ID: 976609587

View in Genome Browser
Species Human (GRCh38)
Location 4:87016191-87016213
Sequence TTGTGGGGAAAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 1, 1: 1, 2: 11, 3: 114, 4: 955}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976609578_976609587 15 Left 976609578 4:87016153-87016175 CCTGGGCGATCTTTTGGTAGCTT 0: 1
1: 0
2: 0
3: 3
4: 53
Right 976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG 0: 1
1: 1
2: 11
3: 114
4: 955
976609577_976609587 19 Left 976609577 4:87016149-87016171 CCAGCCTGGGCGATCTTTTGGTA 0: 1
1: 0
2: 1
3: 4
4: 73
Right 976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG 0: 1
1: 1
2: 11
3: 114
4: 955
976609575_976609587 29 Left 976609575 4:87016139-87016161 CCGTTGCACTCCAGCCTGGGCGA 0: 8289
1: 124235
2: 259379
3: 210650
4: 119891
Right 976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG 0: 1
1: 1
2: 11
3: 114
4: 955

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976609587 Original CRISPR TTGTGGGGAAAGAGGGAAGA GGG Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
900681674 1:3920129-3920151 ATGGAGGGAGAGAGGGAAGAAGG - Intergenic
901442016 1:9283655-9283677 GTTGGGGGAAAGAGGAAAGAGGG + Intergenic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
902077628 1:13800504-13800526 ATGTGGAGGAAGAGGGGAGACGG + Intronic
902086818 1:13869016-13869038 TCGTGGGGACAGCGGGAGGAGGG + Intergenic
902389713 1:16095970-16095992 TTGGAGGGGAAGAGGGAAAAGGG + Intergenic
902392075 1:16112666-16112688 TTGGGGGGTCAGAGGGAAGGGGG + Intergenic
902751192 1:18512310-18512332 TGATGGGGAAAGGAGGAAGATGG + Intergenic
902997843 1:20240913-20240935 TTGTTGGGATAGAGGCAACATGG + Intergenic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904301503 1:29557471-29557493 TGGGAGGGAGAGAGGGAAGAAGG + Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904445649 1:30571204-30571226 TTGTGGGGAACGGAGCAAGATGG + Intergenic
904469368 1:30726595-30726617 TGGTGGGCAAAGAGTGAAGGGGG - Intergenic
904593913 1:31631048-31631070 ATTTGGAGAAAGAGGGATGAGGG - Intronic
905209815 1:36366367-36366389 TTGTGGGGGAAGAGGGAGCAAGG + Intronic
905462452 1:38130578-38130600 TTGGGGGGAAAGGGGGAGGGAGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
906931083 1:50170159-50170181 TTGTGGGGCATGAGAGAAGAAGG + Intronic
907074303 1:51564786-51564808 TTGAGTGGAACAAGGGAAGATGG - Intergenic
907335543 1:53697138-53697160 TTGTCTGGATAGTGGGAAGACGG + Intronic
907364466 1:53946828-53946850 TTGGGGAGAGAGCGGGAAGAAGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908262433 1:62349480-62349502 TTGTGGGGGAGAAGTGAAGAGGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908564388 1:65339753-65339775 ATGCAGGGAAAGAGGAAAGAAGG + Intronic
909141269 1:71868853-71868875 TTGAGGGGAAAGTGGTGAGAGGG - Intronic
909361298 1:74761899-74761921 TTGGGAGGAATGATGGAAGATGG + Intronic
909464424 1:75957357-75957379 TTTTGTGGAAAGAAGGAAAAAGG + Intergenic
909790645 1:79673640-79673662 ATGTGAGGAAAGAGGGCAAATGG - Intergenic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910144585 1:84064892-84064914 ATGGAGGGAAAGAGAGAAGAGGG - Intergenic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910300325 1:85699195-85699217 TTTGCTGGAAAGAGGGAAGAAGG - Intronic
910479883 1:87646925-87646947 TTGTGGGGAAAGAGGAAAGGAGG + Intergenic
910744633 1:90560230-90560252 TTGTAGGGAAAGTGGGATGTTGG + Intergenic
911051594 1:93676104-93676126 TTGTGAGGAAAGAGGGCTGCTGG - Intronic
911074787 1:93862502-93862524 TTCTGAGGCAAGAGGGAAGGGGG + Intergenic
911121847 1:94304140-94304162 TTTTGGGGGATGGGGGAAGAAGG + Intergenic
911178467 1:94840879-94840901 TTGTTGGGAAAGAGGTCCGAGGG + Intronic
911276418 1:95864977-95864999 TTGTGGGGAGAGAGGAAGGGAGG - Intergenic
911731889 1:101300120-101300142 TTCTGAGGCAAGAGGAAAGACGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912517853 1:110227165-110227187 GTTTGGGGACAGAGGGAAGTGGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915237034 1:154491490-154491512 TTGTGGGGTATCAGAGAAGAAGG - Intronic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
915703276 1:157818503-157818525 TAGTGGGGAAGGAGGAATGAGGG + Intronic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916004624 1:160648119-160648141 TTGTGGGCATAGAGAGTAGAAGG - Intergenic
916081230 1:161233629-161233651 TTTTGGGGAAACAGTGTAGAGGG + Intronic
916090044 1:161300849-161300871 TTGAGGGGAAAGAAAGAGGAGGG - Intergenic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916312782 1:163415445-163415467 TGGTGGAGAAAGAGAGATGAGGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917032987 1:170715611-170715633 TTGTGGGAGAAGATAGAAGATGG + Intronic
917342483 1:173994048-173994070 TTGTTGGGGAAGGGGGTAGAGGG + Intronic
917519999 1:175740519-175740541 TGGTGGGGAAAGATGGAAGGAGG - Intronic
917598375 1:176552353-176552375 GCGTGGGGAAAGAGGGAAAGGGG - Intronic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918329502 1:183444452-183444474 CTTTGGGGAAATAGGAAAGAAGG + Intergenic
918477336 1:184939381-184939403 TTGTGGGGACAGTAGGAATAGGG - Intronic
919276820 1:195428858-195428880 TTGTGGGGTTAGAAGCAAGATGG + Intergenic
919435642 1:197556201-197556223 TTGTGGGGAAAGGTGGGAGTGGG + Intronic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921297677 1:213719999-213720021 GTGTGGGGAAAGAGGAAGGCAGG - Intergenic
921563405 1:216686203-216686225 TAGTGGGGAGACAGGGAGGAGGG + Intronic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
921694379 1:218190777-218190799 TTTTGGGGAAGGGAGGAAGATGG + Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
922165358 1:223111151-223111173 TTCCGTGGAAAGAGAGAAGAGGG + Exonic
922870597 1:228899070-228899092 TTGTGGGGCATGAGGGAACCTGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922932632 1:229402375-229402397 TTGTGGGGGATGAGAGTAGACGG + Intergenic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
924554222 1:245104734-245104756 GTGTGGGGAAAAGGGGAAGGAGG - Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
924638156 1:245808382-245808404 TTGAAAGGAAAAAGGGAAGAGGG + Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063169829 10:3498421-3498443 TCGTGGGGAAAGAAAGAAGAGGG + Intergenic
1063374494 10:5545991-5546013 TTGCAGGGGAAGAGGGGAGAAGG - Intergenic
1063441591 10:6077553-6077575 TTCTGGGGAAAGTGAGGAGAGGG + Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1065198932 10:23295307-23295329 TTCTGGGGAAAGCGTGAGGATGG - Intronic
1065313855 10:24442699-24442721 TTTTGGGGAATGTGGGAGGAGGG + Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065990072 10:31000454-31000476 TTGTGGGGGTAGAGAGAAAAAGG - Intronic
1066205795 10:33188168-33188190 TTGAGGGGACAGAGGCACGATGG - Intronic
1066691256 10:38030808-38030830 ATGTAGGGTAAGAGGGGAGATGG + Intronic
1067001444 10:42617860-42617882 ATGTAGGGTAAGAGGGGAGATGG - Intronic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067613812 10:47744422-47744444 TTGGGGGGGAGGGGGGAAGAGGG + Intergenic
1067901976 10:50251354-50251376 TCTTGGGGAAGGAGGGAAGGAGG - Intergenic
1067985189 10:51135962-51135984 TTGTGGGGGAAGGGGGGAGGGGG + Intronic
1068665026 10:59664598-59664620 TTATGGAGAAAGAAGGAAAATGG + Intronic
1068780738 10:60916754-60916776 TTGTGTGGCATGAGGGAATAGGG + Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069165446 10:65152387-65152409 GTGTGGGGAATGAGGAAATAGGG + Intergenic
