ID: 976624823

View in Genome Browser
Species Human (GRCh38)
Location 4:87168258-87168280
Sequence GGCCTTCAGGTCCTTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976624815_976624823 21 Left 976624815 4:87168214-87168236 CCAGTCTCTGCCAAGTACACTTA 0: 1
1: 0
2: 0
3: 11
4: 207
Right 976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 236
976624816_976624823 11 Left 976624816 4:87168224-87168246 CCAAGTACACTTATACTCCCTTG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 236
976624820_976624823 -6 Left 976624820 4:87168241-87168263 CCCTTGATCTTTCAAGGGGCCTT 0: 1
1: 0
2: 0
3: 16
4: 131
Right 976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 236
976624821_976624823 -7 Left 976624821 4:87168242-87168264 CCTTGATCTTTCAAGGGGCCTTC 0: 1
1: 0
2: 2
3: 8
4: 116
Right 976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976624823 Original CRISPR GGCCTTCAGGTCCTTCCTTG AGG Intronic
900457395 1:2783869-2783891 GAGCTTCAGGGCCTACCTTGGGG + Intronic
900829834 1:4958125-4958147 GGCCCCCAGGAACTTCCTTGTGG + Intergenic
901059396 1:6465206-6465228 GGCCTTCAGGTAGTGCCCTGTGG + Exonic
903024430 1:20417433-20417455 CCCCCTCAGTTCCTTCCTTGAGG - Intergenic
903274275 1:22210814-22210836 GGCTTACAGGTCCCTCCTTCTGG - Intergenic
903754615 1:25652191-25652213 GGCCTTCAGGGCCTGACATGCGG - Intronic
908621576 1:65987080-65987102 GGCCTTGAGGTCCCTACATGAGG - Intronic
909655458 1:78026831-78026853 GGCTTTCAGCTCCATCCATGTGG + Intronic
909655553 1:78027996-78028018 GGCTTTCAGCTCCATCCATGTGG + Intronic
909674802 1:78227131-78227153 GGCCTTCAGAGCCTTTCCTGTGG + Intergenic
910193107 1:84614261-84614283 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
912572530 1:110634972-110634994 TGCCTTCTGGTCCTTCCCCGGGG - Intergenic
913063248 1:115226757-115226779 GGCTCACAGGCCCTTCCTTGGGG + Intergenic
913963801 1:143358408-143358430 GGCCTGAAGGTGCTTCCTTTTGG - Intergenic
914854906 1:151343762-151343784 GTCCTTCAGTTCCATCGTTGAGG - Exonic
914859450 1:151374052-151374074 AGCCTTCAGGGCCTTCCCCGTGG - Intergenic
915348824 1:155212177-155212199 GGCCTTCATGTCTCTCCTGGAGG + Exonic
915352016 1:155232803-155232825 GGCCTTCATGTCTCTCCTGGAGG + Intergenic
915651133 1:157311677-157311699 GGCCTGCAGCTCCAGCCTTGGGG - Intergenic
915660287 1:157399881-157399903 GGCCTGCAGCTCCAGCCTTGGGG + Intergenic
915906815 1:159884728-159884750 ACCCTTGAGGTCCTTCCTGGGGG - Intronic
918235732 1:182578927-182578949 GGCCTCCAGTTCCGTCCATGTGG - Intronic
919256829 1:195137041-195137063 GGCCTGAAGGTCCTTTCCTGAGG - Intergenic
919277412 1:195439253-195439275 GGCCTGCAGCTCCTTTCTTTTGG - Intergenic
922024174 1:221735308-221735330 GGGCTCCAGGTGCCTCCTTGGGG - Intronic
