878636 CGCCAGCAACAGAACAAAGCTGG + Intronic
1010727133 6:79347875-79347897 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1010747355 6:79578765-79578787 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1010789944 6:80053393-80053415 CACCAGCAACAGAACAAAGCTGG - Intergenic
1010856682 6:80848726-80848748 CACCAGCAACAGAACAAAGCTGG + Intergenic
1010876803 6:81117069-81117091 CACCAGCAACAGAACAAAGCTGG - Intergenic
1010944419 6:81958050-81958072 CACCAGCAACAGGACAAAGCTGG - Intergenic
1010957100 6:82102284-82102306 CACCAGCAACAGAACAAAGCTGG + Intergenic
1010961620 6:82152034-82152056 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1010997553 6:82551007-82551029 CGCCAGCAACAGAACAAAGCGGG - Intergenic
1011012370 6:82716323-82716345 CACCAGCAACAGAACAAAGCTGG + Intergenic
1011107829 6:83802762-83802784 CACCAGCAACAGAACAAAGCTGG - Intergenic
1011180043 6:84609422-84609444 CACCAGCAACAGAACAAAGCTGG + Intergenic
1011245072 6:85314003-85314025 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1011283368 6:85699782-85699804 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1011304107 6:85908041-85908063 CACCAGCAACAGAACAAAGCTGG - Intergenic
1011313269 6:86004067-86004089 CACCAGCAACAGAACAAAGCTGG - Intergenic
1011358427 6:86497127-86497149 CACCAGCAACAGAACAAAGCTGG - Intergenic
1011417856 6:87140794-87140816 CACCAGCAACAGAACAAAGCTGG + Intergenic
1011619565 6:89230282-89230304 CACCAGCAACAGAACAAAGCTGG - Intronic
1011848099 6:91591078-91591100 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1012017456 6:93870776-93870798 CACCAGCAACAGAACAAAGCTGG - Intergenic
1012040887 6:94203052-94203074 CACCAGCAACAGAACAAAGCTGG - Intergenic
1012094680 6:94943119-94943141 CACCAGCAACAGAACAAAGCTGG + Intergenic
1012129492 6:95472541-95472563 CACCAGCAACAGAACAAAGCTGG + Intergenic
1012151464 6:95759371-95759393 CACCAGCAACAGAACAAAGCTGG + Intergenic
1012654028 6:101793227-101793249 CACCAGCAACAGAACAAAGCTGG - Intronic
1012722018 6:102757903-102757925 CACCAGCAACAGAACAAAGCTGG - Intergenic
1013696131 6:112704731-112704753 CACCAGCAACAGAACAAAGCTGG + Intergenic
1013886580 6:114975396-114975418 CACCAGCAACAGAACAAAGCTGG - Intergenic
1013926550 6:115480087-115480109 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1013999068 6:116343750-116343772 CGCCAGCAACAGAACAAAGCTGG + Intronic
1014040287 6:116817509-116817531 CACCAGCAACAGAACAAAGCTGG + Intronic
1014063495 6:117100287-117100309 CACCAGCAACAGAACAAAGCTGG - Intergenic
1014063921 6:117103117-117103139 CACCAGCAACAGAACAAAGCTGG + Intergenic
1014364519 6:120522972-120522994 TCCCAGCACCAGCACACAGCTGG + Intergenic
1014377125 6:120689726-120689748 CACCAGCAACAGAACAAAGCTGG + Intergenic
1014414234 6:121163679-121163701 CACCAGCAACAGAACAAAGCTGG + Intronic
1014449941 6:121571048-121571070 CACCAGCAACAGAACAAAGCTGG - Intergenic
1014529464 6:122542202-122542224 CACCAGCAACAGAACAAAGCTGG - Intronic
1014907224 6:127044363-127044385 CACCAGCAACAGAACAAAGCCGG + Intergenic
1015063809 6:128999370-128999392 CACCAGCAACAGAACAAAGCTGG + Intronic