1069184074 10:65400468-65400490 TGGTGGGGGAAGGGGGAAGGAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070015527 10:72526181-72526203 TGGATGGGAAAGAAGGAAGATGG + Intronic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070611673 10:77937631-77937653 TTGTGGGGTAGGTGGGAACAAGG - Intergenic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071301796 10:84261589-84261611 TTGTGGGGTGAGTGGGAAGGAGG - Intergenic
1072025618 10:91452987-91453009 ATGTGAGGAAAGGGGAAAGAAGG + Intronic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072320827 10:94248145-94248167 GTGTAGGGAAAGAAGAAAGAAGG - Intronic
1072541376 10:96400683-96400705 TTTCAGGGAAAGAGGGAAAAAGG + Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073785686 10:106886595-106886617 TGGTCAGGAAAGAAGGAAGAAGG + Intronic
1074351827 10:112745174-112745196 TTGTGGAGAGAGTAGGAAGAGGG + Intronic
1074476914 10:113781768-113781790 TTGTTGGGGAAGGGGGAAGGAGG - Intronic
1074708171 10:116154549-116154571 TTGTGGGGAAAGTGACTAGAAGG + Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074781915 10:116808293-116808315 TGGTGGGGAAAGGGGGACGGGGG + Intergenic
1074867013 10:117550652-117550674 ATGGGGGGAAAGAGGGGAGGTGG - Intergenic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075080389 10:119379608-119379630 TTCGTGGGAAACAGGGAAGAGGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075781524 10:125020491-125020513 TTGTGGAGACAGACAGAAGAGGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077361150 11:2140607-2140629 TTGTGGGGAAAGCGGCTGGAGGG - Intronic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077921676 11:6646551-6646573 TGCTGGGGAAAGAGACAAGATGG - Intronic
1078040378 11:7856110-7856132 TGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1078423378 11:11230236-11230258 TGTAGGGGAAAGAGGGAAGTTGG - Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078868458 11:15321237-15321259 TTGTTAGGCAAGAGGGTAGATGG + Intergenic
1079142767 11:17823767-17823789 TTGTGGGGAATAAAGGAAGCTGG - Intronic
1079178567 11:18167937-18167959 TTCAGGGGAAGGATGGAAGAGGG + Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079646513 11:22869933-22869955 TTTTGGGGCAAAAGGGAAGCAGG - Intergenic
1079734114 11:23973969-23973991 TTATGAGGAAAAAGGGAGGAGGG + Intergenic
1080132665 11:28815096-28815118 GGGTGAGGAAAGAGGGGAGATGG - Intergenic
1080229936 11:30008952-30008974 TGGTGGGGAAAGGGTGGAGAGGG + Intergenic
1080425777 11:32153011-32153033 TTCTGGGAAAAGAGGAAGGAAGG - Intergenic
1080899887 11:36479842-36479864 TTGGGGGAAAAGAGAGGAGATGG + Intergenic
1081321835 11:41700790-41700812 TTGTGGGGATAGAAGCAATATGG + Intergenic
1081366075 11:42237085-42237107 ATGGGGGGAAAGAAGGAATAAGG - Intergenic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1081849487 11:46265241-46265263 TTGGGGGGCAAGAGGAGAGAAGG + Intergenic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1083097441 11:60266269-60266291 ATGTGGGGAAAGACAGGAGAAGG - Intergenic
1083203901 11:61135941-61135963 TCGTGGAGAAAGATGTAAGAAGG - Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084611522 11:70206166-70206188 ATGTGGGGAAAGATTGGAGAAGG + Exonic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085678533 11:78548935-78548957 GTGAGGGGAAAGGAGGAAGAGGG - Intronic
1085951537 11:81338339-81338361 GTATGGCAAAAGAGGGAAGAGGG + Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087651043 11:100867894-100867916 GTGTCGGGGAAGAGGGAAGCTGG + Intronic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087866431 11:103233077-103233099 GTCTAGGGAAAGAAGGAAGAAGG + Intronic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1088101172 11:106157495-106157517 TTGTGGGGAAAGATGAAAATTGG - Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088847159 11:113678228-113678250 GGGAGGAGAAAGAGGGAAGAGGG + Intergenic
1089032800 11:115350382-115350404 TTAAAGGGAAGGAGGGAAGAAGG + Intronic
1089187075 11:116625389-116625411 TTAGGGAGAAGGAGGGAAGAAGG - Intergenic
1089391486 11:118104889-118104911 TTTTTAGGAAAGAGAGAAGAAGG - Intronic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1090432944 11:126661990-126662012 GTTTGGGTAAAGAGGAAAGAAGG + Intronic
1090735086 11:129605877-129605899 TTGAGGCTAAATAGGGAAGAAGG - Intergenic
1091364709 11:135007961-135007983 TGGGGCGGAAAGAGGGCAGAGGG + Intergenic
1091558180 12:1591807-1591829 TTGGGGGGAAACTTGGAAGAGGG + Intronic
1091750956 12:3020943-3020965 GAGGAGGGAAAGAGGGAAGAGGG - Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092524014 12:9298559-9298581 TTGTGGGGAAAGGAGCAGGATGG - Intergenic
1092543256 12:9433255-9433277 TTGTGGGGAAAGGAGCAGGATGG + Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092961453 12:13600208-13600230 ATGAGGGGAAAGAGGAAGGAAGG - Intronic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1093667615 12:21833116-21833138 TTGGGGTGAAGGATGGAAGAGGG + Intronic
1093686734 12:22064675-22064697 ATTTGGGGAAAGGGAGAAGAAGG - Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1094008471 12:25781571-25781593 ATGTTGGGAAGGAGGGAGGAGGG - Intergenic
1094019812 12:25902385-25902407 TTATGGGAAAAGACTGAAGAAGG - Intergenic
1094104603 12:26797575-26797597 ATTTGGGGAAAGAGAGAAGGTGG + Intronic
1094763363 12:33561409-33561431 TTGTGGGGGAAAAGGTAAGCAGG + Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1096357412 12:50952866-50952888 TTGAGGGGAAAGAGGGCACAGGG - Intergenic
1096709918 12:53447881-53447903 TTGAGGAGGAACAGGGAAGAAGG + Intergenic
1096836342 12:54353578-54353600 TTGTGGGAAAAGAGGGGGCATGG - Intergenic
1097174114 12:57133042-57133064 TTGTGGGCTAAGAGGGAGAAAGG + Intronic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1097603415 12:61722998-61723020 TTGTGGAGACATTGGGAAGAAGG - Intronic
1097806482 12:63970051-63970073 GTCTGGGGAAAGGGGGAAGGTGG - Intronic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098334305 12:69386642-69386664 ATGTGGGGAGAGAGGGTATAGGG + Intronic
1098583471 12:72129615-72129637 ATGTTGGGAAAGAGAGAAGCAGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098877015 12:75876455-75876477 TTGTGGGGACAGGTGGAAGGGGG + Intergenic
1098913715 12:76236102-76236124 TTTTGGGGAAAAACAGAAGAGGG + Intergenic
1099277740 12:80599280-80599302 TTATGGGGAATGAGAGAATAAGG + Intronic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100287574 12:93182208-93182230 TTGAGGGGAAATTGGGTAGAGGG - Intergenic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1101234676 12:102776462-102776484 TGGAGGGGAAAAAGGGAGGAAGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102232099 12:111269785-111269807 CTTTGGGGAAAGAGGAGAGAGGG - Intronic
1102473859 12:113175998-113176020 TTGTGGGGGAAGTGGGGAGGGGG - Intronic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103147637 12:118609344-118609366 TTGAGGGGAAGGAGGGAAAGAGG + Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103237681 12:119386972-119386994 TTGAGGGGGAAGAGGGGAGGAGG - Intronic
1103412624 12:120723508-120723530 TTTTGGGGGAAGCGGGAAGGAGG - Exonic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1104962909 12:132496708-132496730 ATGTGGGGAAACAGGGAAGGAGG - Intronic
1105424827 13:20285162-20285184 TTCTGGGGATCGAGGGAAGGAGG + Intergenic
1105936654 13:25106714-25106736 TTGACTGGAAAGAGGCAAGAAGG + Intergenic
1106241502 13:27917196-27917218 GTGAAGGGAAAGGGGGAAGAGGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106447958 13:29853080-29853102 TTTTGGGGGAACAGGGAAGGTGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1108393007 13:49966332-49966354 TTGTGGGGGAACAGGGTATATGG + Intergenic
1108423121 13:50271120-50271142 TTGGGAGGAAAGAGAGAAGAGGG + Intronic
1108748954 13:53426602-53426624 TAGAGGGGAAAGAGAGAGGAGGG - Intergenic