922334340 1:224606647-224606669 GGGCTACAGGTCCTGGCTTGAGG + Intronic
922987303 1:229875647-229875669 GGACTTTAGATCCTTACTTGGGG + Intergenic
923012428 1:230099069-230099091 GACTTTCAAGTTCTTCCTTGAGG + Intronic
923553100 1:234979703-234979725 GGCCTTCACGGCCTTCACTGGGG - Intergenic
1063286630 10:4695607-4695629 GGCCTTCAGAGCCCTTCTTGGGG - Intergenic
1063378196 10:5566631-5566653 GGCCTTCAGATGCTCCCATGTGG + Intergenic
1063643887 10:7859355-7859377 TGCCTTCAGATCCTGCCATGTGG + Intronic
1064923451 10:20543565-20543587 TGCCTGCAGGTTCTTCATTGGGG - Intergenic
1065632221 10:27691844-27691866 GGCCTTCAGCTGCATCCATGTGG + Intronic
1068156571 10:53206439-53206461 GGCCTGTAGCTCCTTCCTTTTGG + Intergenic
1068328874 10:55534914-55534936 GGCCTCCAGCTCCATCCATGTGG - Intronic
1072877025 10:99183453-99183475 GGCCTGAAGATCCTTTCTTGAGG - Intronic
1073002624 10:100296894-100296916 GGGCTCCAGGTTCTTCCTTTTGG - Intronic
1074110169 10:110417343-110417365 TGCATTCAGGTCCTCCCTTAGGG - Intergenic
1074225825 10:111483478-111483500 GGGCATCAGGCCCTTCCTTGGGG - Intergenic
1074532731 10:114308066-114308088 GGCCTGCAGGTCCTGGTTTGAGG - Intronic
1075852519 10:125600762-125600784 GGCTTTCAGGTCATTCCGTGGGG - Intronic
1075989863 10:126826339-126826361 GTCTTTCAGGTCCTTACTGGGGG - Intergenic
1076425849 10:130367129-130367151 GGCCATGAGGTCTTCCCTTGTGG + Intergenic
1076528591 10:131128842-131128864 GGCTTTGAGTTCCTTCCATGAGG - Intronic
1076597939 10:131637485-131637507 GACCTCCAGCTCCTTCCGTGTGG - Intergenic
1076684670 10:132192713-132192735 GGCCTGATGGTCCTTCCTGGTGG + Exonic
1076756987 10:132577662-132577684 GGCCCTCCTGTCCTTCCTTTGGG - Intronic
1078445236 11:11399340-11399362 GGCTTTCAGGGCCTTACTTTGGG - Intronic
1080850340 11:36063077-36063099 GGCCTGAAAGTCCTTCCCTGAGG + Intronic
1083827670 11:65212399-65212421 CGCCTTCAGGTCCCTCTGTGGGG + Intergenic
1084929182 11:72540500-72540522 GCCCTTAAGGTCTTTCCCTGAGG - Intergenic
1086288042 11:85271737-85271759 GGCCTTCAGCCCCTTTCTTTGGG + Intronic
1087008858 11:93494900-93494922 ATCATGCAGGTCCTTCCTTGGGG - Intronic
1087301283 11:96439351-96439373 GGCCTACAGGCCCTTTCTTTTGG - Intronic
1088188871 11:107205178-107205200 GGCCTGTAGGTCCTTTCTTTTGG - Intergenic
1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG + Exonic
1088986347 11:114912501-114912523 GGCCTCCAGTTCCATCCATGTGG - Intergenic
1090362974 11:126186267-126186289 GGACCTCAGGTCCTTCTGTGTGG - Intergenic
1090451521 11:126810576-126810598 GGCCTTATTGTCTTTCCTTGCGG - Intronic
1091349331 11:134880508-134880530 GGCCTCCATGTCCTGCCTTTAGG - Intergenic
1091603822 12:1934091-1934113 TCCTTTCAGGTCCTTCCTTCTGG - Intergenic