1015290250 6:131531206-131531228 CACCAGCAACAGAACAAAGCTGG - Intergenic
1015422362 6:133025740-133025762 CACCAGCAACAGAACAAAGCTGG - Intergenic
1016365039 6:143307220-143307242 CACCAGCAACAGAACAAAGCTGG - Intronic
1016436767 6:144046210-144046232 TGCCAGCAACAGAACAAAGCTGG - Intronic
1017234801 6:152108290-152108312 GGTCAGCAACAGAACAAGGCAGG - Intronic
1017302989 6:152883757-152883779 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1018011250 6:159671714-159671736 TGCCAGCAACAGAACAAAGCTGG + Exonic
1018126131 6:160684743-160684765 CACCAGCAACAGAACAAAGCTGG - Intergenic
1018243885 6:161803579-161803601 GCCCAGCCCCAGCTCAACTCGGG + Intronic
1018525653 6:164707772-164707794 CACCAGCAACAGAACAAAGCTGG - Intergenic
1019097887 6:169600436-169600458 CACCAGCAACAGAACAAAGCTGG + Intronic
1019217182 6:170451523-170451545 GCTCAGCAACAGCTCCAGGCAGG + Intergenic
1019397665 7:830845-830867 GCCGAGCAACAACCCAAAGCTGG - Intronic
1019809759 7:3156711-3156733 GTCCAGCAACAGGACAGGGCTGG - Intronic
1020349306 7:7201023-7201045 CGCCAGCAACAGAACAAAGCTGG - Intronic
1020374200 7:7466077-7466099 CACCAGCAACAGAACAAAGCTGG + Intronic
1021342176 7:19479066-19479088 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1021875627 7:25046884-25046906 CACCAGCAACAGAACAAAGCTGG - Intergenic
1022347345 7:29529106-29529128 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1022352770 7:29580919-29580941 CACCAGCAACAGAACAAAGCTGG + Intergenic
1022439208 7:30419500-30419522 CACCAGCAACAGAACAAAGCTGG - Intergenic
1022441948 7:30440228-30440250 CACCAGCAACAGAACAAAGCTGG + Intronic
1022695578 7:32702544-32702566 CACCAGCAACAGAACAAAGCTGG - Intergenic
1022867099 7:34432426-34432448 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1023194230 7:37617076-37617098 CACCAGCAACAGAACAAAGCTGG - Intergenic
1024002071 7:45196631-45196653 TCCCAGAATCAGCACAACGTGGG - Intergenic
1024205962 7:47160773-47160795 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1024463574 7:49685295-49685317 CACCAGCAACAGAACAAAGCTGG - Intergenic
1024671377 7:51599022-51599044 CACCAGCAACAGAACAAGGCTGG - Intergenic
1024704533 7:51942363-51942385 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1024796813 7:53031339-53031361 CCCCAGCAACGGAACAAAGCTGG - Intergenic
1025640738 7:63365930-63365952 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1025720920 7:64012299-64012321 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1025787548 7:64657492-64657514 GCCCAGCAGCAACATAACACTGG - Intergenic
1025967807 7:66291877-66291899 CACCAGCAACAGAACAAAGCTGG - Intronic
1026417603 7:70198313-70198335 CACCAGCAACAGAACAAAGCTGG + Intronic
1026643021 7:72143097-72143119 CACCAGCAACAGAACAAAGCTGG + Intronic
1027292533 7:76729468-76729490 CACCAGCAACAGAACAAAGCTGG + Intergenic
1027921805 7:84404016-84404038 CACCAGCAACAGAACAAAGCTGG + Intronic
1028013491 7:85678842-85678864 CGCCAGCAACAGAACAAAGCAGG - Intergenic
1028117499 7:87016736-87016758 GCCCAGTAACTACACAACGTGGG + Intronic
