ID: 976608870

View in Genome Browser
Species Human (GRCh38)
Location 4:87008234-87008256
Sequence TCTCACATATTTAAAGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976608870 Original CRISPR TCTCACATATTTAAAGTAGT AGG Intronic
901534739 1:9874851-9874873 ACTCACACTTTCAAAGTAGTGGG + Intronic
902816643 1:18920037-18920059 TCTCATATTTTTAACGTAATAGG - Intronic
904085847 1:27907354-27907376 TCTAATATATTTAAAGTACTTGG - Intronic
906184131 1:43848114-43848136 AGTTACATATTTAAGGTAGTGGG - Intronic
911603393 1:99871825-99871847 TCTTACACATTTAAACTATTGGG - Intronic
912436307 1:109663971-109663993 TCTCACCTATCCAAAGAAGTAGG - Intronic
912438313 1:109678075-109678097 TCTCACCTATCTGAAGAAGTAGG - Intronic
912440825 1:109696524-109696546 TCTCACCTATCCAAAGAAGTAGG - Intronic
914674105 1:149894736-149894758 TCTCACATGCTAAAATTAGTGGG + Intronic
915181605 1:154066108-154066130 TGGGACACATTTAAAGTAGTGGG + Intronic
915249248 1:154576731-154576753 TCTCACAGATTTCAAGTATTTGG - Exonic
915636173 1:157188562-157188584 TGTCACATATCTATATTAGTTGG - Intergenic
916970670 1:170011091-170011113 AATCAAATATTTAAAGTATTTGG - Intronic
917363036 1:174198024-174198046 ATGCGCATATTTAAAGTAGTTGG + Intronic
918000199 1:180486630-180486652 TCACAAATATTAAAACTAGTGGG + Intronic
919286776 1:195573547-195573569 TCTCAAATATATAAAGAACTAGG + Intergenic
919697140 1:200588925-200588947 TTTCACTTATTTAAATTACTTGG + Intronic
921966002 1:221090547-221090569 TTTCACATCCTTAAATTAGTGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922637756 1:227192922-227192944 TCTTACATATTTAAATTAGCTGG - Intronic
922884700 1:229009181-229009203 TTTCACATTTTTACAGGAGTGGG + Intergenic
923909952 1:238430589-238430611 TCACATAAATTTAAAGTAGAGGG - Intergenic
924255424 1:242177988-242178010 TTTCACCTATTTCAAGAAGTGGG - Intronic
924276741 1:242396302-242396324 TCTCACCCATTAAAAATAGTTGG - Intronic
1063893783 10:10657452-10657474 ACTCACGCATTTAAAGTACTGGG - Intergenic
1065363358 10:24910250-24910272 TCACACATATTTTAAGAACTAGG + Intronic
1067730671 10:48809007-48809029 ACTCACCTATTGAAAGTATTAGG - Intronic
1068805288 10:61188355-61188377 ACTCACATATGTATAGTAGGTGG - Intergenic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1069467936 10:68658627-68658649 TCTCACATAATTATAGTCTTTGG + Intronic
1070239122 10:74660430-74660452 TTTCTCATATTTAAAATAGGAGG - Intronic
1071009606 10:80922675-80922697 TTTCACATATTTATAATATTTGG - Intergenic
1071492596 10:86146096-86146118 TCTCAGAAATTGAAAATAGTAGG - Intronic
1072132804 10:92512963-92512985 TTTCACATTTGTAAAGTGGTGGG - Intronic
1072334333 10:94384228-94384250 TTTCACTTATTTAAACTATTAGG + Intergenic
1072934309 10:99697653-99697675 TGTCACATCCTTAAAATAGTCGG + Intronic
1078803686 11:14673840-14673862 TCTCAAATTTGTAGAGTAGTTGG + Intronic
1080531189 11:33178291-33178313 TCTCACCTCTTTCAAGTAGCGGG - Intergenic
1085815689 11:79735001-79735023 TCACACAGATGTAAAGTAGCAGG + Intergenic
