ID: 976608674

View in Genome Browser
Species Human (GRCh38)
Location 4:87007017-87007039
Sequence TGCCCAGCAACAGCACAACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976608674_976608678 -8 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608678 4:87007032-87007054 GCTGGGCAGGCGTTGGGCGCCGG 0: 1
1: 0
2: 0
3: 28
4: 316
976608674_976608680 8 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608680 4:87007048-87007070 GCGCCGGCGGTCTTCGAGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
976608674_976608681 9 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 11
976608674_976608682 10 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608682 4:87007050-87007072 GCCGGCGGTCTTCGAGCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
976608674_976608679 -5 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608679 4:87007035-87007057 GGGCAGGCGTTGGGCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 320
976608674_976608684 11 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608684 4:87007051-87007073 CCGGCGGTCTTCGAGCGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
976608674_976608685 19 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608685 4:87007059-87007081 CTTCGAGCGTGGGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976608674 Original CRISPR TGCCCAGCAACAGCACAACG CGG (reversed) Intronic
900004533 1:36070-36092 TGCCCAGCTCCCACACAACGGGG - Intergenic
900024255 1:206586-206608 TGCCCAGCTCCCACACAACGGGG - Intergenic
901225494 1:7610814-7610836 GGCCCAGCAGCAGCACAGAGTGG + Intronic
901480269 1:9520347-9520369 TCCTCAGCAACAGCAACACGGGG - Intergenic
903855977 1:26337741-26337763 TGCCCAGCATCAGGCCAATGTGG + Intronic
905548176 1:38816563-38816585 AGCCCACCAACAGCCCAAGGGGG - Intergenic
905661832 1:39733386-39733408 TACAGAGCAACAGCACAAGGAGG - Intronic
907188946 1:52633087-52633109 TGCGCAACGACAGCACGACGCGG - Intergenic
909548946 1:76877144-76877166 AGCCCAGTAACAGCAAAAGGAGG + Intronic
913197109 1:116466242-116466264 TGGCCAGCAAGAGCACAAACAGG + Intergenic
917731296 1:177877450-177877472 TCCTCAGCACCAGCACAATGTGG + Intergenic
1063132552 10:3190999-3191021 AGCCCAGCAGCAGCACAGCATGG - Intergenic
1064380433 10:14837618-14837640 TTCACAGCAAAACCACAACGTGG + Intronic
1067173415 10:43925759-43925781 TGCCCAGCACCATCACACTGGGG + Intergenic
1075228802 10:120653747-120653769 TGACCAGCGACAGCAGAACCTGG - Intergenic
1076271011 10:129152292-129152314 GGCTCAGCAACAGCTCAACTTGG + Intergenic
1078084216 11:8224195-8224217 TGCCCAGCAACAGCACATGCTGG + Intergenic
1082053532 11:47793429-47793451 TTCCCAGCAACAGTACAAAAGGG - Intronic
1084420609 11:69058705-69058727 GGCCCCGCAGCAGCACAGCGGGG - Intronic
1084796882 11:71512145-71512167 TCACCAGCAACAGAACAAAGTGG + Intronic
1091377952 12:38122-38144 TGCCCAGCTCCCACACAACGGGG - Intergenic
1095739039 12:45587174-45587196 TCACCAGCAACATCACAACAAGG + Intergenic
1096706474 12:53425208-53425230 TGCCCAGCAGCAGCAGGAGGAGG - Exonic
1101182129 12:102230584-102230606 TGCCCAGCAACAGGAGAAGGAGG - Intergenic
1101784408 12:107870377-107870399 TGCACAGCAAGAGCACTACAGGG + Intergenic
1105906042 13:24811662-24811684 TCACCAGCAACAGAACAAAGCGG - Intronic
1106614087 13:31310542-31310564 TGCCCAGCACCAGCAAAGGGTGG - Intronic