1028702107 7:93792672-93792694 CACCAGCAACAGAACAAAGCTGG - Intronic
1028970273 7:96851675-96851697 CACCAGCAACAGAACAAAGCTGG - Intergenic
1029037123 7:97533674-97533696 CACCAGCAACAGAACAAAGCTGG + Intergenic
1029044662 7:97614643-97614665 CACCAGCAACAGAACAAAGCTGG + Intergenic
1029590250 7:101502599-101502621 GCCCAGCTCCAGCCCAACTCCGG - Intronic
1029979564 7:104865197-104865219 CACCAGCAACAGAACAAAGCTGG + Intronic
1030518055 7:110562556-110562578 CACCAGCAACAGAACAAAGCTGG - Intergenic
1030531013 7:110712029-110712051 CACCAGCAACAGAACAAAGCTGG - Intronic
1030572779 7:111248540-111248562 CACCAGCAACAGAACAAAGCTGG - Intronic
1030637292 7:111964180-111964202 CACCAGCAACAGAACAAAGCTGG + Intronic
1030795384 7:113781147-113781169 CACCAGCAACAGAACAAAGCTGG - Intergenic
1031285009 7:119855918-119855940 CACCAGCAACAGAACAAAGCAGG + Intergenic
1031314505 7:120239850-120239872 GACCAGCAACGGAACAAAGCTGG - Intergenic
1031579102 7:123450205-123450227 CACCAGCAACAGAACAAAGCTGG - Intergenic
1031585342 7:123527334-123527356 CACCAGCAACAGAACAAAGCTGG - Intronic
1031848130 7:126830722-126830744 CACCAGCAACAGAACAAAGCTGG - Intronic
1031905145 7:127452061-127452083 CACCAGCAACAGAACAAAGCTGG + Intergenic
1032646321 7:133828791-133828813 GTCTAGCAATAGCACAAAGCAGG - Intronic
1033498627 7:141925706-141925728 CACCAGCAACAGAACAAAGCTGG - Intronic
1033776307 7:144615268-144615290 CGCCAGCAACAGAACAAAGCTGG + Intronic
1034038180 7:147847616-147847638 CACCAGCAACAGAACAAAGCTGG - Intronic
1034040000 7:147867974-147867996 TGCCAGCAACAGAACAAAGCTGG - Intronic
1034372002 7:150606705-150606727 CACCAGCAACAGAACAAAGCTGG + Intergenic
1034723864 7:153317619-153317641 CACCAGCAACAGAACAAAGCTGG - Intergenic
1035156041 7:156914405-156914427 CACCAGCAACAGAACAAAGCTGG - Intergenic
1035229215 7:157453433-157453455 CACCAGCAACAGAACAAAGCTGG - Intergenic
1035459657 7:159031107-159031129 GCCCAGCACCGTCACAACCCCGG - Intronic
1035921222 8:3678159-3678181 CACCAGCAACAGAACAAAGCTGG + Intronic
1036536312 8:9655865-9655887 CACCAGCAACAGAACAAAGCTGG + Intronic
1036686290 8:10913862-10913884 TCCCAGCAGCAGCACGAGGCAGG + Intronic
1036756130 8:11472342-11472364 GCCCAGCACCAGCACATCCTTGG + Intronic
1037183438 8:16033610-16033632 CACCAGCAACAGAACAAAGCTGG + Intergenic
1037545333 8:19915020-19915042 CCCCACCAACAGAACAAAGCTGG - Intronic
1038438343 8:27554421-27554443 CACCAGCAACAGAACAAAGCTGG - Intergenic
1039112572 8:34055888-34055910 CACCAGCAACAGAACAAAGCTGG + Intergenic
1039319486 8:36413137-36413159 CACCAGCAACAGAACAAAGCTGG - Intergenic
1040473160 8:47753074-47753096 CACCAGCAACAGAACAAAGCTGG + Intergenic
1041048536 8:53910222-53910244 TACCAGCAAGAGCACAAAGCTGG + Intronic
1041557396 8:59173679-59173701 CACCAGCAACAGAACAAAGCTGG - Intergenic
1041581192 8:59461833-59461855 CACCAGCAACAGAACAAAGCTGG - Intergenic
1041613095 8:59874820-59874842 CACCAGCAACAGAACAAAGCTGG - Intergenic
1041976192 8:63802432-63802454 CACCAGCAACAGAACAAAGCTGG - Intergenic
1041999356 8:64103353-64103375 CACCAGCAACAGAACAAAGCTGG + Intergenic