1086242245 11:84709130-84709152 TTTCTCCTATTTGAAGTAGTTGG - Intronic
1086500892 11:87452536-87452558 TTTCATATATTTAAATTATTAGG + Intergenic
1086508954 11:87534983-87535005 TTTCATATATTTAAATTATTAGG + Intergenic
1087914155 11:103789110-103789132 TTTCACACATTTAAATCAGTTGG - Intergenic
1088167851 11:106959410-106959432 TCACACATATTTTATGTACTCGG + Intronic
1091618128 12:2065658-2065680 GCTCACAGATTTAAAGAAGAAGG + Intronic
1093397558 12:18702048-18702070 TTTCACATATTTCAAATTGTTGG - Intronic
1093821790 12:23628279-23628301 GAGCACATATTTAAAATAGTAGG + Intronic
1093861808 12:24175207-24175229 TCTAACATCTTTCATGTAGTGGG + Intergenic
1095243572 12:39890374-39890396 TATCACATATTTAGGGAAGTAGG - Intronic
1095479024 12:42614415-42614437 TCTGACATCTTTAAAGGACTGGG - Intergenic
1095764842 12:45883388-45883410 TATCAAATATTTACAATAGTTGG + Intronic
1096857073 12:54491182-54491204 TCTCAAATTTCTAAAGTTGTAGG + Intergenic
1096999754 12:55866714-55866736 TTTCACATATTTAAATTATTAGG - Intergenic
1098833868 12:75396866-75396888 TATAAAATATTTAAAGTAGCTGG - Intronic
1099036531 12:77594159-77594181 TCTCACATATTTACAATTGTAGG + Intergenic
1100586616 12:95986483-95986505 TCTCAGATATTTAAAGTAGAAGG - Intronic
1103067131 12:117908773-117908795 TGTGACATATTTGAAGTATTAGG - Intronic
1105756616 13:23470772-23470794 TTTCACATATTTCAAATAGAAGG + Intergenic
1109688298 13:65849570-65849592 TATAGCATATTTAAAGTGGTAGG - Intergenic
1109756629 13:66769803-66769825 TCTCATATTTTTACAGTTGTGGG + Intronic
1111325319 13:86686852-86686874 TCTCTCATTTTTAAATTAGTAGG + Intergenic
1111724550 13:91989326-91989348 TCTTACATGTTTAGAGTAATGGG - Intronic
1112665537 13:101568229-101568251 TCTATCAAATTTAAAGTATTTGG - Intronic
1113077754 13:106484720-106484742 TCTGAAATATTTAAGGGAGTTGG + Intergenic
1113176806 13:107574133-107574155 TCTCATATATTTGCAGAAGTAGG - Intronic
1113225994 13:108160043-108160065 TCTGACAAATTCAAATTAGTTGG - Intergenic
1113429674 13:110238853-110238875 TCTCAAGTATTTAAGATAGTAGG - Intronic
1113867755 13:113539049-113539071 TCACAAATATTTAAAACAGTTGG + Intronic
1116690171 14:48095796-48095818 TTTCACATATGTAAAGATGTCGG + Intergenic
1116747787 14:48843751-48843773 TCTCACAAACTCAAAGTAGAAGG - Intergenic
1120275025 14:82361932-82361954 TCTAACATATTCAAAGTATTTGG - Intergenic
1120730784 14:87998789-87998811 CCTCAGATACCTAAAGTAGTGGG + Intergenic
1121807675 14:96845022-96845044 TGTCACTCATTTAAGGTAGTAGG + Intronic
1125746230 15:41999474-41999496 TCTCACTTATTCATAGCAGTGGG - Intronic
1126136225 15:45394699-45394721 TCTCACATATTTTAGGGTGTGGG + Intronic
1129621243 15:77148611-77148633 TCTAACATATTTAAAGGAGAAGG + Intronic
1131960049 15:97780742-97780764 TTGCACATATTTAAAGTATACGG - Intergenic
1134892910 16:17856853-17856875 TCTCACAGCTTTAAAATAGCAGG + Intergenic
1135541698 16:23334811-23334833 TGTCACATTTTAAATGTAGTAGG + Intronic