1108894834 13:55313205-55313227 TTGAGGGGCAAGAGAGAAAATGG - Intergenic
1109595707 13:64550847-64550869 TTTTGGAGAAAGTGGGAATATGG - Intergenic
1109760611 13:66823354-66823376 TTTTTAGGAAAGAGAGAAGAAGG + Intronic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110563070 13:76929959-76929981 TTGTGGGGAAAAAGGGATATTGG - Intergenic
1110775722 13:79406033-79406055 TTGCTGGGGAAGAGGGAAGGGGG - Exonic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112937444 13:104818973-104818995 TTCTTGGGAGAGAAGGAAGATGG - Intergenic
1113412369 13:110101507-110101529 TTTTCAGGAAATAGGGAAGAAGG + Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113941742 13:114021994-114022016 TTGTGGGCAAAGGGGACAGATGG - Intronic
1114173500 14:20297952-20297974 TTGTGGGGAGAGTGGCAGGAGGG + Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1115429824 14:33303564-33303586 TTTTGGGGAACAATGGAAGATGG + Intronic
1115901455 14:38154105-38154127 TATTTGGGAAAGAGGGTAGAAGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116831685 14:49726487-49726509 TTGTGGGTAAAGAATGACGATGG - Intronic
1117028055 14:51641848-51641870 TTATGGGGAAAGCGGGGAGGAGG - Intronic
1117033813 14:51705719-51705741 TGATGGGGAAAGAAGGCAGATGG - Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117730797 14:58719972-58719994 TTGGGGAGAAAGAGGAAAAATGG + Intergenic
1118476096 14:66118918-66118940 ATGTGAGGAAAGATGGAAGGAGG - Intergenic
1118590404 14:67396670-67396692 ATGTGGGCAAAGATGGAACAAGG - Intronic
1118762893 14:68891287-68891309 TTGTGGGGACAGGGTCAAGAAGG + Intronic
1118817857 14:69325443-69325465 TTCTGGGGAAACAGGGACGAGGG - Intronic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119507150 14:75182772-75182794 GGGTGGGGGAAGAGGGGAGAAGG - Intergenic
1119618620 14:76114914-76114936 TTGTGGGGAAGGACGAAGGAGGG + Intergenic
1119775008 14:77242882-77242904 TCCTGGGGAAGGATGGAAGAAGG - Exonic
1119976280 14:79027843-79027865 TTGTGGGGGAAGAGGGGAAGAGG - Intronic
1120489950 14:85164804-85164826 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121505377 14:94473126-94473148 TGGTGGGGGAAGGGGGAAGGAGG - Intronic
1121583813 14:95049261-95049283 TTCTGGGGAAAGTGTGCAGAGGG - Intergenic
1121651814 14:95564367-95564389 TTGTGGGGTCAGAGTGATGATGG + Intergenic
1122014001 14:98777887-98777909 TTGTGGGGAATGTGGGGAGAGGG + Intergenic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122297238 14:100712465-100712487 TTGCCGGGAAAGAGGCAACAGGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122449919 14:101797473-101797495 GGGTGGAGAAAGAGGGCAGAGGG - Intronic
1122723075 14:103732844-103732866 TTGTGGGGATAGGGGGCAAATGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123471694 15:20559777-20559799 TTGGGGGGCAAGAGAGAAAATGG - Intergenic
1123587518 15:21772863-21772885 TGTTGGGGAAAGAGGGGAAAGGG + Intergenic
1123624156 15:22215428-22215450 TGTTGGGGAAAGAGGGGAAAGGG + Intergenic
1123646311 15:22440576-22440598 TTGGGGGGCAAGAGAGAAAATGG + Intergenic
1123731997 15:23154762-23154784 TTGGGGGGCAAGAGAGAAAATGG - Intergenic
1123750133 15:23352144-23352166 TTGGGGGGCAAGAGAGAAAATGG - Intergenic
1124282501 15:28376063-28376085 TTGGGGGGCAAGAGAGAAAATGG - Intergenic
1124300202 15:28535542-28535564 TTGGGGGGCAAGAGAGAAAATGG + Intergenic
1124597905 15:31106101-31106123 TTGTGGGGAAAGAAGAATGAGGG - Intronic
1124600178 15:31127488-31127510 ATGTGGTGAAAGTGGGAAGGTGG + Intronic
1124692128 15:31832612-31832634 TTGTGGGCGACGAGGGATGAGGG - Intronic
1125204072 15:37131334-37131356 ATGCAGGAAAAGAGGGAAGAGGG + Intergenic
1125526888 15:40382212-40382234 TTGTGGTGAAATTGTGAAGAAGG - Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125947716 15:43723477-43723499 TTTTGGGGGAAAAGGGAAGGAGG + Intergenic
1127176760 15:56366346-56366368 TTAGGGGGAAAAGGGGAAGAGGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127876998 15:63120121-63120143 GTGTGGGGAAACAGGAAATAGGG - Intergenic
1127901887 15:63346903-63346925 ATGTGGGGAAAGAAGGACTAGGG + Intronic
1128557456 15:68641434-68641456 TTTGGGGGAGAGAGGAAAGAAGG + Intronic
1128699863 15:69796302-69796324 TTGTGAGAAGAGATGGAAGAAGG + Intergenic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129074208 15:72977503-72977525 TTTGGGTGAAAGAGGGAAGCAGG + Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129514516 15:76148853-76148875 TTGCGGGAAGAGAGGGAGGAGGG - Intronic
1129783375 15:78289998-78290020 TGGTGTGGAAAGTGGGAAAAAGG - Exonic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129879557 15:78997885-78997907 GGGTGGGGAGAGAGGAAAGAAGG + Intronic
1129947437 15:79551565-79551587 GGGAGGGGAAAGAAGGAAGAAGG + Intergenic
1130052538 15:80495796-80495818 GTGTGGGGAAAGTGGAAGGAGGG - Intronic
1130275058 15:82472182-82472204 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130300473 15:82676644-82676666 TTGTGGGAGAGGAGTGAAGATGG + Intronic
1130467407 15:84199551-84199573 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130496853 15:84473984-84474006 GAGTGGGCAAACAGGGAAGAAGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130589702 15:85204149-85204171 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130649738 15:85755761-85755783 TGGTGGGGAACCAGGGAGGATGG - Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131116043 15:89796401-89796423 ATGTGGGGAAAGCAGTAAGAGGG + Intronic
1131479887 15:92771664-92771686 TTGTGGGGTTAGAAGCAAGATGG + Intronic
1131795825 15:96015858-96015880 TTTTGGGGGAAGCGGGAAGGAGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132113794 15:99121054-99121076 TGGTGGGGGAAGTGGGGAGATGG + Intronic
1132279155 15:100597725-100597747 TTGTGGGGGCAGATGGAAAAGGG - Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134231131 16:12431229-12431251 GTCTGGGCAAAGGGGGAAGAGGG + Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134511362 16:14850338-14850360 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134656327 16:15950376-15950398 TTTGGGGGAACCAGGGAAGAAGG + Intronic
1134699006 16:16248835-16248857 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1134906572 16:17984669-17984691 GAGAGGGGAAAGAGGGAAGGGGG - Intergenic
1134972831 16:18545838-18545860 TTCTAGAGAAAGAGGGAGGAGGG - Intronic
1135040244 16:19112775-19112797 TTGTGGGGGAGGGGGGAAGGGGG + Intergenic
1135241915 16:20814844-20814866 TAGAGGGGAAATAGGGGAGAAGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135869808 16:26138843-26138865 TCCTGGAGAAAGAGGGCAGAGGG + Intergenic
1136011663 16:27367388-27367410 TTGTGGGGGATGAGGGGAGGGGG + Intergenic
1137074325 16:35943701-35943723 TTCTGGGGATAGAGCCAAGATGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137892952 16:52181440-52181462 TTGTGAGGTAAGAGGGAACAAGG + Intergenic
1138306671 16:55983170-55983192 TTGTGGGGGCAGAGGGTATATGG - Intergenic
1138371974 16:56534238-56534260 TTATGTGGAAAGAGGGAGTAGGG + Intergenic
1138894578 16:61188089-61188111 ATATGGCGAAAGAGGGAACAAGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1140186228 16:72774650-72774672 TGGCGAGGAAAGAGGGTAGAAGG - Intergenic
1141057651 16:80833452-80833474 TTGCTGGGGAAGAGGGAAGGAGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141659101 16:85432066-85432088 TTATGGGGGAAGAGGGGTGAGGG - Intergenic
1141835617 16:86537168-86537190 TTGTGGGAAATTTGGGAAGAAGG + Intronic
1142404910 16:89882970-89882992 TTGAGGAGAAAGGAGGAAGAAGG + Intronic
