ID: 976618685

View in Genome Browser
Species Human (GRCh38)
Location 4:87105288-87105310
Sequence GAGTGAAGGACTTTAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976618682_976618685 -4 Left 976618682 4:87105269-87105291 CCCTGACTTCACTGATTAGGAGT 0: 1
1: 0
2: 3
3: 15
4: 131
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99
976618680_976618685 18 Left 976618680 4:87105247-87105269 CCATTTGTTTTGTTTGCATGGAC 0: 1
1: 0
2: 0
3: 25
4: 290
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99
976618677_976618685 20 Left 976618677 4:87105245-87105267 CCCCATTTGTTTTGTTTGCATGG 0: 1
1: 0
2: 4
3: 31
4: 443
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99
976618679_976618685 19 Left 976618679 4:87105246-87105268 CCCATTTGTTTTGTTTGCATGGA 0: 1
1: 0
2: 4
3: 42
4: 511
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99
976618675_976618685 24 Left 976618675 4:87105241-87105263 CCCTCCCCATTTGTTTTGTTTGC 0: 1
1: 0
2: 1
3: 47
4: 600
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99
976618676_976618685 23 Left 976618676 4:87105242-87105264 CCTCCCCATTTGTTTTGTTTGCA 0: 1
1: 0
2: 1
3: 33
4: 441
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99
976618683_976618685 -5 Left 976618683 4:87105270-87105292 CCTGACTTCACTGATTAGGAGTG 0: 1
1: 0
2: 1
3: 6
4: 84
Right 976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976618685 Original CRISPR GAGTGAAGGACTTTAGTCTC AGG Intronic
901422156 1:9158470-9158492 GAGAGGAGGGCTTTGGTCTCTGG - Intergenic
910142976 1:84046828-84046850 GAGAGAGGAACTTTAGTCTGGGG + Intergenic
911057812 1:93722879-93722901 GAGTGAAGGATTTTACTCTCAGG - Intronic
913486346 1:119335360-119335382 GTGTGAAGGACTTTGGGCACTGG - Intergenic
916341771 1:163744928-163744950 GTGAGAAGGATTTTGGTCTCAGG - Intergenic
916720604 1:167482449-167482471 GAGTGAACGTCTTTCCTCTCTGG + Intronic
920099248 1:203506821-203506843 GAGAGCAGGACTTCAGACTCTGG - Intronic
921352943 1:214256304-214256326 GAGTAATGGACTTCAGTCTAAGG + Intergenic
1065473946 10:26113727-26113749 GTGTCAAGGACTTTAGCCTAGGG - Intronic
1069654380 10:70077029-70077051 GAGGGAAGGACTTTTAGCTCAGG - Intronic
1072271088 10:93777591-93777613 GAATTAATGACTTTAGTCCCCGG - Exonic
1073232757 10:101986312-101986334 GAGTGAGGGGATATAGTCTCTGG - Intronic
1075393507 10:122110653-122110675 CAGTGAATGACCTTAGACTCTGG + Intronic
1076002716 10:126924823-126924845 GAGTGAAGGATCTAAGTCCCTGG + Intronic
1083049035 11:59760736-59760758 AAGTGAAGGAATTGAGTCTCAGG + Intronic
1084213155 11:67633157-67633179 GAGGGAAGGACTCCAGCCTCAGG - Intronic
1085326602 11:75611117-75611139 GAGGGAGGGACTGTAGCCTCTGG - Intronic
1089344167 11:117779441-117779463 CAGTGAAGGATTTTGGTCTTTGG - Intronic
1090346566 11:126076383-126076405 GAGTGAAGGAATTCAATCTAAGG + Intergenic
1090600365 11:128363628-128363650 TAGAGAAGGATTTTGGTCTCAGG - Intergenic
1093800540 12:23366802-23366824 GTCTGAATGACTTTAGACTCAGG - Intergenic