1042171632 8:65997802-65997824 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1042402243 8:68362866-68362888 CACCAGCAACAGAACAAAGCTGG + Intronic
1042476628 8:69255204-69255226 CACCAGCAACAGAACAAAGCTGG + Intergenic
1042624306 8:70740487-70740509 CACCAGCAACAGAACAAAGCTGG - Intronic
1042720465 8:71821369-71821391 CACCAGCAACAGAACAAAGCTGG + Intergenic
1042750394 8:72152467-72152489 CACCAGCAACAGAACAAAGCTGG - Intergenic
1042763158 8:72292152-72292174 CACCAGCAACAGAACAAAGCTGG + Intergenic
1042816160 8:72880581-72880603 CACCAGCAACAGAACAAAGCTGG - Intronic
1043070043 8:75626349-75626371 CACCAGCAACAGAACAAAGCTGG - Intergenic
1043089088 8:75875407-75875429 CGCCAGCAACAGAACAAAGCAGG - Intergenic
1043241624 8:77941490-77941512 CACCAGCAACAGAACAAAGCTGG + Intergenic
1043498030 8:80824043-80824065 CGCCAGCAACAGAACAAAGCTGG + Intronic
1043787786 8:84424569-84424591 CACCAGCAACAGAACAAAGCTGG - Intronic
1043938775 8:86173503-86173525 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1044143772 8:88686691-88686713 CACCAGCAACAGAACAAAGCTGG + Intergenic
1044380375 8:91527117-91527139 CACCAGCAACAGAACAAAGCTGG - Intergenic
1044383406 8:91559642-91559664 CACCAGCAACAGAACAAAGCTGG + Intergenic
1044449074 8:92313176-92313198 CACCAGCAACAGAACAAAGCTGG - Intergenic
1044540871 8:93406796-93406818 CACCAGCAACAGAACAAAGCTGG + Intergenic
1044576855 8:93779382-93779404 CACCAGCAACAGAACAAAGCTGG - Intronic
1045123520 8:99064221-99064243 CGCCAGCAACAGAACAAAGCTGG + Intronic
1045709181 8:104963713-104963735 CGCCAGCAACAGAACAAAGCTGG - Intronic
1046122148 8:109859746-109859768 CACCAGCAACAGAACAAAGCTGG + Intergenic
1046464585 8:114585364-114585386 CCCCAGCAACGGAACAAAGCTGG - Intergenic
1046900906 8:119522119-119522141 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1046968362 8:120193065-120193087 CACCAGCAACAGAACAAAGCTGG - Intronic
1046982287 8:120349358-120349380 CACCAGCAACAGAACAAAGCTGG + Intronic
1047204871 8:122795049-122795071 TCCCAGCACCAGCACAGGGCTGG + Intronic
1047519543 8:125583820-125583842 CACCAGCAACAGAACAAAGCTGG + Intergenic
1047815389 8:128458014-128458036 CACCAGCAACAGAACAAAGCTGG - Intergenic
1048138766 8:131771887-131771909 CACCAGCAACAGAACAAAGCTGG + Intergenic
1048401473 8:134075768-134075790 CACCAGCAACAGAACAAAGCTGG - Intergenic
1048647925 8:136443098-136443120 CACCAGCAACAGAACAAAGCTGG - Intergenic
1048785606 8:138047584-138047606 CACCAGCAACAGAACAAAGCTGG - Intergenic
1048792597 8:138117149-138117171 CACCAGCAACAGAACAAAGCTGG + Intergenic
1049418816 8:142507771-142507793 GGCCAGGCACAGCACAACCCAGG - Intronic
1049820401 8:144629916-144629938 GTCCAGGTGCAGCACAACGCAGG + Intergenic
1050645420 9:7714022-7714044 CACCAGCAACAGAACAAAGCTGG + Intergenic
1051085492 9:13343873-13343895 CACCAGCAACAGAACAAAGCTGG + Intergenic
1051204000 9:14664970-14664992 CACCAGCAACAGAACAAAGCTGG + Intronic
1051300529 9:15645360-15645382 CCCCAGCAACAGAACAAAGCTGG + Intronic
1051537753 9:18178999-18179021 CACCAGCAACAGAACAAAGCTGG + Intergenic
1051790871 9:20800867-20800889 CACCAGCAACAGAACAAAGCTGG - Intronic