1096548432 12:52356741-52356763 GGCCTGCAGGTCCTCCCTGCAGG - Intergenic
1097763567 12:63497211-63497233 GGCCTCCAGCTCCATCCATGTGG - Intergenic
1100233212 12:92631312-92631334 GACCTTGAGGTCCATTCTTGAGG + Intergenic
1101863010 12:108498266-108498288 AGGTTTCAGCTCCTTCCTTGGGG - Intergenic
1103527074 12:121576275-121576297 GGCCTTCAGATCCTCCCAGGTGG - Intronic
1103964942 12:124632699-124632721 AGCCATTAGGTCCTTACTTGAGG + Intergenic
1104680798 12:130750207-130750229 GGCCTTCCTCTCCTTCCTTTTGG - Intergenic
1107317390 13:39148132-39148154 GGCCTCCAGCTCCATCCATGTGG - Intergenic
1108846632 13:54686194-54686216 GGCCTGAAGGTCTTTCCCTGAGG - Intergenic
1108855641 13:54789564-54789586 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
1108871767 13:54996216-54996238 GGCCTAAAGATCCTTCCCTGAGG - Intergenic
1111295103 13:86267783-86267805 GGCCTGGGGGTCCTTCCCTGAGG + Intergenic
1113212736 13:108001979-108002001 GGCCTTTAGGCCCTTCATTGTGG + Intergenic
1113281558 13:108794028-108794050 GGCCTTCAGCTGCATCCATGTGG - Intronic
1114680951 14:24483003-24483025 CTCCTTCATCTCCTTCCTTGGGG - Intergenic
1116818427 14:49604399-49604421 GGCCTCCAGGTTCTAACTTGTGG - Intronic
1117759239 14:59009539-59009561 GGCCTTCTGTTCCTTTCTTCAGG + Intergenic
1118325451 14:64777490-64777512 GCCCTTCATGTACTACCTTGTGG + Intronic
1118361635 14:65062125-65062147 GGCCTGCAGGCACTGCCTTGAGG - Exonic
1119619971 14:76124682-76124704 GGGCTGCAGGGGCTTCCTTGGGG + Intergenic
1123989009 15:25669392-25669414 GGAATTCAGGTCCTTCCCTTAGG - Intergenic
1124062244 15:26305253-26305275 GGCCTGAAGGTCCTTTCCTGAGG - Intergenic
1124617896 15:31255841-31255863 CTCCCTCAGGTCCTTCCTTCTGG - Intergenic
1125041678 15:35195208-35195230 GACCTTCAGTTCCATCCATGTGG + Intergenic
1125966557 15:43879973-43879995 GGCCTGCAGCTCTTTCCCTGAGG + Intronic
1126513111 15:49502488-49502510 GGCCTTCAGTTCTTTTCTTTTGG + Intronic
1127043538 15:55002648-55002670 GGCCTTTAGCTCCTTCATTTTGG - Intergenic
1127193217 15:56554946-56554968 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
1129048758 15:72760514-72760536 TGCCTCCAGGTTCTTCTTTGCGG - Exonic
1129226113 15:74171381-74171403 GGCCTTATTGTCCTTCCTGGTGG + Intergenic
1132460763 16:53460-53482 GGCCTTCGGGTCCCACCTTGCGG + Exonic
1133639937 16:7707092-7707114 TCCCTTCAGGTCCTTGTTTGAGG + Intronic
1135123647 16:19787959-19787981 GGCCTGGGGGTCCTTCCCTGAGG - Intronic
1135394847 16:22123328-22123350 GGCATTGAGGTCCCTGCTTGGGG - Intronic
1135856365 16:26014634-26014656 GGCCTTCAGCTCCATCCATGTGG + Intronic
1136366348 16:29810940-29810962 GGCCTAGAGGTGCTTCCTGGGGG + Exonic
1137652945 16:50136030-50136052 TACCTTCAGGTCCTGCCTGGGGG - Intergenic