1136038140 16:27556382-27556404 TTTCATATTTTTAAAGTACTGGG - Intronic
1137017424 16:35391946-35391968 TCTCACATATTTAACAATGTGGG - Intergenic
1139071162 16:63384997-63385019 TCTCACATATATAAAGTACAGGG + Intergenic
1142424351 16:89993110-89993132 TATCAAATTTTTATAGTAGTGGG - Intergenic
1143743208 17:8969373-8969395 TCTCACATATTTTATGTACTGGG - Intergenic
1147472366 17:40674952-40674974 TCTCACATCTTTATAATAGGAGG - Intergenic
1148264445 17:46214031-46214053 TTTCACATAGTTAAAGTATAGGG - Intronic
1150357100 17:64496268-64496290 TCTCATCTTTTTGAAGTAGTCGG - Intronic
1154968940 18:21387736-21387758 TCAGACATATTTCTAGTAGTGGG + Intronic
1155015911 18:21839292-21839314 TAGCAAAGATTTAAAGTAGTGGG - Intronic
1155458401 18:26047131-26047153 TCTCACATCCTTGAGGTAGTAGG - Intronic
1155861343 18:30904452-30904474 TTTCAAATACTCAAAGTAGTAGG + Intergenic
1156052043 18:32949044-32949066 AGTAACATATTTAAAGTAATGGG - Intronic
1156121377 18:33846768-33846790 ACTGACATATTTTAAATAGTGGG - Intergenic
1156643707 18:39134009-39134031 TCTCACATTTTTAATGTTTTTGG + Intergenic
1156759148 18:40566317-40566339 ATTCACATGTTTAAAGCAGTTGG - Intergenic
1158886600 18:61833935-61833957 CCACACATAATTAAAGGAGTTGG - Intronic
1159400860 18:67931867-67931889 TTTCAAATATTTATAATAGTGGG + Intergenic
1166273881 19:41737500-41737522 TTTCCCATATTTAAATTATTAGG - Intronic
1166426374 19:42682394-42682416 TTTCACATATTTAAATTATTAGG - Intronic
926462184 2:13144627-13144649 TTTCCCATATTTAAATTAGATGG + Intergenic
931489803 2:62732740-62732762 TTTCAAATATTTATAGCAGTAGG + Intronic
933056331 2:77672070-77672092 TTTCACATATTGAAAATATTGGG - Intergenic
933217366 2:79645450-79645472 TCTCCCCTATTTAGGGTAGTTGG - Intronic
933332982 2:80918662-80918684 TGTCATCTGTTTAAAGTAGTGGG - Intergenic
933442305 2:82328336-82328358 TCTCACCTATCTAATGTATTAGG - Intergenic
933706813 2:85297509-85297531 TTTCACATTTTGAAAGAAGTGGG - Intronic
933927887 2:87116385-87116407 TTTCACATATTGAAAATATTGGG - Intergenic
935504955 2:103889122-103889144 TCTAACATATATAAAGTGCTTGG - Intergenic
937133544 2:119531921-119531943 TTTCACATATTTAAATCATTAGG + Intergenic
939975390 2:148711346-148711368 TAACACATATTTAAAATACTTGG + Intronic
940750914 2:157626434-157626456 GTTCAGATATTTAAAGTCGTAGG + Intronic
940816353 2:158302069-158302091 CATCACATTTCTAAAGTAGTTGG + Intronic
941213173 2:162668754-162668776 TTTCAAATATTTTAAGTATTGGG + Intronic
941573948 2:167206826-167206848 TCTCATATTTTGAAAGTAATAGG + Intronic
942336893 2:174898258-174898280 TCTCCCATGTTCAAAGTATTGGG - Intronic
943949798 2:194119117-194119139 TTTAACATATATAAAGTATTTGG - Intergenic
944629672 2:201611806-201611828 TCTCACCTTTTCAAAGTTGTTGG - Intronic
946912059 2:224473383-224473405 TCTGACATACTTGAATTAGTGGG + Exonic
947293461 2:228603606-228603628 CATCCCATATTTAAAGGAGTGGG - Intergenic
1168840886 20:909461-909483 TCTCACAGATGTAAAGTTGAGGG + Intronic
1169612137 20:7393329-7393351 TCTTACATATGTAAACTACTGGG + Intergenic