1051987353 9:23106202-23106224 CACCAGCAACAGAACAAAGCTGG + Intergenic
1052063873 9:23992809-23992831 CTCCAGCAACAGAACAAAGCTGG + Intergenic
1052117571 9:24667851-24667873 CACCAGCAACAGAACAAAGCTGG - Intergenic
1052131961 9:24858917-24858939 CACCAGCAACAGAACAAAGCTGG + Intergenic
1052410571 9:28116930-28116952 CACCAGCAACAGAACAAAGCTGG - Intronic
1052451847 9:28640845-28640867 CACCAGCAACAGAACAAAGCTGG - Intronic
1052594511 9:30540429-30540451 CACCAGCAACAGAACAAAGCTGG + Intergenic
1052612173 9:30790072-30790094 CACCAGCAACAGAACAAAGCTGG - Intergenic
1052640393 9:31159967-31159989 CACCAGCAACAGAACAAAGCTGG - Intergenic
1052770601 9:32685253-32685275 CACCAGCAACAGAACAAAGCTGG + Intergenic
1052800144 9:32958917-32958939 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1052888088 9:33668451-33668473 CACCAGCAACAGAACAAAGCTGG + Intergenic
1053041754 9:34879327-34879349 CACCAGCAACAGAACAAAGCTGG + Intergenic
1054816282 9:69478092-69478114 CACCAGCAACAGAACAAAGCTGG + Intronic
1054819482 9:69507039-69507061 CACCAGCAACAGAACAAAGCTGG + Intronic
1054886398 9:70204075-70204097 CACCAGCAACAGAACAAAGCTGG - Intronic
1055338583 9:75258714-75258736 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1056077245 9:83054564-83054586 CACCAGCAACAGAACAAAGCTGG - Intronic
1056727084 9:89128870-89128892 CACCAGCAACAGAACAAAGCTGG + Intronic
1056857882 9:90150589-90150611 CACCAGCAACAGAACAAAGCTGG + Intergenic
1057163041 9:92904936-92904958 CACCAGCAACAGAACAAAGCTGG - Intergenic
1057205008 9:93166479-93166501 GCCCAGCAATGGCACAACCTCGG + Intergenic
1057331308 9:94118559-94118581 CACCAGCAACAGAACAAAGCTGG - Intergenic
1057513293 9:95698562-95698584 CACCAGCAACAGAACAAAGCTGG + Intergenic
1057697882 9:97340186-97340208 CACCAGCAACAGAACAAAGCAGG - Intronic
1057768978 9:97950381-97950403 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1057844227 9:98509392-98509414 CACCAGCAACAGAACAAAGCTGG + Intronic
1058134518 9:101291913-101291935 CACCAGCAACAGAACAAAGCTGG + Intronic
1058192887 9:101940425-101940447 CACCAGCAACAGAACAAAGCTGG - Intergenic
1058516521 9:105782075-105782097 CACCAGCAACAGAACAAAGCTGG - Intergenic
1059005213 9:110394474-110394496 CACCAGCAACAGAACAAAGCTGG + Intronic
1059007419 9:110418088-110418110 CACCAGCAACAGAACAAAGCTGG + Intronic
1059039089 9:110792083-110792105 CACCAGCAACAGAACAAAGCTGG + Intronic
1059240706 9:112803156-112803178 CACCAGCAACAGAACAAAGCTGG - Intronic
1059317831 9:113442584-113442606 CACCAGCAACAGAACAAAGCTGG - Intergenic
1059673430 9:116514019-116514041 CACCAGCAACAGAACAAAGCTGG - Intronic
1059675607 9:116536375-116536397 CACCAGCAACAGAACAAAGCTGG - Intronic
1059732457 9:117071029-117071051 CACCAGCAACAGAACAAAGCTGG - Intronic
1059967095 9:119626348-119626370 CACCAGCAACAGAACAAAGCTGG - Intergenic
1060012549 9:120056222-120056244 CACCAGCAACAGAACAAAGCTGG + Intergenic
1060133838 9:121132659-121132681 CACCAGCAACAGAACAAAGCTGG - Intronic
1060339407 9:122760124-122760146 CACCAGCAACAGAACAAAGCTGG + Intergenic