1142887060 17:2919535-2919557 TTGTGGGGAACACGGGAAGTGGG + Intronic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1143016884 17:3895535-3895557 TGGTTGGGGAAGAGGGCAGAAGG + Intergenic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143359130 17:6353256-6353278 TTGTGGGGAATGTGGAAACATGG + Intergenic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143514395 17:7412095-7412117 TTGTGGGGAAAGATGGGGGTCGG - Intronic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1144422893 17:15114201-15114223 ATGAGGGGAAAGAAGCAAGATGG - Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1145886818 17:28387824-28387846 TTGGTGGGAAATAGGGAAGAAGG + Intronic
1145933359 17:28701264-28701286 TTCTGGGTGAAGACGGAAGAGGG + Intronic
1146322874 17:31859937-31859959 TTGAGGGGGATGAAGGAAGAGGG - Intergenic
1146501498 17:33368743-33368765 TGGTGAGGAGAGAGGAAAGATGG - Intronic
1146618857 17:34380456-34380478 TTTTGGGACAAGAGGGAAAAGGG - Intergenic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1147257892 17:39192896-39192918 AAGTGGGGAAAGAGGCATGAAGG + Intronic
1147265082 17:39229695-39229717 TTGTTGGGAAAGTGGGCAGTGGG + Intergenic
1147383947 17:40071068-40071090 GGTGGGGGAAAGAGGGAAGAAGG - Intronic
1148028145 17:44602298-44602320 GGGTGGGGAAAGAGAGAAGGTGG + Intergenic
1148197849 17:45727611-45727633 ATGTGGGGAAAGTGTGGAGAAGG - Intergenic
1148546185 17:48520745-48520767 TTCTGTGGGAAGTGGGAAGATGG + Intergenic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1148638259 17:49165627-49165649 GTGGGGGGAAAGAGAGAGGAAGG - Intronic
1149202185 17:54199837-54199859 TTGGGGGGAAAGGGGAAATAAGG - Intergenic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1150351076 17:64444935-64444957 TTATGGAGAAGGAGGAAAGATGG - Intergenic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150836412 17:68568095-68568117 TCTTGGGGAAAGAGAGAATAGGG + Intronic
1151200417 17:72463837-72463859 TGGTGGGGAAAAAGGAAAGTGGG + Intergenic
1151578712 17:74965556-74965578 TTGTGGGGAAAAGGGGAAGGGGG - Intronic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152737907 17:82006509-82006531 TTGAGGGGAAAGAGAAAGGAGGG + Intronic
1153098842 18:1440740-1440762 TTGTGGGGAGATAGGAAAAAAGG + Intergenic
1153327020 18:3831031-3831053 TTGTGGGCAAACAGGGATCATGG + Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153835958 18:8964183-8964205 TTGTGGAGAATAAGGGAAAAAGG - Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154301091 18:13193301-13193323 TTGTGGGGAAAAGCAGAAGAGGG - Intergenic
1154937920 18:21079548-21079570 TGGAGGGGTAAGAGTGAAGAGGG + Intronic
1155029453 18:21971603-21971625 TTTTTGGGAGACAGGGAAGAGGG - Intergenic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155747108 18:29369739-29369761 TTCTAGGGAAAGAAGGAATATGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156375716 18:36513700-36513722 AAGAGGGGAAAGAGGGATGAAGG - Intronic
1156386064 18:36606364-36606386 TTGTAGGGGAAGAGAGGAGAAGG + Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1158106866 18:53895372-53895394 GTGTGGGAAAAGAGGCAAGTCGG + Intergenic
1158894700 18:61901773-61901795 TTGTGGAGATAGAAGGAAAAGGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159321701 18:66859343-66859365 GTCTAGGGAAAGAGGGAAGTGGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161273402 19:3402875-3402897 TGAGGGGGAGAGAGGGAAGAGGG + Intronic
1161635037 19:5382927-5382949 AGGTGGGGAAAGTGGGAAGCGGG - Intergenic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1162634184 19:11953716-11953738 TTGAGTGGAAAGAGGGCAGCAGG + Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163160929 19:15463864-15463886 TTAGGGGGAAAGAGGGAACAGGG + Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163625940 19:18389695-18389717 TTTTGAGGAATGAGGAAAGATGG - Intergenic
1163841502 19:19613708-19613730 GAGTTGGGAAAGGGGGAAGATGG - Intronic
1164484704 19:28645003-28645025 TAGTGGGAAAAGAGGAAACAAGG + Intergenic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165427226 19:35752915-35752937 TGGTGGGGGAAGCGGGCAGATGG - Exonic
1165614520 19:37188046-37188068 GTGAGGGGAAAGAGAGAAAAGGG + Intronic
1165762432 19:38329560-38329582 ATGCAGGGAAAGAGGGAAGGAGG + Intergenic
1166171419 19:41029961-41029983 TTGTGGGGGAAGAGGTGGGAAGG + Intergenic
1166302743 19:41921637-41921659 TTGGGAGGAAGGAGAGAAGAGGG + Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1167100072 19:47399233-47399255 TTCTGGGAAAAGGGGGAGGAGGG + Intergenic
1167261963 19:48463828-48463850 TGGTGGGGGAAGAGGAGAGAGGG - Intronic
1167712188 19:51119172-51119194 TAGTGGGGGATGATGGAAGAGGG + Intergenic
1167781348 19:51601187-51601209 TGGTGGGGAGAGACGGGAGAGGG - Intergenic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168467851 19:56618631-56618653 TTGTGGGGAAACAGGCCTGAAGG + Intronic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
925513614 2:4654612-4654634 TTGTCGGGGGACAGGGAAGAAGG - Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927592052 2:24365011-24365033 TTCAGGGGAAAGAGGAGAGAAGG + Intergenic
928051878 2:28006892-28006914 TTGTGGGGAAATAAGGTATATGG + Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930253828 2:49066152-49066174 TTGATGGGGAAGAGAGAAGAAGG + Intronic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931755508 2:65370776-65370798 TGGTCAGGAAAGAGGGGAGATGG - Intronic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932310455 2:70735580-70735602 TTGTTAGGAAAGAGGGAGGAGGG - Intronic
932379510 2:71269542-71269564 TTGTGGGGTACGATGGAAGTGGG - Intergenic
932459073 2:71870845-71870867 TTCTGGTTAAAGAGGCAAGATGG + Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
933057986 2:77697794-77697816 TTGTGGGGAAAGATAGTATATGG + Intergenic
933187572 2:79295539-79295561 TTGTGAGGGAAGAAGGGAGAGGG - Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935720928 2:105978568-105978590 TTGTTTTGAAAGAGGGAAAATGG - Intergenic
935809049 2:106778034-106778056 ATGTGAAGAAAGAGAGAAGATGG + Intergenic
936745933 2:115576559-115576581 TTGTCAGGAAAATGGGAAGAAGG + Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
936989979 2:118352993-118353015 GAGTGGGGAAAGTGGGAGGATGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937334635 2:121054431-121054453 TTGTGGGGAAGGGTGGCAGATGG + Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938399395 2:130976208-130976230 TTGAGGGATAAGAGGGAAAAGGG + Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938890154 2:135696337-135696359 TTATGGGGAAGAAGGGAAGGTGG + Intronic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939724544 2:145700210-145700232 TTATGGAGAAAGAGAAAAGAAGG - Intergenic
940106109 2:150102181-150102203 TTGCTGGGAAAAAAGGAAGAGGG - Intergenic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940368040 2:152870520-152870542 CCGTGGGGAAAAAGAGAAGAGGG + Intergenic
940800036 2:158123250-158123272 GTGTGCGGAAAGGGGGAAGGTGG + Intronic
941088003 2:161141470-161141492 TTGAGGGGCAAGAGGAAGGAGGG - Intronic
941163033 2:162056549-162056571 TTGTGAGGTTAGAGGCAAGATGG - Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941655747 2:168143346-168143368 ATCTGGGGAAAGAAGGGAGATGG - Intronic
941903927 2:170703298-170703320 TGGTTTGGAAAGTGGGAAGAGGG - Intergenic
942526323 2:176856733-176856755 TTCAGGGGACAGAAGGAAGAGGG - Intergenic
942543965 2:177043616-177043638 TTTTGGGGAGAGAGGGAGAAAGG - Intergenic
942587809 2:177503536-177503558 TTGTGGGGACAGCAGGAAGTAGG + Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942655302 2:178208741-178208763 AAGGAGGGAAAGAGGGAAGAAGG - Intronic
942994971 2:182249709-182249731 TTGGGGGGTAAGGGTGAAGAAGG - Intronic