1173104494 20:40120738-40120760 TCTCACATCCTTAAAGTACAGGG - Intergenic
1174048928 20:47753971-47753993 CATTACATGTTTAAAGTAGTTGG - Intronic
1174768136 20:53272968-53272990 TCTCCTCTATTTAAAGTAGGTGG - Intronic
1175383795 20:58581319-58581341 TCTCATACATTTAAAGGAGTAGG + Intergenic
1175882442 20:62268505-62268527 TCTCATTTATGTAAAGAAGTGGG - Intronic
1176725560 21:10429284-10429306 TCTCTCATATTTAAAGAACATGG + Intergenic
1176890440 21:14311614-14311636 TCTTTCACCTTTAAAGTAGTAGG + Intergenic
1177341347 21:19805199-19805221 GCTCACATGCTTAAATTAGTTGG - Intergenic
1178099214 21:29248976-29248998 TTTCAAATTTTTAAAGAAGTGGG - Intronic
1180621323 22:17164429-17164451 TCTCACATAAACGAAGTAGTTGG + Intronic
1184314110 22:43669997-43670019 TCTAACATTTTTAAGGTTGTAGG + Intronic
949815023 3:8049050-8049072 TCTAACATTTTTAAAGTGGAAGG - Intergenic
951356385 3:21672018-21672040 TCTCAAATATTCAAGGTTGTTGG + Intronic
953824761 3:46241562-46241584 TTTCACATATTTATCTTAGTTGG + Intronic
954535525 3:51356697-51356719 TTTCTCATATGTAAAGTAGGAGG - Intronic
955186890 3:56722945-56722967 TATCACATATTCAAATTAGGAGG + Intergenic
957962464 3:87275068-87275090 AATCACATATTTTAAATAGTAGG - Intronic
958722908 3:97867614-97867636 TTTCAAATATTTAAGGAAGTAGG - Intronic
958917496 3:100065924-100065946 TTTCAGATATGTAAAGTATTAGG + Intronic
959722104 3:109503714-109503736 TCACACAAATTTAAAGTAAAGGG - Intergenic
959726908 3:109553839-109553861 TCTCAGATATTTAGATTAGGTGG + Intergenic
962691128 3:137899575-137899597 TCGGACACATTTAAAGCAGTGGG + Intergenic
964353842 3:155830755-155830777 ACTCAAATATTTAAAGAAATAGG + Intronic
964601047 3:158501715-158501737 TCACACAAATTTAAAGTAAAGGG - Intronic
965448733 3:168809756-168809778 TCCCACAGAATTAATGTAGTTGG - Intergenic
971465592 4:26956249-26956271 TTTCACATAATTAGAGTAATGGG + Intronic
973549296 4:52015797-52015819 TCACAAATATTTCAAATAGTTGG - Intronic
974135940 4:57818042-57818064 TCTTAAATAAGTAAAGTAGTGGG - Intergenic
976385696 4:84455414-84455436 ACTCACATATTTCCAGAAGTAGG + Intergenic
976575001 4:86658614-86658636 TCTCTCATATTTTTAGTATTAGG - Intronic
976578847 4:86710192-86710214 TCTCACATTTTTAAAGATATGGG - Intronic
976608870 4:87008234-87008256 TCTCACATATTTAAAGTAGTAGG + Intronic
976669158 4:87632867-87632889 TCTCACATATTTAGGGTATTGGG - Intergenic
977831835 4:101603355-101603377 ACACACATATATAAAATAGTTGG + Intronic
978259103 4:106731329-106731351 TCTCAAATAATTAATGTAGTAGG - Intergenic
978895113 4:113877433-113877455 CCTCAAATTTTTAAAGCAGTTGG - Intergenic
978930052 4:114298837-114298859 TATCAAATATTTAAAGAACTAGG - Intergenic
979164174 4:117505330-117505352 ACTAAAATATTTAAAATAGTCGG + Intergenic
979181598 4:117735697-117735719 TTTCAGATCTTTAAAGTAGGAGG - Intergenic
979420162 4:120494337-120494359 TCTCTCCTTTTTAAAGTAGGTGG + Intergenic
980282912 4:130743425-130743447 TCTCAAATACTTTAGGTAGTAGG + Intergenic