1137876764 16:52004447-52004469 GGCCTCCAGGCTCTTCCTTTGGG + Intergenic
1137904464 16:52306254-52306276 GGCCTGAAGGTCCTTTCCTGAGG - Intergenic
1138126676 16:54444590-54444612 GGCCCTGATGTCCTTCCTTTGGG + Intergenic
1138742942 16:59331853-59331875 GGCCTAAAGGTCCTTTCCTGAGG - Intergenic
1138981052 16:62268948-62268970 GGCCTCCAGCTCCATCCATGTGG - Intergenic
1141432520 16:83977774-83977796 AAACTTCAGGTCCTTCCCTGAGG - Intronic
1141678773 16:85531737-85531759 GGCCATCCGGTCCATCCTGGGGG - Intergenic
1142840016 17:2621365-2621387 GGCCTCCAGTTCCATCCATGTGG + Intronic
1142866089 17:2792459-2792481 TGCCTTCCTCTCCTTCCTTGGGG - Intronic
1144197779 17:12911906-12911928 GATCTTTAGGTCCTTCCTTTTGG - Intronic
1144886520 17:18466823-18466845 GGCCTTCTGGGCCTCCCTTTTGG - Intergenic
1145145688 17:20477485-20477507 GGCCTTCTGGGCCTCCCTTTTGG + Intergenic
1145763665 17:27443258-27443280 GGCCTTCAGGGCCTCCCTTTTGG - Intergenic
1146126016 17:30232356-30232378 GTTCTTCAGGTCATTCTTTGAGG - Intronic
1146295502 17:31646888-31646910 GGCCTAAAGGTCCTTTCCTGAGG + Intergenic
1147057021 17:37842828-37842850 GTCCTCCAGGTCCATCCATGTGG + Intergenic
1149902442 17:60492633-60492655 GGCCTTTAGCTCCTTCATTTTGG + Intronic
1150264851 17:63825612-63825634 GGTCTTCAGCTCCTTCCTCAGGG + Exonic
1151313229 17:73307070-73307092 TGCCTTCAGCTCCATCTTTGGGG + Intronic
1151668005 17:75556583-75556605 GGGCGTCAGGTCCTTCCCTCTGG - Intronic
1151737492 17:75953536-75953558 GTTTGTCAGGTCCTTCCTTGTGG - Exonic
1152220052 17:79058804-79058826 GGCCTTCAGGTCTCTTCTGGAGG - Intergenic
1153643519 18:7175089-7175111 GGCCTTCTGGACCCTCCATGTGG + Intergenic
1154148195 18:11884111-11884133 GGCCACCAGGCCCTTCCTGGGGG + Exonic
1157509865 18:48263177-48263199 GGCTTTCAGGTCTCTCCTTCTGG + Intronic
1158189613 18:54811732-54811754 GGCCTTCAGGAATTTCCTTGTGG + Intronic
1160942616 19:1627461-1627483 GGCCCTCAGGATGTTCCTTGGGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165336127 19:35170654-35170676 GGCCTGCAGGGCCTTCTTGGTGG - Intergenic
1165534490 19:36431870-36431892 CCCCTTCAGGTCTTCCCTTGTGG - Intergenic
1166979762 19:46625445-46625467 GCTCTTCAGGTCCCTCCTAGAGG - Intergenic
1167252099 19:48404862-48404884 GGCCTTCCTGTCCTACATTGAGG + Exonic
1168642850 19:58041306-58041328 GGCCAGCAGGTCCCTCCTAGAGG + Intronic
925844752 2:8025059-8025081 GCCTTTCAGGTACTTCATTGAGG + Intergenic
925903102 2:8522664-8522686 GGCCTTGAGCTTCTTCCTCGGGG + Intergenic
927000433 2:18789196-18789218 GGCCTTCCGCTCCTTTTTTGTGG + Intergenic
927484454 2:23479063-23479085 TGCCTGCAGGTCCCTCCTTGAGG - Intronic
929075211 2:38075013-38075035 GGCCTTCGCCTCCTTCCGTGTGG - Exonic