1060865669 9:126994152-126994174 CACCAGCAACAGAACAAAGCTGG + Intronic
1060945785 9:127568819-127568841 GCCCGGCGCCAGCACATCGCAGG - Exonic
1061809154 9:133152360-133152382 GCCCAGCAGCCGGACAACCCTGG - Intergenic
1061833392 9:133310997-133311019 CACCAGCAACAGAACAAAGCTGG + Intergenic
1186665084 X:11708233-11708255 CACCAGCAACAGAACAAAGCTGG + Intergenic
1186687409 X:11940308-11940330 CACCAGCAACAGAACAAAGCTGG - Intergenic
1186914530 X:14205926-14205948 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1186931137 X:14391936-14391958 CACCAGCAACAGAACAAAGCTGG + Intergenic
1187314010 X:18174942-18174964 GCCCAGCAGCAGCAGACCACTGG - Intronic
1187705310 X:22004477-22004499 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1187835443 X:23428314-23428336 CACCAGCAACAGAACAAAGCTGG - Intergenic
1188109017 X:26175587-26175609 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1188109592 X:26181559-26181581 CACCAGCAACAGAACAAAGCTGG - Intergenic
1188121986 X:26319441-26319463 CACCAGCAACAGAACAAAGCTGG - Intergenic
1188123206 X:26335104-26335126 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1188238770 X:27759664-27759686 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1188271946 X:28151744-28151766 CACCAGCAACAGAACAAAGCTGG - Intergenic
1188978523 X:36705206-36705228 CACCAGCAACAGAACAAAGCTGG - Intergenic
1189598077 X:42590769-42590791 CACCAGCAACAGAACAAAGCTGG + Intergenic
1189603543 X:42651834-42651856 CACCAGCAACAGAACAAAGCTGG + Intergenic
1189662086 X:43311224-43311246 CACCAGCAACAGAACAAAGCTGG - Intergenic
1190422633 X:50301153-50301175 CACCAGCAACAGAACAAAGCTGG - Intronic
1190546798 X:51536592-51536614 CACCAGCAACAGAACAAAGCTGG - Intergenic
1190603905 X:52120255-52120277 CGCCAGCAACAGAACAACGCTGG + Intergenic
1190621684 X:52292892-52292914 CACCAGCAACAGAACAAAGCTGG + Intergenic
1190800590 X:53784459-53784481 CACCAGCAACAGAACAAAGCTGG + Intergenic
1190911271 X:54774660-54774682 GCCCAGCAACAGCAGAAAGGAGG - Intronic
1190919946 X:54841550-54841572 GCCCAGCAACAGCAGAAAGGAGG + Intergenic
1190970753 X:55344791-55344813 TGCCAGCAACGGCACAAAGCTGG + Intergenic
1191050082 X:56182489-56182511 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1191098256 X:56696870-56696892 CACCAGCAACAGAACAAAGCTGG + Intergenic
1191170605 X:57443633-57443655 CACCAGCAACAGAACAAAGCTGG - Intronic
1191192885 X:57685375-57685397 CACCAGCAACAGAACAAAGCTGG + Intergenic
1191565102 X:62518079-62518101 CACCAGCAACAGAACAAAGCTGG + Intergenic
1191645764 X:63479131-63479153 CACCAGCAACAGAACAAAGCTGG + Intergenic
1191698813 X:64018279-64018301 CACCAGCAACAGAACAAAGCTGG - Intergenic
1191707885 X:64113754-64113776 CACCAGCAACAGAACAAAGCTGG - Intergenic
1191723671 X:64257368-64257390 CACCAGCAACAGAACAAAGCTGG - Intergenic
1191914290 X:66185722-66185744 CACCAGCAACAGAACAAAGCTGG - Intronic
1192371747 X:70520143-70520165 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1192383410 X:70639891-70639913 CACCAGCAACAGAACAAAGCTGG + Intronic
1192391149 X:70729284-70729306 TACCAGCAACAGAACAAAGCTGG + Intronic