943266368 2:185738262-185738284 TTGAGGAGAAAGAGGGAAATAGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943394439 2:187315589-187315611 TGGTGGGGCGAGAGGGAACAGGG - Intergenic
943543008 2:189241191-189241213 TTAAGGGAAAAAAGGGAAGATGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
944209897 2:197196249-197196271 TTGTGGGGAAAAAAGAAAAATGG + Intronic
944482676 2:200174227-200174249 GTGTGGGGGAAGAGGGGACATGG - Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944837567 2:203595046-203595068 GTGTGGGGATAGGGGGAATATGG + Intergenic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
945128630 2:206541517-206541539 TGGAGGGGAAAGAGGGACAAAGG + Intronic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
945785179 2:214225357-214225379 TTGTGGAGAATGAGGGTATAAGG + Intronic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946213452 2:218165455-218165477 GTGTGGGGTAAGATGGAATATGG + Intronic
946330113 2:219004219-219004241 GGGTTGGGAAAGAAGGAAGAGGG - Exonic
946510441 2:220349920-220349942 TTGTGGGGCATGGGGGAAGGGGG + Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946963121 2:225006017-225006039 TAGAGTGGAAAGAGTGAAGATGG + Intronic
946984138 2:225252611-225252633 TTGTCAGGAAAGAGGCATGAGGG - Intergenic
947377803 2:229514681-229514703 TGTTGGGGAAAGAGGGTGGAGGG - Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948316552 2:237031805-237031827 GTATGGGGAAAGAGGAAGGAGGG + Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169409756 20:5357868-5357890 TGGTGAGGAAGGAGGGAAAATGG + Intergenic
1169410774 20:5367899-5367921 TTGTGAGGTTAGAGGCAAGATGG + Intergenic
1169826654 20:9776027-9776049 TTTTGGGGAAAGTGAAAAGATGG + Intronic
1170029391 20:11929342-11929364 ATGAGGGGAAAGGGGGATGAAGG + Intergenic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170713497 20:18812576-18812598 TTTTGGGGAAAGCTGGGAGAAGG + Intronic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1172090929 20:32432074-32432096 TTGTGGGGAAAGTGTTGAGAGGG + Intronic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173044064 20:39492641-39492663 TTGTGGAGAACGGGGAAAGAAGG + Intergenic
1173461794 20:43248810-43248832 TTGAGGGGCAAGAGGGAAATAGG + Intergenic
1173509947 20:43619485-43619507 TTGTGTGGAAAGTGGAAAGGAGG + Intronic
1173821994 20:46025581-46025603 GGATTGGGAAAGAGGGAAGATGG + Intronic
1173833707 20:46111101-46111123 TTGAGGGGAAGGAGGGCAGGAGG + Intergenic
1174303627 20:49600100-49600122 TTGTGGGGAATGGGGGACGAGGG - Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175245031 20:57577095-57577117 ATGTGGGGAGAGTGGGTAGATGG - Intergenic
1175571943 20:60030054-60030076 TTGTGGGGGAAGGTGGCAGAAGG - Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175766168 20:61594255-61594277 GTGGGGGGGAAGAGGGAAGGGGG + Intronic
1175774995 20:61647579-61647601 TTGTGAGGAGAGAGAGGAGAGGG - Intronic
1175869091 20:62199097-62199119 CCTGGGGGAAAGAGGGAAGACGG - Exonic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1177072463 21:16527735-16527757 TTTTGAGAAAATAGGGAAGAGGG - Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178129274 21:29552502-29552524 TTCTGGGGAAACGGGCAAGAAGG - Intronic
1178267033 21:31152994-31153016 TTGTTGGTAAAGAGGAAAAATGG - Intronic
1178580150 21:33831503-33831525 TTGAGGGGGAAGAGGGAGGCAGG + Intronic
1179005234 21:37508072-37508094 GTGTGGGGAAAGAGGGAGAGAGG - Intronic
1179336923 21:40465285-40465307 TTGTGGGGAGAGAGAAAAGCAGG - Intronic
1180203254 21:46240025-46240047 TGGTGGCTAAAGAGGGAAGTGGG + Intronic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181477286 22:23176606-23176628 GTGTGGGGAATGAGGGATGTTGG - Intergenic
1181595767 22:23913611-23913633 TGGAGGGGAAAGAAGGGAGATGG - Intergenic
1181995318 22:26875769-26875791 GTGTGGGGAAAAAAGAAAGATGG - Intergenic
1182298339 22:29323826-29323848 ATCTGGGGAAAAAGGGAAGTTGG + Intergenic
1182332192 22:29559018-29559040 TTTAGGGGACAGTGGGAAGAGGG - Intronic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1183395636 22:37569289-37569311 TTCTGGGGTAAGAGGGAGGCTGG - Exonic
1183440034 22:37817928-37817950 TTGTGGGGCACAAGGGAGGATGG - Intergenic
1183464359 22:37972159-37972181 GGGTGGGGAAAGAGGGAGGGAGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184775954 22:46622986-46623008 TTGTGGGAAAAGAAGTAATAGGG + Intronic
1185256978 22:49839472-49839494 GTGTGGGGAATGAGGGTAGGCGG + Intergenic
949744014 3:7267703-7267725 TAGCGGGGAAAGACGGAAAACGG + Intronic
949867072 3:8555124-8555146 TTGTGGGGAAATGGGGCAGAGGG - Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951044055 3:18018755-18018777 ATGTGGGGAAAGAGAAAACAGGG - Intronic
951321984 3:21255737-21255759 TTGTGGGGGAGGAGCCAAGATGG - Intergenic
951324918 3:21289937-21289959 TTATGAAGAAAGAGGGTAGAGGG + Intergenic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954851421 3:53604193-53604215 TTGTGTGAAAAGTGGGAAGTGGG + Intronic
954854882 3:53635460-53635482 TTGGGGGGGATCAGGGAAGATGG + Intronic
954934683 3:54315541-54315563 TTGTGGGGAAGGGGAGTAGAGGG - Intronic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955451271 3:59069522-59069544 TTGTTGGGAAGGTTGGAAGAGGG - Intergenic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
955756629 3:62231282-62231304 TTCTGGGGAGAGAGGAGAGAAGG + Exonic
956045867 3:65195250-65195272 TTGTAGAGAAAGTGGGGAGAAGG + Intergenic
956744182 3:72298568-72298590 TTGTGGGGAGAGAGTGATGAGGG + Intergenic
957350007 3:79012453-79012475 TTGAGGGGAAAGTGGATAGAAGG - Intronic
958491003 3:94773086-94773108 GTGTAGGGAAAGAGAGAATATGG + Intergenic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
959084651 3:101838492-101838514 TTGTGGGCCAAGAGACAAGATGG + Intronic
959097954 3:101976169-101976191 TAGTGGGGAGAGAGGGAATGGGG + Intergenic
959120964 3:102231559-102231581 TTGGGAGCAAAGAGGGAAAAGGG - Intronic
960273419 3:115699357-115699379 TGGTGGGGGAAGAGGAAGGAAGG - Intronic
960796808 3:121496138-121496160 TTGAGGAGAAGGACGGAAGATGG - Intronic
961006521 3:123409374-123409396 ATGTGGGGAAAAAGGACAGACGG + Intronic
961021131 3:123508064-123508086 TTTAGGGCAAAGAGGGAAAAGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961602060 3:128069985-128070007 TTGTGGGGAAACAGGTGAGACGG - Exonic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
961996189 3:131246250-131246272 TTGTGGGGAAAGGGTGAGGGAGG - Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
965401310 3:168215985-168216007 TTGTGTGGAATGAAGGAAGAGGG + Intergenic
965684376 3:171286083-171286105 TGCTGGGGAGAGAGGGGAGAGGG + Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967236573 3:187390721-187390743 TTGTGGGGAAAGGTGGGAGAGGG + Intergenic
967510427 3:190304692-190304714 TTTTGGGAAATGAGGAAAGAAGG + Intergenic
967996761 3:195172816-195172838 ATTTGGGGAAAGAGGGCAAAGGG + Intronic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
969752787 4:9124772-9124794 TTGTCGGGAAACGGGGAAGAGGG + Intergenic
970146585 4:13042450-13042472 TGGTAGGGAAAAAGGGAACAGGG - Intergenic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970329411 4:14963662-14963684 TTGCAGGGTAAGAGTGAAGAGGG + Intergenic
970329436 4:14964063-14964085 TTGTGGGGTAAGAGTGAAAAGGG - Intergenic
970764561 4:19532014-19532036 TTGTGGAGACAAAGGAAAGAAGG + Intergenic
970781579 4:19744173-19744195 TTATGGGGAGAGGGAGAAGAAGG - Intergenic
971902718 4:32682687-32682709 TTGTGAGGTTAGAGGAAAGATGG - Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972644465 4:40954380-40954402 TGGAGAGGAAAGAGGGAAGGTGG + Intronic
973704991 4:53572286-53572308 TTCTGGGGAATGAGGGAGGTAGG + Intronic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