1094070428 12:26407013-26407035 GAGTGGAGGAGTTTCATCTCTGG - Intronic
1099438653 12:82673378-82673400 GACTGAAGGCCTTTTCTCTCTGG + Intergenic
1100664553 12:96737296-96737318 GAGTGAATGAATTTATTCACAGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1111980412 13:95009767-95009789 AAGTGAAGGTCCTTATTCTCAGG - Intergenic
1119971900 14:78980120-78980142 GAGTGAAGGGCTTAAGTCAAAGG - Intronic
1120549033 14:85846554-85846576 GAATGGAGGACTCCAGTCTCCGG - Intergenic
1121557279 14:94847922-94847944 GAGTGCATGACTTAAGTCCCTGG - Intergenic
1125478705 15:40065135-40065157 GAGTAAAGGACTCCAGACTCTGG - Intergenic
1125925530 15:43559915-43559937 GAGTTACGGGCTTTAGTCACTGG - Intronic
1125938673 15:43659466-43659488 GAGTTACGGGCTTTAGTCACTGG - Intronic
1127007606 15:54587989-54588011 GGGTGAATCATTTTAGTCTCAGG + Intronic
1135393898 16:22116538-22116560 GAGGGAAGGACTACAGTCACAGG + Intronic
1135935676 16:26777788-26777810 GAGGGAAGGACTGGAGTCTGTGG + Intergenic
1144080344 17:11758529-11758551 CAATGATGGACTTTAGTTTCCGG - Intronic
1144930260 17:18853362-18853384 GAATGAAAGACTGTAGTCTTGGG - Intronic
1153740708 18:8124412-8124434 GACTGAATGAATTAAGTCTCAGG - Intronic
1158189662 18:54812254-54812276 GAATGAAGGATTTGAGTTTCCGG + Intronic
1158613877 18:58968330-58968352 CAGTGAGGGAGCTTAGTCTCTGG - Intronic
1160510939 18:79452950-79452972 GATTGAAGCACTTAAGTTTCCGG - Intronic
926308580 2:11658224-11658246 GTGCTAAGCACTTTAGTCTCAGG + Exonic
927816685 2:26223580-26223602 CAGTCAAGGACTTGGGTCTCTGG + Intronic
932213193 2:69948662-69948684 GAGTGGAGCCCTTTGGTCTCAGG + Intergenic
932491899 2:72127804-72127826 GAGGGATGGAATTTACTCTCTGG + Intergenic
940273786 2:151918413-151918435 GAGGGAAGGAAATGAGTCTCCGG - Intronic
945682942 2:212935510-212935532 GAGTTAAGAGCTGTAGTCTCAGG + Intergenic
1171085983 20:22238929-22238951 AATTCAAGGACTGTAGTCTCTGG + Intergenic
1172328941 20:34060628-34060650 GAGTGAAGGCATTTGGTTTCAGG + Intronic
1172921808 20:38489775-38489797 GAGTAAAGGTCTTCAGTCTGAGG + Intronic
1176345211 21:5737514-5737536 GAGTGAACGACTTAGATCTCAGG - Intergenic
1176352025 21:5858098-5858120 GAGTGAACGACTTAGATCTCAGG - Intergenic
1176499616 21:7586941-7586963 GAGTGAACGACTTAGATCTCAGG + Intergenic
1176539532 21:8135584-8135606 GAGTGAACGACTTAGATCTCAGG - Intergenic
1176558483 21:8318629-8318651 GAGTGAACGACTTAGATCTCAGG - Intergenic
1203244483 22_KI270733v1_random:51939-51961 GAGTGAACGACTTAGATCTCAGG - Intergenic
960305440 3:116054568-116054590 GAGTGAAGCCCTTTTCTCTCGGG - Intronic
961826512 3:129601962-129601984 GAGTGAAGGAATCTATTCCCGGG + Intronic
965483648 3:169251158-169251180 GAGTGAAGGAGTCTACTCTGGGG + Intronic
971482049 4:27123758-27123780 GAGTGAAGGATTTAAGTCACGGG - Intergenic
974903401 4:68029492-68029514 CACTGCAGGACTTTAATCTCAGG + Intergenic
976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG + Intronic
978905923 4:114005372-114005394 GAATGAGGGGCTTTAGACTCAGG + Intergenic