929397100 2:41535586-41535608 GGCCTGAAGGTCCTTTCTTGAGG - Intergenic
930755653 2:54969338-54969360 GGCCTTCTGATACTTCCTGGTGG + Intronic
931646730 2:64429472-64429494 TGCCTTCAGGGTCTTCCCTGAGG + Intergenic
931964510 2:67518438-67518460 GGCCTAAAGGTCCTTTCCTGAGG + Intergenic
932452509 2:71822302-71822324 GTCGTTCAGGTCCATCCATGTGG + Intergenic
935881583 2:107571006-107571028 AGCCTTCTGCTCCTTCCTGGAGG + Intergenic
936061945 2:109300605-109300627 GGACTTCAGGTTCTTCCTGGTGG + Intronic
936874540 2:117172537-117172559 GGCCTGCAGTTCCTTTCTTTTGG + Intergenic
936934573 2:117826804-117826826 GGCCTACAGTCTCTTCCTTGCGG + Intronic
945036664 2:205709388-205709410 GGCTCTCAGGTGCTTCCTTAAGG + Intronic
945263142 2:207863326-207863348 GGCCTGCAGGCACTGCCTTGAGG - Intronic
945739381 2:213642039-213642061 GGATTACAGGTCCCTCCTTGAGG + Intronic
948491053 2:238313701-238313723 GGCCCTCAGGCCCTTCCAGGAGG - Intergenic
948902044 2:240960971-240960993 GGCCTGCACTCCCTTCCTTGAGG - Intronic
1171402026 20:24879928-24879950 GGCCTCCAGGGCTTTTCTTGGGG - Intergenic
1173707763 20:45124918-45124940 GCCATTCAGATTCTTCCTTGGGG - Intergenic
1175929830 20:62488545-62488567 GGCCTCTAGGTTCTTCCTTATGG - Intergenic
1176663498 21:9662384-9662406 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
1181137529 22:20779077-20779099 GGCCCACAGATCCTTCATTGAGG + Intronic
1182393092 22:30015755-30015777 GGTCTCCAGGGCCTTCCTAGAGG + Intronic
949645148 3:6084857-6084879 GGCCCACAACTCCTTCCTTGAGG + Intergenic
950245434 3:11412283-11412305 GGCCTGAAGGTCCTTTCCTGAGG + Intronic
950401642 3:12773602-12773624 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
952941798 3:38451284-38451306 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
953320801 3:41969595-41969617 GGCCTCCAGTTCCATCCATGTGG + Intergenic
955732736 3:62004411-62004433 GGCCTGAAGGTCCTTTCCTGAGG - Intronic
955774024 3:62414812-62414834 GGCCTTCCCGTCCTCCCTGGAGG - Intronic
956619511 3:71207042-71207064 GACCTTCAGAGGCTTCCTTGTGG - Intronic
957532295 3:81455860-81455882 GGCCTCCAGCTCCATCCATGTGG - Intergenic
958948466 3:100391299-100391321 TGCCTTCAAGACCTGCCTTGAGG - Intronic
959336377 3:105070419-105070441 GACCTCCAGTTCCTTCCATGTGG - Intergenic
959495441 3:107045613-107045635 AGCCTTCATCTCCTTCCTTTGGG + Intergenic
960148100 3:114224810-114224832 GGCCTACAGGTCACTCTTTGGGG + Intergenic
960420984 3:117444904-117444926 GGGCTTCAGGTCCAGGCTTGAGG + Intergenic
965492745 3:169360035-169360057 GCCCTTCAAGTTCTTCCTTGAGG + Intronic
967655636 3:192044545-192044567 GGCCTTCAGGTCTGACCTAGTGG + Intergenic
972887435 4:43509861-43509883 GGCCTTCAGCCCCTTCCTTTTGG - Intergenic
972963162 4:44478080-44478102 GGCCTCCAGCTCCATCCATGTGG + Intergenic