1112333617 13:98496459-98496481 TGCGCAGCCACAGCCCACCGGGG - Intronic
1113764892 13:112875040-112875062 TGCCCGCCACCAGCACCACGTGG + Intronic
1118806025 14:69237638-69237660 TGCAGAGCAGCAGCACATCGTGG - Exonic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1125056416 15:35362736-35362758 TCCCCAAAAACAGCACAACTTGG - Intronic
1125265913 15:37880743-37880765 TGCACAGCAAAACCACAAGGTGG - Intergenic
1128212754 15:65913845-65913867 GGCCCAGCAGCACCACAATGAGG + Exonic
1129737736 15:77975332-77975354 TGCCCAGCCCCAACACCACGAGG - Intergenic
1131122854 15:89833893-89833915 TGCCCTGCAACAGCATCAGGAGG + Exonic
1132054081 15:98635895-98635917 TGCCCAGCATCCGCACACCACGG - Intergenic
1132375711 15:101327023-101327045 TGGCCAGCAACAGCCCCACCAGG - Intronic
1132448975 15:101954874-101954896 TGCCCAGCTCCCACACAACGGGG + Intergenic
1132602881 16:781778-781800 TGCCCAGCAGCAGCAGGACGGGG - Intronic
1137765546 16:50975074-50975096 TGCCCAGCAGCAGCACCCCATGG - Intergenic
1138162348 16:54766114-54766136 GTCCCAGCAACTGCACAAAGAGG - Intergenic
1142265144 16:89061027-89061049 TGCCCAGCAGCAGCCCAGCTGGG + Intergenic
1142292161 16:89198170-89198192 TGCCCAGCAGCAGCACGGGGCGG + Exonic
1143337072 17:6179359-6179381 TGCGCTGCAACAGCACAATCAGG + Intergenic
1144636165 17:16910590-16910612 AGCCCAGCAACAGCCAAAGGCGG - Intergenic
1144645905 17:16973237-16973259 GGCCCAGCAACAGCCAAAGGCGG + Intergenic
1144819136 17:18059185-18059207 TACCCACCAAAAGCACAGCGAGG - Intronic
1145203601 17:20968685-20968707 GGCCCAGCAACAGCCAAAGGCGG - Intergenic
1145355271 17:22139936-22139958 TGCCCAGCAATAGCACCAAGGGG + Intergenic
1146969071 17:37057707-37057729 TGCACAGAAAAACCACAACGAGG - Intergenic
1148204100 17:45768737-45768759 CGTCCAGCAGCAGCACAAAGGGG + Intergenic
1148214239 17:45825717-45825739 GGCCCAGCAACAGCACGCAGAGG - Intronic
1152343835 17:79739677-79739699 TGCCCAGGAACAGCTGCACGTGG - Intronic
1153274932 18:3359257-3359279 TGCACAGCATCAGCACCAGGTGG - Intergenic
1160079708 18:75713950-75713972 TTCCCAGTGACAGCACAAGGTGG + Intergenic
1160448827 18:78948025-78948047 TGAACAGCAACAGCAAAACCAGG + Intergenic
1160636285 19:77679-77701 TGCCCAGCTCCCACACAACGGGG - Intergenic
1161096689 19:2396278-2396300 TCCCCAGGTACAGCACAAGGTGG - Intronic
1162231001 19:9266216-9266238 TGGACAGGAACAGCCCAACGAGG + Intergenic
1162393951 19:10405285-10405307 TGCCCAGCTTCAGCAAAACAGGG + Intronic
1162558432 19:11402018-11402040 TGCCCAGAACCAGCTCACCGAGG - Exonic
1162792451 19:13070084-13070106 TGCCCACCAGAGGCACAACGTGG - Intronic
1165993195 19:39827389-39827411 TGCCCAGCACCTCCACAATGCGG + Exonic
925208568 2:2027291-2027313 AGCCCAGCAACAGCTGCACGTGG + Intronic
933946611 2:87291758-87291780 TGCCCAGCAACTGCCCCACTGGG - Intergenic
934101159 2:88654306-88654328 TGGGCAGCAACAGCATAACATGG + Intergenic
936333581 2:111569783-111569805 TGCCCAGCAACTGCCCCACTGGG + Intergenic
936565197 2:113577371-113577393 TGCCCAGCTCCCACACAACGGGG + Intergenic
941052280 2:160748590-160748612 TGCCAAGGAACAGCACAATCTGG + Intergenic
947534708 2:230933438-230933460 TGCCCAGCAGCTGCACACCATGG - Intronic
1171963764 20:31514601-31514623 GCCCCACCAACAGCACTACGCGG + Exonic
1183064008 22:35351340-35351362 GCCCCAGCAACGGCACACCGGGG - Intergenic
1183260648 22:36793267-36793289 TGCACAGCAAAATCACAATGAGG - Intergenic
1183279171 22:36922980-36923002 TGCCCAGGAACAGCACACTGCGG + Intronic