979846772 4:125523211-125523233 GAGTGAGTGCCTTTAGGCTCCGG - Intergenic
980226427 4:129993023-129993045 TAGTGAAGGAGTTTAGTTTATGG + Intergenic
981221403 4:142241075-142241097 GTGTGAATGACTTTCATCTCTGG + Intronic
986373472 5:7105612-7105634 GAGTGCAGGACTTGAGTGGCTGG - Intergenic
988527463 5:31999568-31999590 GAGTGAGAGACTTTACCCTCTGG + Intronic
990103312 5:52220842-52220864 CAGATAAGGACTTTTGTCTCTGG - Intergenic
990661997 5:58026291-58026313 GAGTGAAGGAATGTAGTCAAGGG + Intergenic
991155681 5:63432060-63432082 GAGCTAAGGACTCTACTCTCTGG - Intergenic
994398408 5:99248179-99248201 CACTGAAGGGCTTTAATCTCAGG - Intergenic
996487062 5:124048889-124048911 GAGTGTAGGCCTGTAGTCTTTGG + Intergenic
1004887603 6:20066762-20066784 GAGTAAAGGAAGTCAGTCTCAGG + Intergenic
1006242876 6:32701312-32701334 GAAAGGAAGACTTTAGTCTCTGG - Intergenic
1018719328 6:166560950-166560972 GAGTGAATGGGATTAGTCTCAGG - Intronic
1020126237 7:5533910-5533932 GTGGGAAGGACTCTAGCCTCAGG + Intronic
1020201617 7:6084447-6084469 GAGTGATGTCCTTTAGTGTCCGG - Intergenic
1020492023 7:8798504-8798526 GATTGCAGAACTTTAGTCTGTGG + Intergenic
1028113413 7:86970061-86970083 GAGTGAGTGAATGTAGTCTCCGG + Intronic
1029615992 7:101657611-101657633 GAAAGAAGGTCTTTATTCTCAGG + Intergenic
1030653376 7:112139833-112139855 CAGTGAAGGCCTGTAGTCTGTGG - Intronic
1031101161 7:117481228-117481250 GAGAGAAGGACTTTACTCTTTGG + Intronic
1032084328 7:128876084-128876106 GAGTGAAGGGCTTTGTGCTCAGG - Intronic
1037824648 8:22154146-22154168 GAGTCAAGGACTTGAGTCCTCGG + Exonic
1038221012 8:25607870-25607892 CAGTGAAGGAATTGTGTCTCAGG - Intergenic
1040642563 8:49355775-49355797 GAGTGTCAGAATTTAGTCTCTGG - Intergenic
1042694698 8:71544020-71544042 GACTGCAGGACTGCAGTCTCAGG + Intronic
1048027350 8:130598886-130598908 GAGTTAATGACTTTGTTCTCTGG + Intergenic
1050611283 9:7356376-7356398 GAATGGAGGACATTTGTCTCAGG + Intergenic
1056455332 9:86754173-86754195 GAGGGAAGGAATTTTGTCTTTGG + Intergenic
1059331429 9:113538101-113538123 GAGGGAAGGACTATTGTCCCAGG - Intronic
1059747559 9:117217820-117217842 GAATGAATGACTTGAGTTTCTGG + Intronic
1061518976 9:131106279-131106301 GAGTGGAGGAGTTGAGACTCAGG - Intronic
1062055850 9:134469464-134469486 GAGTGAGAGACTTTAGACTGAGG + Intergenic
1062255606 9:135619340-135619362 GAGTGGAGCACTGTAGTCCCAGG + Intergenic
1203460816 Un_GL000220v1:35024-35046 GAGTGAACGACTTAGATCTCAGG - Intergenic
1187511733 X:19925731-19925753 GAGTGAAGGCCTGGAGACTCTGG - Intronic
1189029608 X:37437151-37437173 TAGTGGTGAACTTTAGTCTCTGG + Intronic
1190036193 X:47026907-47026929 GAGTAAAGGAATATAGTGTCTGG - Intronic
1196744457 X:119057243-119057265 TACTGAAGGACTCCAGTCTCTGG - Intergenic
1197155432 X:123265041-123265063 GAGTGCAGGAATTTTGTGTCAGG + Intronic
1199136772 X:144262751-144262773 GAGCTAAAGATTTTAGTCTCAGG + Intergenic
1199157143 X:144563634-144563656 GACTTTAGGACTTTAGTCACTGG - Intergenic