980802352 4:137768716-137768738 ACTTACAGATTTAAAGAAGTAGG + Intergenic
981099643 4:140816078-140816100 TCTTACATATTTCAGGTAGAGGG - Intergenic
983267485 4:165522702-165522724 TCTCAGGTATTTATAGTAGTTGG + Intergenic
983947341 4:173600918-173600940 TCTCAAATATCTCAAGAAGTGGG - Intergenic
986840882 5:11696308-11696330 TTTCACATATTTTAAATAGTTGG - Intronic
987157604 5:15106344-15106366 TCTTACATAGTAAATGTAGTGGG - Intergenic
989252334 5:39332171-39332193 TCTCAAATAATTTAAATAGTTGG - Intronic
989717042 5:44476549-44476571 TTTCACATATTTATATTACTAGG - Intergenic
990542382 5:56787046-56787068 TAGCACATATTAAAACTAGTTGG + Intergenic
991012943 5:61902588-61902610 TCTCTCAAAGTTAAAGTAATAGG - Intergenic
994634979 5:102333509-102333531 TCCCACATATTTATAGGAATTGG - Intergenic
995051559 5:107711749-107711771 TTGCACATTTTTAAAGTATTTGG + Intergenic
995337353 5:111014967-111014989 TCTAAGATATTGAAAGTAGTTGG + Intergenic
995995872 5:118298690-118298712 TCTCAGAAATTTAAAATACTAGG + Intergenic
998187441 5:139992173-139992195 TTGCACATTTTTAAAGTAGAAGG + Intronic
999417515 5:151411894-151411916 TTTCTCCTATTTAAAATAGTAGG - Intergenic
1002670122 5:180860397-180860419 TCTAAGACATTTAAAGTAGTTGG - Intronic
1003109463 6:3241387-3241409 TCTCAAATATTTAAAATAAGTGG + Intronic
1003830779 6:10008791-10008813 GCTTACATATTTAAAATACTTGG - Intronic
1004156480 6:13172648-13172670 TCTCACCTATTTAATGTTTTAGG + Intronic
1005250383 6:23938973-23938995 TTATACATATTTTAAGTAGTTGG + Intergenic
1005403260 6:25457556-25457578 ACTCCCATATTCAAAGTAGATGG + Intronic
1009031787 6:58067871-58067893 TTTCACATATTTAAATTATTAGG - Intergenic
1009207623 6:60822322-60822344 TTTCACATATTTAAATTATTAGG - Intergenic
1009654126 6:66518025-66518047 TCATAAATATTTAAAGGAGTTGG - Intergenic
1009822545 6:68822460-68822482 TCTCAAATATATAAAATAATAGG - Intronic
1010522617 6:76858494-76858516 TCTGACATATTTAGAGGAGCAGG - Intergenic
1011009378 6:82686571-82686593 TCTCAGATATTTATAGTCCTTGG + Intergenic
1012030081 6:94048733-94048755 GCTCACATTTTTAAAATAGGAGG - Intergenic
1014267774 6:119300714-119300736 TCTCTCATGTTTAAAATAGAAGG + Intronic
1015536935 6:134276008-134276030 TCTCTCATATATTCAGTAGTGGG + Intronic
1016634636 6:146273369-146273391 TCTCACATAATAAAAGCTGTGGG - Intronic
1017199178 6:151733990-151734012 TCTCACAGTTTCAAAGTAGGAGG - Intronic
1017750419 6:157486205-157486227 TCTCCCATATGTAAGGGAGTCGG + Intronic
1018037111 6:159890954-159890976 TCTCAAATATTTTCAGCAGTGGG + Intergenic
1018340831 6:162849243-162849265 TCACACACATGTAAAGGAGTGGG + Intronic
1018400966 6:163419170-163419192 ACTCATATATTTAAAGGAGAGGG - Intronic
1021035002 7:15786633-15786655 TATGACATATTTAAAGTGCTGGG + Intergenic
1022666289 7:32414581-32414603 TCTGACATATTAAAAGAAGTTGG + Intergenic
1022863487 7:34392243-34392265 TTTTACATATTTAAATTATTGGG + Intergenic
1023270027 7:38452558-38452580 TCTTCCATATTTAGGGTAGTTGG - Intronic