1192667935 X:73107128-73107150 CACCAGCAACAGAACAAAGCTGG + Intergenic
1192692810 X:73381968-73381990 CACCAGCAACAGAACAAAGCTGG + Intergenic
1192826025 X:74696822-74696844 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1192876323 X:75232908-75232930 CACCAGCAACAGAACAAAGCTGG + Intergenic
1192879273 X:75265699-75265721 CACCAGCAACAGAACAAAGCTGG - Intergenic
1192976263 X:76288978-76289000 CACCAGCAACAGAACAAAGCTGG + Intergenic
1193051265 X:77102429-77102451 CACCAGCAACAGAACAAAGCTGG - Intergenic
1193066865 X:77269155-77269177 TGCCAGCAACAGAACAAAGCTGG + Intergenic
1193216100 X:78866481-78866503 CACCAGCAACAGAACAAAGCTGG - Intergenic
1193229870 X:79031606-79031628 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1193267917 X:79494956-79494978 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1193281408 X:79655461-79655483 CACCAGCAACAGAACAAAGCTGG - Intergenic
1193346134 X:80406222-80406244 CACCAGCAACAGAACAAAGCTGG + Intronic
1193376517 X:80767693-80767715 CGCCAGCAACAGAACAAAGCTGG + Intronic
1193391824 X:80937677-80937699 CACCAGCAACAGAACAAAGCTGG + Intergenic
1193465448 X:81842138-81842160 CACCAGCAACAGAACAAAGCTGG + Intergenic
1193564861 X:83064630-83064652 CACCAGCAACAGAACAAAGCTGG - Intergenic
1193604048 X:83543380-83543402 CACCAGCAACAGAACAAAGCTGG + Intergenic
1193733744 X:85132677-85132699 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1193757521 X:85426856-85426878 CACCAGCAACAGAACAAAGCTGG - Intergenic
1193787000 X:85771905-85771927 AACCAGCAACAGAACAAAGCTGG - Intergenic
1193817143 X:86118341-86118363 CACCAGCAACAGAACAAAGCTGG - Intergenic
1193896210 X:87117293-87117315 CACCAGCAACAGAACAAAGCTGG + Intergenic
1194068759 X:89293611-89293633 CACCAGCAACAGAACAAAGCTGG + Intergenic
1194772499 X:97922157-97922179 CACCAGCAACAGAACAAAGCTGG + Intergenic
1195099587 X:101541321-101541343 CACCAGCAACAGAACAAAGCTGG + Intergenic
1195125981 X:101810702-101810724 CACCAGCAACAGAACAAAGCTGG - Intergenic
1195163581 X:102196083-102196105 CACCAGCAACAGAACAAAGCTGG - Intergenic
1195167523 X:102235497-102235519 CACCAGCAACAGAACAAAGCTGG - Intergenic
1195191335 X:102451590-102451612 CACCAGCAACAGAACAAAGCTGG + Intronic
1195203854 X:102575410-102575432 CACCAGCAACAGAACAAAGCTGG + Intergenic
1195233589 X:102876194-102876216 CACCAGCAACAGAACAAAGCTGG - Intergenic
1195276295 X:103283614-103283636 CACCAGCAACAGAACAAAGCTGG + Intergenic
1195294144 X:103459566-103459588 CACCAGCAACAGAACAAAGCTGG - Intergenic
1195340480 X:103902136-103902158 CACCAGCAACAGAACAAAGCTGG - Intergenic
1195391311 X:104365660-104365682 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1195452733 X:105034243-105034265 CACCAGCAACAGAACAAAGCTGG - Intronic
1195508377 X:105685170-105685192 CACCAGCAACAGAACAAAGCTGG + Intronic
1195603043 X:106770775-106770797 CGCCAGCAACAGAACAAAGCTGG - Intronic
1195723469 X:107890137-107890159 CACCAGCAACAGAACAAAGCTGG - Intronic
1195735966 X:108012517-108012539 CACCAGCAACAGAACAAAGCTGG + Intergenic
1195764168 X:108278114-108278136 CACCAGCAACAGAACAAAGCTGG + Intronic