975662285 4:76699623-76699645 TTTTGTGGGAACAGGGAAGAAGG + Intronic
975905096 4:79200377-79200399 GTTCTGGGAAAGAGGGAAGAAGG + Intergenic
975923582 4:79422193-79422215 TTGTGGGGTAGGAGGGAGAATGG - Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976188836 4:82469662-82469684 TTGTGAGGTTAGAAGGAAGATGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976564825 4:86541180-86541202 TTATGGGGAAAGTGGGGAGTGGG + Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976818297 4:89175404-89175426 AGGTTGGGAAAGAGGGAAGATGG - Intergenic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
977226194 4:94394644-94394666 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
977397010 4:96484006-96484028 GTCTGTGGAAAGAGGGAAGGAGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978066995 4:104417233-104417255 TTCTGGGTAATGAGGGAAGCTGG + Intergenic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
978669005 4:111223696-111223718 TTTTGGGTAAAGAAAGAAGAAGG + Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
978990492 4:115076080-115076102 TTGTTGGGAAAGAGGGAACAAGG - Exonic
979033349 4:115679645-115679667 TTGTGAGGAAATGGGGAAAATGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980008775 4:127571428-127571450 TTGAGGGGAGAGAGGTGAGATGG - Intergenic
980010435 4:127588927-127588949 TTGTGGGGGAGGAGCCAAGATGG + Intergenic
980305184 4:131051738-131051760 ATTTGGGATAAGAGGGAAGAGGG + Intergenic
980581443 4:134759063-134759085 TTTTGGGGAAAAAAGGAAGGAGG - Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981134559 4:141195459-141195481 AGGTGGGGAAAGGAGGAAGAGGG - Intronic
981220671 4:142229836-142229858 TTTTGGGGGGATAGGGAAGAAGG + Intronic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981365920 4:143903027-143903049 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981386550 4:144138199-144138221 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981766549 4:148257136-148257158 TTCTGGGCAAAGTGGGTAGAGGG - Intronic
982229340 4:153194154-153194176 AGATGGGGAAAGAGTGAAGAAGG + Intronic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982616547 4:157644396-157644418 TGGTGGGCAAACTGGGAAGATGG + Intergenic
982807300 4:159782413-159782435 GTGTGGGGATAGAGGGCATATGG - Intergenic
983271005 4:165561637-165561659 TTGAGGGGAAAGAGAGGTGAGGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983905550 4:173177559-173177581 TGGTGGGGAGAGATGAAAGAAGG + Intronic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984043785 4:174771872-174771894 TTGTGGTGAAAGAGGCAAAATGG + Intronic
984462532 4:180056558-180056580 GTGTGGGGAAATGGGGAGGAGGG + Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
986192417 5:5509638-5509660 TTGAGGGGGAAGAGGGCAGGAGG + Intergenic
986313350 5:6571064-6571086 AGGAAGGGAAAGAGGGAAGAGGG + Intergenic
986347105 5:6845890-6845912 TAGTGAGGAGAGAGGAAAGAAGG + Intergenic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986669864 5:10133243-10133265 GTGTGGGGACAGAGGGGATAAGG - Intergenic
987097285 5:14561095-14561117 TTGTGAGCTAAGAGGGGAGATGG + Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988148497 5:27344101-27344123 TATTGGGGAAAATGGGAAGAAGG + Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
989008575 5:36843547-36843569 TTGTGGGGAAATAGGAAATAGGG - Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989412847 5:41140312-41140334 GTTTGGGGGAAGAGGGAGGATGG + Intergenic
989502133 5:42179864-42179886 TTGAGGGTAGAGAGGAAAGAGGG + Intergenic
990058421 5:51615684-51615706 TTGTGGGGAGAGAAGTGAGATGG + Intergenic
990552028 5:56891194-56891216 TTTGGGGAAAAGAAGGAAGAGGG + Intronic
990574515 5:57111592-57111614 TTGAGGGGGAAGAGGGCGGACGG - Intergenic
991037552 5:62143146-62143168 TAATGGGGAAAGACGCAAGAGGG + Intergenic
992400580 5:76407798-76407820 TTGTGTAGTAAGAGGGTAGATGG - Intronic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
993014448 5:82519716-82519738 TTGTGGGGAATGTGGGCAGAGGG + Intergenic
993134612 5:83943376-83943398 TTTTAGGGAAATAGGGAAGAGGG + Exonic
993869609 5:93236853-93236875 TTTTGGGGGAAAAGAGAAGAGGG + Intergenic
993954623 5:94216660-94216682 ATGTGGGGGAAGTGAGAAGACGG - Intronic
994401786 5:99289288-99289310 TTGTGAGGAAAGAGGGACATGGG + Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
995704921 5:114978505-114978527 GTGTGGGGGAAATGGGAAGAGGG + Intergenic
995717939 5:115098715-115098737 TGGTAGGGAATGAGGGAGGATGG + Intergenic
995734545 5:115285946-115285968 TTGTGGGGGATGAGGGGAAAAGG + Intronic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996450777 5:123621668-123621690 AAGTGGGGAAAAAGGCAAGAAGG - Intergenic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
996870205 5:128182370-128182392 TTTTGGGGAAAGAAGGAACTGGG - Intronic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997258619 5:132448321-132448343 TTGTGGGGAGATAAGGAATACGG - Intronic
997340494 5:133140980-133141002 TTGGGGGGATATAGGGTAGAGGG - Intergenic
997963263 5:138338367-138338389 GGGAGGGGAAAGAGGGAAGGAGG - Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998171425 5:139874011-139874033 GTGTGGGGAAAGAGTGACCACGG + Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998523899 5:142825301-142825323 TTGTGGAGGAAGAGGGTAGTTGG + Intronic
998722823 5:144974293-144974315 TTGACAGGAAAGAGGGAAAAAGG + Intergenic
998977283 5:147662318-147662340 TTGTGGGGCAGGAAGGGAGAAGG - Intronic
999090450 5:148931674-148931696 TAGGTGGGAAAGAGGGAAGGAGG - Intronic
999167180 5:149559821-149559843 TTGGGGGGAGAGAGAGAATAGGG - Intronic
999961816 5:156764041-156764063 TTCTTGGGACAGGGGGAAGAGGG - Intronic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000240863 5:159406823-159406845 TTGTGGGAAAAGAGAGAAGCAGG + Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000404011 5:160866732-160866754 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1000885691 5:166744836-166744858 TGGAGGGGAATGAGAGAAGAGGG + Intergenic
1000920148 5:167128570-167128592 TTCAGGTGAAAGAGGGAACAGGG - Intergenic
1001815722 5:174667826-174667848 TTCTCGGGAAAGAGGGACAAAGG + Intergenic
1001835127 5:174825182-174825204 TGGTGGGGAAAAAGGGACAAGGG - Intergenic
1001859383 5:175040135-175040157 TTAAGTTGAAAGAGGGAAGAAGG - Intergenic
1001980725 5:176035612-176035634 TTGTGGGGGAAGGGGGAAAGGGG - Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002236735 5:177808453-177808475 TTGTGGGGGAAGGGGGAAAGGGG + Intergenic
1002460164 5:179369347-179369369 GTGTGGGGACAGAGCGAAGGCGG - Intergenic
1002664690 5:180814465-180814487 TGGTGGGTAAAGAGAGAAAAGGG - Intronic
1003122437 6:3329158-3329180 TTGTGGGGGATGAGGGAGGTGGG - Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003481830 6:6541733-6541755 AAGACGGGAAAGAGGGAAGAGGG - Intergenic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1003867410 6:10375894-10375916 TTTTGGTGGAAGGGGGAAGAGGG + Intergenic
1004005939 6:11637229-11637251 TTGTGTGGAAAGAGAGGAGGAGG + Intergenic
1004057787 6:12158542-12158564 TTGTGGGGCAAGGAGGAGGATGG + Intronic
1004315379 6:14582247-14582269 TGGATGGGAAAGAAGGAAGAGGG - Intergenic
1005119953 6:22378978-22379000 ATGTGGGGAAAAGGGCAAGAAGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005390702 6:25330403-25330425 TTTTGGGGAGCCAGGGAAGAAGG + Intronic
1005836456 6:29713136-29713158 TCGTGGGGAAAGATGCAGGATGG + Intergenic
1005850440 6:29816806-29816828 TGGTGGGGAAAGATGCAGGATGG + Intergenic
1005857288 6:29872216-29872238 TGGTGGGGAAAGATGCAGGATGG + Intergenic
1005860076 6:29893531-29893553 GTGTGGGGAAAGATGCTAGATGG + Intergenic