975374347 4:73626193-73626215 GTCCTCCAGGTACTTCCATGTGG + Intergenic
976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG + Intronic
979025203 4:115562844-115562866 AGAATTCAGTTCCTTCCTTGCGG - Intergenic
979158805 4:117431796-117431818 GGCCTTCAGTTCCAGCCTTGTGG + Intergenic
980213971 4:129827242-129827264 GGCTTTGAGGTCCATCCATGTGG - Intergenic
980979747 4:139644159-139644181 GGCCTCCAGTTCCATCCATGTGG + Intergenic
983308049 4:166019154-166019176 GGCCTCCAGCTCCATCCATGCGG - Intronic
983955990 4:173699102-173699124 GACCTCAAGGTCCTTCTTTGAGG + Intergenic
984458806 4:180007237-180007259 GGCCTCCAGCTCCATCCATGTGG - Intergenic
985132897 4:186757030-186757052 GGCACTCTGGGCCTTCCTTGAGG + Intergenic
985207126 4:187550564-187550586 GGCCTGAAGGTCATTTCTTGAGG + Intergenic
985411808 4:189693545-189693567 GGCCTGAAGGTCCTTTCCTGAGG - Intergenic
987684706 5:21182231-21182253 TCCCTTCCGGTCCTTCCATGTGG - Intergenic
987817940 5:22928406-22928428 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
990342399 5:54836302-54836324 GGCCTTTAATTACTTCCTTGAGG + Intergenic
992944103 5:81792687-81792709 GGCTTTTAGCTCCTTCCTTTGGG - Intergenic
993198382 5:84780819-84780841 GGCCCTCAGCTCTTTCCTTTTGG - Intergenic
994914010 5:105948919-105948941 GGCCTGAAGGTCCTTTCTTGAGG + Intergenic
995599127 5:113776757-113776779 GGCGGTCAGGTGCTTCCATGTGG + Intergenic
995650718 5:114364085-114364107 AGCCATCATGTCCTTGCTTGAGG + Intronic
997039877 5:130240231-130240253 GGCCTCCAGCTCCATCCATGTGG + Intergenic
1000239158 5:159393168-159393190 GGCTTTCAGGCCCTTCCATGTGG - Intergenic
1000511715 5:162190775-162190797 GGCCTTCAGCTTCTTCAGTGAGG + Intergenic
1001232309 5:169999133-169999155 GTCCTTCAGGGCATTCCTTTAGG + Intronic
1001289522 5:170446847-170446869 GGCCCTCACGTCCCTCCCTGGGG + Intronic
1001850428 5:174959638-174959660 GTCCTCCAGGTTCATCCTTGTGG + Intergenic
1002382877 5:178842791-178842813 AGCGTTCAGGGCCTTCCCTGGGG - Intergenic
1003444212 6:6169944-6169966 GGCCCCCAGGTCCTGCCTTTTGG + Intronic
1004621168 6:17331667-17331689 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
1005978802 6:30820243-30820265 GGGCAACAAGTCCTTCCTTGGGG - Intergenic
1006781806 6:36637271-36637293 GGCCTTCAGCTGCTGCCTGGAGG - Intergenic
1007250664 6:40492737-40492759 GGCCTCCAGTGCCCTCCTTGGGG - Intronic
1010883012 6:81202336-81202358 GGCCTGTAGGTCCTTCATTTTGG + Intergenic
1012179805 6:96139189-96139211 GGCCTGCAGGCCCTTCATTTTGG - Intronic
1012396243 6:98800834-98800856 GACTGTCAGGTCCTACCTTGGGG - Intergenic
1013915933 6:115336786-115336808 GGCCTGTAGGTCCTTCGTTACGG + Intergenic
1014106561 6:117570877-117570899 GGCCTTCATGATCTTCCTTAAGG + Exonic