1024404239 7:48959980-48960002 TCTTACATATTTAAAAAATTAGG + Intergenic
1024413257 7:49071997-49072019 TGTCATATATTTCAAGCAGTTGG - Intergenic
1025013148 7:55415394-55415416 TCTGACATATATACAATAGTTGG - Intronic
1027244314 7:76356685-76356707 TCTCATTTATTTAAAATACTGGG - Intronic
1029404767 7:100367935-100367957 ACTCACAGATTTAAAGCAGTTGG + Intronic
1031938216 7:127758751-127758773 TGTCAGATTTTTAAAGTAGCAGG + Intronic
1032367457 7:131313831-131313853 TTTCACATATTTAAATTATTAGG - Intronic
1034878354 7:154744832-154744854 TCTCAAATATCTACAGCAGTAGG + Intronic
1035351919 7:158253095-158253117 TGACACATATTTAAAGCACTTGG - Intronic
1037231397 8:16663066-16663088 TTTGACATAGTTAAAGTTGTAGG + Intergenic
1037953171 8:23032153-23032175 CCTCACATATTTCAAGTGATTGG + Intronic
1039448474 8:37651337-37651359 CCTCACATATTAACACTAGTGGG + Intergenic
1039587865 8:38721560-38721582 TCTCACATATGTCCAGTAGGTGG - Intergenic
1041298021 8:56381005-56381027 TATAACATATTCAAAGTACTGGG - Intergenic
1043031936 8:75146197-75146219 TCTCACCTATTTAACGTAGCCGG + Intergenic
1047049017 8:121088782-121088804 TCACACATAAATAAATTAGTGGG - Intergenic
1051452136 9:17208519-17208541 CCAATCATATTTAAAGTAGTTGG - Intronic
1051806684 9:21001709-21001731 GCTCACATATTCAAAGTGTTAGG + Exonic
1054892640 9:70268581-70268603 TTTCACAAATTTAAAGTATCTGG + Intronic
1055292862 9:74801809-74801831 TCTCTCATCTTTAAACTTGTAGG - Intronic
1055492312 9:76817945-76817967 TTTCACATATTTCTATTAGTTGG + Intronic
1057733291 9:97630773-97630795 TTTCAAATATTTACAGAAGTAGG - Intronic
1059128065 9:111713466-111713488 ACTCACATGTTTAAATTTGTTGG + Intronic
1060167588 9:121431634-121431656 TCTCACTAATTTATATTAGTAGG + Intergenic
1060452946 9:123760771-123760793 GCTCACATAATTAAAGTGATTGG + Intronic
1061459870 9:130728800-130728822 ACTCAGATATTTAAATTAGCAGG - Intronic
1186027150 X:5325720-5325742 TGGCACATATTTACAGCAGTTGG - Intergenic
1186314433 X:8353707-8353729 TCTCTCATTTTTATTGTAGTTGG + Intergenic
1186768588 X:12795270-12795292 ACTCACATATTCAAAGGATTAGG + Intronic
1186965287 X:14780386-14780408 TCTCAAAGATTTAATGTTGTAGG - Intergenic
1188153646 X:26713137-26713159 TCACACATAATCAAAGTAGAGGG - Intergenic
1188335325 X:28924909-28924931 TCTTTCATATTGAAATTAGTTGG + Intronic
1189520858 X:41766282-41766304 TATTGCATATTTAAACTAGTAGG + Intronic
1190785250 X:53640816-53640838 GCTCACATATATAAAGTATCGGG - Intronic
1193591568 X:83394138-83394160 TCTCAAATATTTTAAAAAGTAGG + Intergenic
1194575717 X:95612126-95612148 TTTCACATATTTAAATTATTAGG - Intergenic
1196259457 X:113560592-113560614 TCTCTCATGTTCAAAGTATTGGG + Intergenic
1196424583 X:115557327-115557349 TCTCTCATACTTAAAATATTTGG - Intergenic
1196460618 X:115925587-115925609 TCTAACATTTTTAAAGTATTGGG - Intergenic
1198939673 X:141939591-141939613 TTGCACATATTAAAAGTACTAGG + Intergenic
1199551418 X:149065730-149065752 TTTCTCATATTTAAAGGATTAGG - Intergenic