1005863048 6:29916066-29916088 TGGTGGGGAAAGATGCAGGATGG + Intergenic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1005926222 6:30447864-30447886 GGGTGGGGAAACAGGGAGGAAGG + Intergenic
1006169117 6:32082952-32082974 ATGAGAGCAAAGAGGGAAGATGG - Intronic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006575310 6:35040908-35040930 TTCTGGGATACGAGGGAAGAGGG - Intronic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1007503512 6:42316562-42316584 TTGTGAGGCTAGAGGCAAGATGG - Intronic
1007572102 6:42900239-42900261 TTGTTGGGGAAATGGGAAGAGGG - Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008596949 6:53052046-53052068 TTGTGGGGTAGGTGGGACGAGGG - Intronic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1009422039 6:63474305-63474327 TTGTGTAGAAAGTGGGAAAACGG + Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1011726853 6:90218464-90218486 GGGTGGGGGAAGAGGAAAGAGGG - Intronic
1011855861 6:91690251-91690273 TTTTGGTGAAAGGTGGAAGATGG - Intergenic
1012433734 6:99192933-99192955 CTTTGGTGAAAGAAGGAAGAAGG - Intergenic
1012711942 6:102617729-102617751 TGATGCAGAAAGAGGGAAGATGG - Intergenic
1012971911 6:105740111-105740133 TTTTAGGGTAAGAGGGAAGAGGG + Intergenic
1013635801 6:112028080-112028102 TTATGGGGCAAGATGGAACAGGG - Intergenic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1013723578 6:113063372-113063394 TCATGGAGAAAGAGGGCAGAAGG - Intergenic
1014054477 6:116997825-116997847 TGGAGGGGAAAGAGGGAGGTAGG - Intergenic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014228582 6:118876220-118876242 TTGAAGGGAAAGAGGGATGAGGG + Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1015097192 6:129429823-129429845 TTGTGGGGAAATAGAGGCGAGGG - Intronic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015242978 6:131046701-131046723 TTAAGGGGGAAGAAGGAAGATGG + Intronic
1015620602 6:135127858-135127880 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1015968097 6:138715287-138715309 TTGTGAAGAAAGAGGGAAGGGGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016049840 6:139519309-139519331 GTTTGGGGAAAGGGGTAAGAAGG - Intergenic
1016404606 6:143716917-143716939 TGGAGGGGCAAGAGGGGAGACGG - Intronic
1017279125 6:152604765-152604787 TTGTAGGGACAGTGGGAAGGGGG - Intronic
1017638844 6:156470748-156470770 TTGTGGGGAAGGAATGAAGAGGG + Intergenic
1018108568 6:160513105-160513127 GAGTGGGGAAAGGGGGAATAGGG - Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019762885 7:2826776-2826798 TTGAGGGGAGACAGGGAAGGAGG + Intronic
1019824478 7:3272400-3272422 TTGAGGGGAAACAGGTAAGGGGG + Intergenic
1019827920 7:3299961-3299983 TGGTGTGGAAAGGGGGCAGATGG + Intergenic
1020891402 7:13882393-13882415 TTGTGGGGAGAGAGTGAACACGG + Intergenic
1020989742 7:15182190-15182212 GTTTGGGGGAAGAGGGAAGTGGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021244290 7:18243084-18243106 TAGTGGGGAAAAAAGAAAGAAGG - Intronic
1021279039 7:18694331-18694353 TTGTGAGGAGAGAGGGACAAAGG - Intronic
1021472737 7:21024326-21024348 AGGTGGGGAAGGAGGGAATAGGG - Intergenic
1021797224 7:24268461-24268483 GAGTGGAGAAAGAGGCAAGAAGG - Intergenic
1021940212 7:25671628-25671650 TTGTGGCAAATGAGTGAAGAAGG + Intergenic
1022009632 7:26297625-26297647 ATGTGAGGAAAGAAGGAAGGAGG - Intronic
1022184960 7:27958404-27958426 TTAAGGGGAAAGGAGGAAGAAGG + Intronic
1022361387 7:29662880-29662902 ATGTGGGCAAAGAGAGACGAAGG - Intergenic
1022435763 7:30383361-30383383 TTTGGGGCAAAGAGGGAAGGGGG - Intronic
1022491480 7:30823457-30823479 ATGAAGGGAAAGAAGGAAGAAGG - Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022935942 7:35176556-35176578 ATGTGGGCAAAGAGAGATGAAGG + Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023396696 7:39758253-39758275 TGGTGAGGAAAGAGGAAAAAGGG + Intergenic
1024037823 7:45523743-45523765 TTGTGGAGAAAGGGAGATGAAGG + Intergenic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026741786 7:72983474-72983496 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026801629 7:73403902-73403924 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1027101949 7:75381603-75381625 TTATGAGGAAGGAGAGAAGAGGG - Intergenic
1027738239 7:81963368-81963390 TAGAAGGGAGAGAGGGAAGAGGG + Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1028879577 7:95864973-95864995 TTGTGGGGAAAGGGGGAAGGTGG + Intronic
1029154389 7:98504813-98504835 TGGTGGGGAGAGAAGGCAGATGG + Intergenic
1029196206 7:98807238-98807260 ATGTGGGGAAAGAGCAAAGGTGG - Intergenic
1029745434 7:102513424-102513446 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1029763373 7:102612403-102612425 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030727925 7:112948109-112948131 TTGTGGGGAAGGATGGGAGGGGG - Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031235807 7:119174809-119174831 GTGGGGGGAAAGAGGAGAGAGGG - Intergenic
1031325125 7:120386375-120386397 TTGAGGGGGAAGAGGCAAGAAGG - Intronic
1031943126 7:127810431-127810453 TTTTAGTGAAAGAGGGCAGATGG - Intronic
1031963149 7:128007604-128007626 TTTTAGGCAAAGATGGAAGAAGG + Intronic
1032190034 7:129759596-129759618 TAGTGAGGAAAGGAGGAAGAAGG + Intergenic
1032201444 7:129825548-129825570 CTGTCGGGAAAGGAGGAAGAAGG - Intergenic
1032290530 7:130586310-130586332 TTGGGGGGAGAGTGGGAAGCAGG + Intronic
1032698775 7:134360536-134360558 TTGTGGGGAAGCAGGAATGAGGG - Intergenic
1033206223 7:139425281-139425303 TGGAGGGGAAAGAGGGAACTTGG - Intergenic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033879712 7:145865406-145865428 TTGGGGGGAAAGGGTGATGAAGG + Intergenic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035994883 8:4534579-4534601 GAATGGGGAAAGAGGGAGGAGGG - Intronic
1036145321 8:6249831-6249853 TTTTGAGGAATCAGGGAAGAAGG - Intergenic
1036279024 8:7383322-7383344 TGGAGGGGAAAGAGAGAAGGAGG - Intronic
1036342496 8:7928552-7928574 TGGAGGGGAAAGAGAGAAGGAGG + Intronic
1036506016 8:9356751-9356773 AGCTGGGGAAAGAGAGAAGACGG - Intergenic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037234696 8:16704103-16704125 TTGTGGGGAAAGAGCTTAGAAGG - Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038279908 8:26154498-26154520 TTGTGGAGAAAGAGGAAGGGAGG + Intergenic
1038642276 8:29338099-29338121 TTGGGAGGGAGGAGGGAAGATGG - Intronic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1040072667 8:43201169-43201191 AAGTGGGGAACGAGGGAAGGAGG - Exonic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041221233 8:55653502-55653524 TGGTGGGGAATGGGGGAAAAGGG - Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1042262366 8:66872363-66872385 TGGTGGGGTCATAGGGAAGAAGG - Intronic
1042278553 8:67030077-67030099 TACTGGGGAAAGAGGAGAGATGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1042938692 8:74086271-74086293 TTGTAGAGAAAGACAGAAGATGG - Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044778762 8:95722090-95722112 TTGTGGGAAAAGTGTGACGACGG - Intergenic
1044804151 8:95987730-95987752 TTGTGGGGAAGGAGGGTCTATGG - Intergenic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045164346 8:99586611-99586633 TTGTGGGGAGAGGGAAAAGATGG + Intronic
1045238064 8:100373755-100373777 ATTTGGGAAAAGAGTGAAGAAGG + Intronic
1045340748 8:101252386-101252408 TTTTGGGGCAAGTGGGAAGAGGG + Intergenic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1045906782 8:107355241-107355263 TGGTAGGGAGAGAGGGAAGCGGG - Intronic
1046394347 8:113621302-113621324 TTGTGGGGAAAGGTGGAAAGAGG - Intergenic
