ID: 976608681

View in Genome Browser
Species Human (GRCh38)
Location 4:87007049-87007071
Sequence CGCCGGCGGTCTTCGAGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 11}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976608673_976608681 10 Left 976608673 4:87007016-87007038 CCCGCGTTGTGCTGTTGCTGGGC 0: 1
1: 0
2: 0
3: 20
4: 1220
Right 976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 11
976608674_976608681 9 Left 976608674 4:87007017-87007039 CCGCGTTGTGCTGTTGCTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 11
976608670_976608681 25 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976608681 Original CRISPR CGCCGGCGGTCTTCGAGCGT GGG Intronic
1074896877 10:117784748-117784770 CGCCGGCTGTCCTTGAGTGTGGG - Intergenic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG + Exonic
948751554 2:240136187-240136209 CGGCGGGAGTCTCCGAGCGTGGG - Exonic
1176223086 20:63979276-63979298 ACCCGGCGGGCTTCGAGCGGCGG - Intronic
1184923252 22:47620419-47620441 CGCAGGCTGTCTTCGACTGTTGG - Intergenic
969912257 4:10457365-10457387 CGCCGGCGGTCTGCGGCCGGCGG - Intronic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG + Intergenic
1062600317 9:137316301-137316323 CGCCCGCGGCCTTCGCGCGCCGG + Intronic
1200100712 X:153688154-153688176 CGCCCGCGGTCTGCAAGCGGCGG - Exonic