1183742857 22:39678251-39678273 TGCCCAGGACCAGCACAGTGGGG + Intronic
1184173624 22:42773441-42773463 TGCCCAGACACAACACCACGAGG + Intergenic
1184761258 22:46545962-46545984 TGTCCAGCAACAGCATCAGGGGG - Intergenic
1184875569 22:47272909-47272931 GGCCCAGCAACAGAACACCCAGG - Intergenic
1184975520 22:48058787-48058809 TGCCCAGCAAAAGCACCAGCAGG + Intergenic
949471731 3:4403628-4403650 TTCTCAGCAACAGCAGAATGAGG + Intronic
958666114 3:97139604-97139626 GGCCCACTAACAGCACAAAGAGG + Intronic
961376389 3:126468862-126468884 GGACCAGCAACAGCACAGTGGGG - Intronic
963839823 3:150093838-150093860 TGAACAGCATCAGCATAACGTGG + Intergenic
968750885 4:2388388-2388410 GGACTATCAACAGCACAACGAGG + Intronic
976608674 4:87007017-87007039 TGCCCAGCAACAGCACAACGCGG - Intronic
985267421 4:188162985-188163007 TGCCCAGCAGCAGCTCAGCCTGG - Intergenic
985410805 4:189681659-189681681 TGCCCAGCTACAGAAGAAAGTGG + Intergenic
988973773 5:36495174-36495196 GGTCCAGGAGCAGCACAACGTGG + Intergenic
991134798 5:63168782-63168804 TGGCCAGCAACACCACCACTGGG + Intergenic
992416480 5:76556898-76556920 TGCCCTGCTACAGCACTACAAGG + Intronic
993146773 5:84103845-84103867 AGCCCAGCCACAGCATAACTGGG + Intronic
996796387 5:127352910-127352932 TGCCCAGCAGCAGCAGCAGGAGG + Intronic
997228804 5:132228309-132228331 TTCCCAGCACCACCACAAGGAGG + Intronic
999605038 5:153305453-153305475 TCACCAGCAACAGAACAAAGTGG - Intergenic
1002133383 5:177094597-177094619 TGCCCAGCAAGAGCACCCCGGGG - Intronic
1009895771 6:69746869-69746891 GCCCCAGCAAGAGCACAACAGGG + Intronic
1010997554 6:82551008-82551030 TCGCCAGCAACAGAACAAAGCGG - Intergenic
1017896763 6:158686811-158686833 TGGCCAGCATCAGCTCAACAGGG - Intronic
1019605965 7:1910377-1910399 TGGCCAGCAACAGGACTACAGGG + Intronic
1023542470 7:41280496-41280518 TGGCCAACAACAGCTCACCGAGG + Intergenic
1024002072 7:45196632-45196654 CTCCCAGAATCAGCACAACGTGG - Intergenic
1028117498 7:87016735-87016757 CGCCCAGTAACTACACAACGTGG + Intronic
1035373285 7:158392504-158392526 TGGCCAGCAAGAGCTCCACGTGG + Intronic
1035471658 7:159113633-159113655 AACCCAGCAACAGAAAAACGAGG + Intronic
1039412353 8:37365588-37365610 TCCCAAGCAACAGCACCACCGGG + Intergenic
1040487021 8:47883391-47883413 TGCACAGAAACAGCTCCACGTGG - Intronic
1040709696 8:50173721-50173743 TGACAAGAAACAGCACAATGTGG - Intronic
1042271645 8:66961870-66961892 CGCCCACCAGCAGCCCAACGGGG + Exonic
1044787121 8:95806376-95806398 TTTCCAGAAACAGCACAACAAGG - Intergenic
1049007238 8:139863341-139863363 TGCCCAGCTGCAGCACAGGGAGG + Intronic
1049767059 8:144359735-144359757 TGCCCAGCACCTGCACCACCCGG - Exonic
1049887228 9:35853-35875 TGCCCAGCTCCCACACAACGGGG - Intergenic
1056852853 9:90098568-90098590 TTCTCAGCAACAGCACAGAGAGG - Intergenic
1057883213 9:98808575-98808597 TGCCCAGGGAGAGCACAAGGAGG - Intronic
1061133578 9:128721349-128721371 TGGCCAGCAACACCACCACCTGG - Exonic
1062286909 9:135777484-135777506 TGTCCAGCAGCAGCACGATGGGG - Exonic
1203671957 Un_KI270755v1:23777-23799 TGCCCAGCTACAGAAGAAAGTGG - Intergenic
1186300829 X:8198132-8198154 TACCCAGCATCAGCACATAGGGG + Intergenic
1195847850 X:109248037-109248059 TCACCAGCAACAGAACAAAGTGG - Intergenic
1199585905 X:149415518-149415540 TGCCCATCATCAGGACAATGAGG + Intergenic
1199771970 X:150980940-150980962 TGCCCAGCAACTGCCCACAGTGG - Intronic