1046478505 8:114782199-114782221 TTTGGGGGAAAGAGAGAAGATGG + Intergenic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047180299 8:122581378-122581400 TAGTGGAGAAAGGGTGAAGAAGG - Intergenic
1047284252 8:123472908-123472930 ATGAAAGGAAAGAGGGAAGAGGG - Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048098179 8:131317197-131317219 GGGTAGGGAAAGAGGAAAGAAGG + Intergenic
1048285812 8:133140821-133140843 ATGAGGCCAAAGAGGGAAGAAGG - Intergenic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049055521 8:140233603-140233625 TGGTGGGGAGAGAGGGAGGGAGG - Intronic
1050008231 9:1157443-1157465 TTGTGGGTAAAATGGGGAGATGG + Intergenic
1050122486 9:2321660-2321682 TTATGGTCAAAGAGGGAAGTAGG - Intergenic
1050271076 9:3945929-3945951 ATGTGGGGGAACAGGTAAGAGGG - Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050520885 9:6498586-6498608 TTGCGGGGGAAGAGAGAAAAGGG - Intronic
1050696613 9:8286273-8286295 TGTTGGGGAAGGAGGGAATAAGG - Intergenic
1051123321 9:13775575-13775597 ATGTGGGGAAAGAATGAATAAGG + Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051202441 9:14642661-14642683 ATGTGGGGACAGAGAGAAGGTGG + Intronic
1051260093 9:15255392-15255414 AAAGGGGGAAAGAGGGAAGAAGG + Intronic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052166587 9:25337824-25337846 TTGTGGGGAAAGGGAGTATATGG + Intergenic
1052392997 9:27903044-27903066 TTGCGGGGAAGGAGAGAAGCAGG - Intergenic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1053179167 9:35953073-35953095 TAGAGGGGAAAGGGGGAAAACGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053535324 9:38919966-38919988 TGGTGGGGAAATAGGAAGGAAGG + Intergenic
1053595026 9:39551818-39551840 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053852808 9:42306846-42306868 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1054630807 9:67443984-67444006 TGGTGGGGAAATAGGAAGGAAGG - Intergenic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1055569136 9:77598748-77598770 TTCTGGGAAAAGAGCCAAGAGGG + Intronic
1055845238 9:80554636-80554658 TTGTGGTCACAGAGAGAAGATGG + Intergenic
1056069739 9:82973761-82973783 TGGAAGGGAAAGAAGGAAGAGGG - Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057261967 9:93589836-93589858 TTGTGTGGAGAGAGGGAAAGGGG - Intronic
1057343373 9:94224356-94224378 ACGAGGGGAAAGAGGGAAGGAGG - Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057408338 9:94793741-94793763 TTATGCAGAAAGAGAGAAGAAGG + Intronic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1058066144 9:100550112-100550134 TTGTTGGGAAAGAAAGATGATGG + Exonic
1058223851 9:102336667-102336689 TTATGGAGACAGAGGGAATATGG - Intergenic
1058538868 9:105991417-105991439 ATGGGTGGAAATAGGGAAGAAGG + Intergenic
1058695462 9:107555216-107555238 TTGTGGGGTAACAGAGGAGATGG + Intergenic
1059021757 9:110583255-110583277 ATATGGGGAAAGATGGAAGAGGG + Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059670481 9:116486416-116486438 ATGGAGGGAAAGAGGGAAGAAGG + Intronic
1059675827 9:116538201-116538223 AGGAAGGGAAAGAGGGAAGAAGG + Intronic
1060090158 9:120735509-120735531 TTGTGGGGCAAGGGTGAAGATGG + Intergenic
1060172270 9:121471642-121471664 TTGTGTGGAAAGCTGGAAGTTGG - Intergenic
1060217120 9:121745093-121745115 ATGTGGGGGAAAAGGGCAGACGG + Intronic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061459489 9:130725235-130725257 AAGTGGGGAAAGAGGGAAATGGG - Intronic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1061900886 9:133671404-133671426 TGGTGTGGAAAGAAGGAAGCCGG + Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1185511412 X:667703-667725 TTGTGAGGAAAGAGGAAATAGGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185751106 X:2609871-2609893 TGGAGGGGAAAGAAGGAGGAAGG + Intergenic
1185808008 X:3078419-3078441 TGGAGGCCAAAGAGGGAAGATGG - Intronic
1185884519 X:3770561-3770583 TTGGGGGGAACGGGGGAAGGGGG - Intergenic
1185954880 X:4478380-4478402 AAGGGAGGAAAGAGGGAAGAAGG + Intergenic
1186014871 X:5180109-5180131 TTGGGGAGTAAGAGGGATGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186380199 X:9049868-9049890 GTCTGGGGAAAGATGGGAGATGG - Intronic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1186427813 X:9478012-9478034 AGGTGGGGAAAGGGGAAAGACGG + Intronic
1186852444 X:13593612-13593634 TGGTGGGGAAAGCAGGGAGAGGG + Intronic
1186874929 X:13807403-13807425 TGAAGGTGAAAGAGGGAAGAGGG + Intronic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1186958608 X:14710296-14710318 TTGAGCAGTAAGAGGGAAGAGGG + Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1188550402 X:31358112-31358134 TGAGGGGGAATGAGGGAAGAGGG - Intronic
1189339534 X:40194211-40194233 TTGGGGTGGAAAAGGGAAGATGG - Intergenic
1189512470 X:41676715-41676737 TTGTGAAGAAACAGGGAAAAAGG + Intronic
1189579298 X:42388911-42388933 TTGTGAGGGAGGAGGGAAGTGGG + Intergenic
1189585576 X:42458381-42458403 TTGAGGGGAAAGGTGGAAGGGGG - Intergenic
1189797261 X:44657159-44657181 TTGTAGGGATAGTGGGATGATGG + Intergenic
1190010252 X:46778519-46778541 TGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190933845 X:54975475-54975497 TTGCGGGGAAGGATGGAAGGAGG + Intronic
1190981401 X:55459374-55459396 TGGTGGGGAAAGAGGGAGTCAGG + Intergenic
1190984104 X:55485091-55485113 TGGAGGGGGAAGAGGGAAAAAGG + Exonic
1190987297 X:55513806-55513828 TGGTGGGGAAAGAGGGAGTCAGG - Intergenic
1191157780 X:57294492-57294514 ATTTGGGAAAAGAAGGAAGAAGG - Intronic
1191729402 X:64317296-64317318 TTGGAAGGAAAGAGGAAAGATGG - Intronic
1191869214 X:65731289-65731311 TGTTGGAGAAAGAGGGAACAGGG + Intronic
1192032107 X:67524873-67524895 TTGTGGGGAAAGGAAGAAGTTGG + Intergenic
1192050589 X:67720649-67720671 TCCTGGAGAAAGAGAGAAGAGGG - Intronic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1192762584 X:74109097-74109119 TTGTGGGGAAGGGTGGGAGAGGG + Intergenic
1192789996 X:74372138-74372160 TTGTGGAAAAAGGGGAAAGATGG + Intergenic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193454001 X:81706987-81707009 TTGTGGGGAATGAAGAAGGAAGG - Intergenic
1194363645 X:92986581-92986603 TTATGAGGAATGATGGAAGATGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1196047760 X:111274193-111274215 TTGTGGGGATAGTGGTAAGGAGG + Intergenic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196531216 X:116788839-116788861 ATGGGGGGAAAGGGGGAAGGGGG + Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196834645 X:119802937-119802959 TTATGGGGAGAGAGTGAAGTAGG - Intergenic
1196921035 X:120585374-120585396 TTTGGGGGAAAGGAGGAAGAAGG + Intergenic
1196988472 X:121301086-121301108 TTTTGGGGAAAGAGGTATGTAGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197209828 X:123819479-123819501 TTGTAGAGAAAGAGGGAAGGGGG + Intergenic
1197708516 X:129650503-129650525 TCTTGGGGAAAGAGGGAAGGAGG - Intronic
1197899011 X:131348428-131348450 TTGTGGGGAAGGGATGAAGATGG - Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199137506 X:144270503-144270525 TTACGGGGAGAGTGGGAAGAGGG + Intergenic
1199617659 X:149670699-149670721 TGGTGGGGAGAGAGGAAGGAGGG - Intergenic
1199624984 X:149732550-149732572 TGGTGGGGAGAGAGGAAGGAGGG + Intergenic
1199711460 X:150472661-150472683 TAATGGGGAGAGAGGGAGGAGGG + Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200002078 X:153067326-153067348 TTTTGTGGAAAGAGGGGTGACGG - Intergenic
1200005655 X:153082699-153082721 TTTTGTGGAAAGAGGGGTGACGG + Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1200671879 Y:6102837-6102859 TTATGAGGAATGATGGAAGACGG + Intergenic
1200749663 Y:6933323-6933345 AGGTGGGGAAAGGGGAAAGAAGG + Intronic
1201696216 Y:16829337-16829359 TTGTGAGCAAAGAGTGGAGAAGG - Intergenic