1195787843 X:108547128-108547150 CACCAGCAACAGAACAAAGCTGG - Intronic
1195977870 X:110547024-110547046 CACCAGCAACAGAACAAAGCTGG + Intergenic
1196240918 X:113342844-113342866 CACCAGCAACAGAACAAAGCTGG - Intergenic
1196544463 X:116946299-116946321 CACCAGCAACAGAACAAAGCTGG - Intergenic
1196612665 X:117732744-117732766 CACCAGCAACAGAACAAAGCTGG - Intergenic
1196635559 X:117998601-117998623 GCACAGCCACAGCACAATGAAGG + Intronic
1196788186 X:119440489-119440511 CACCAGCAACAGAACAAAGCTGG - Intronic
1196896876 X:120345358-120345380 CACCAGCAACAGAACAAAGCTGG + Intergenic
1197267292 X:124388338-124388360 GCCCAGCATCAGCACCACCTAGG - Intronic
1197420710 X:126234480-126234502 CACCAGCAACAGAACAAAGCTGG - Intergenic
1197510448 X:127363208-127363230 CACCAGCAACAGAACAAAGCTGG + Intergenic
1197818063 X:130518361-130518383 CACCAGCAACAGAACAAAGCTGG + Intergenic
1197877659 X:131128234-131128256 CACCAGCAACAGAACAAAGCTGG - Intergenic
1197919778 X:131579663-131579685 CACCAGCAACAGAACAAAGCTGG + Intergenic
1198123873 X:133622273-133622295 CACCAGCAACAGAACAAAGCTGG + Intronic
1198166352 X:134061672-134061694 CACCAGCAACAGAACAAAGCTGG - Intergenic
1198365997 X:135940788-135940810 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1198819712 X:140634035-140634057 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1198893513 X:141426240-141426262 CACCAGCAACAGAACAAAGCTGG - Intergenic
1199383876 X:147201383-147201405 CGCCAGCAACAGAACAAAGCTGG + Intergenic
1199422002 X:147654720-147654742 CACCAGCAACAGAACAAAGCTGG + Intergenic
1199637003 X:149823859-149823881 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1199933206 X:152545505-152545527 CACCAGCAACAGAACAAAGCTGG + Intergenic
1199968413 X:152840329-152840351 CGCCAGCAACAGAACAAAGCTGG - Intronic
1200331625 X:155304600-155304622 CACCAGCAACAGAACAAAGCTGG - Intronic
1200353185 X:155521041-155521063 CACCAGCAACAGAACAAAGCTGG - Intronic
1200371296 X:155727826-155727848 TGCCAGCAACAGAACAAAGCTGG - Intergenic
1200460124 Y:3444534-3444556 CACCAGCAACAGAACAAAGCTGG + Intergenic
1200581311 Y:4953934-4953956 CACCAGCAACAGAACAAAGCTGG - Intergenic
1200722906 Y:6627766-6627788 CACCAGCAACAGAACAAAGCTGG + Intergenic
1201051678 Y:9942114-9942136 CACCAGCAACAGAACAAAGCTGG + Intergenic
1201053628 Y:9966625-9966647 CACCAGCAACAGAACAAAGCTGG - Intergenic
1201419386 Y:13781846-13781868 CACCAGCAACAGAACAAAGCTGG - Intergenic
1201776067 Y:17667586-17667608 CCTCAGCAACAGAACAAAGCTGG - Intergenic
1201800076 Y:17945286-17945308 CACCAGCAACAGAACAAAGCTGG + Intergenic
1201801477 Y:17960670-17960692 CACCAGCAACAGAACAAAGCTGG - Intergenic
1201825489 Y:18238406-18238428 CCTCAGCAACAGAACAAAGCTGG + Intergenic
1201933301 Y:19378306-19378328 CACCAGCAACAGAACAAAGCTGG - Intergenic
1201956448 Y:19629189-19629211 CGCCAGCAACAGAACAAAGCTGG - Intergenic
1202125340 Y:21564614-21564636 ATCCAGCAACAGCCCAACGAAGG - Intergenic
1202153668 Y:21864778-21864800 ATCCAGCAACAGCCCAACGAAGG + Intergenic
1202200682 Y:22344637-22344659 CACCAGCAACAGAACAAAGCTGG - Intronic