1014302509 6:119700073-119700095 GGCCTTCAGTTTCTTCCTTATGG + Intergenic
1015241619 6:131030253-131030275 GGGCTACAGGGCCCTCCTTGGGG + Intronic
1017115877 6:150975918-150975940 GGTCTTCTGGTCCTCACTTGTGG + Intronic
1017616590 6:156252718-156252740 GGCCTTCAGTTCCATCCATGTGG + Intergenic
1022131574 7:27409534-27409556 GGCCTAGAGGTCCTACCTTTGGG - Intergenic
1022205338 7:28158361-28158383 GGCCTTCCTGCCCTTCCTTCTGG + Intronic
1022466427 7:30655700-30655722 GGCCTTCACTGCCTTCCTGGGGG + Exonic
1022896662 7:34756860-34756882 TGCATTCAGGGCCTCCCTTGTGG + Intronic
1023206925 7:37761151-37761173 GTCCTTCAGGTTCATCCATGTGG + Intronic
1024761268 7:52598665-52598687 GGCCTGAAGCTCCTTTCTTGAGG + Intergenic
1024881196 7:54087378-54087400 GTCCTCCAGGTTCATCCTTGTGG + Intergenic
1026177387 7:68009845-68009867 GACCTTCAGCTGCTTCCTTTGGG - Intergenic
1027353561 7:77335457-77335479 TGCTTCCAGGTCATTCCTTGAGG - Intronic
1030362613 7:108610715-108610737 GGGCTTCTGGTCCTTCTTGGTGG + Intergenic
1032201299 7:129825083-129825105 GGCCTGCAGGGCGTTCCCTGCGG - Intergenic
1033418960 7:141189204-141189226 GGCCTTCAAGTCTTTCCCTCTGG - Intronic
1035773977 8:2173346-2173368 GCCCTTCAATGCCTTCCTTGAGG + Intergenic
1037726978 8:21490904-21490926 CTCCTTCAGGTCCTTCCTTAAGG + Intergenic
1039869895 8:41537199-41537221 GACCTTCAGGTCCTCCCTTTTGG - Exonic
1040026956 8:42790494-42790516 GGCCTGAAGGTCCATCCCTGAGG + Intronic
1040605449 8:48927191-48927213 GGGCTTGAGGTGCTTCCTGGGGG + Intergenic
1040659238 8:49549879-49549901 GGCCTGAAGGTCCTTTCCTGAGG + Intronic
1041380971 8:57254196-57254218 AGCTTCCAGCTCCTTCCTTGGGG + Intergenic
1042326118 8:67529689-67529711 GGCTTTCATGTCCTTGCTTTGGG - Intronic
1046129915 8:109954411-109954433 GACCTCCAGGTCTTTCCTGGGGG + Intergenic
1046640271 8:116721777-116721799 GGCCTTCAGCCCCTTCATTTTGG + Intronic
1047134588 8:122062045-122062067 TGCCTTGAGTTCCTGCCTTGAGG + Intergenic
1048031520 8:130637869-130637891 CGCCTTCAAGTGGTTCCTTGTGG + Intergenic
1048985972 8:139735135-139735157 GTCCTTCTGGTCCTACCTTCTGG - Intronic
1060211496 9:121713229-121713251 GGCCTTCAGCTCTTTCCTCTTGG + Intronic
1060620354 9:125059843-125059865 GGCTTTCAAGTATTTCCTTGTGG - Intronic
1061387041 9:130296484-130296506 GGGCTTCAGCTCCTTCATTTGGG + Intronic
1062171240 9:135136006-135136028 GGGCTTCAGGTCCCTCCTCCAGG + Intergenic
1203662600 Un_KI270753v1:59378-59400 GGCCTGAAGGTCCTTTCCTGAGG - Intergenic
1203670789 Un_KI270755v1:9436-9458 GGCCTGAAGGTCCTTTCCTGAGG + Intergenic
1189278582 X:39805058-39805080 TGCCTTCAGTTCCTCCCTTCAGG - Intergenic
1189296971 X:39925708-39925730 GGTCTGCAGGGCCTTCTTTGGGG - Intergenic
1194442982 X:93955430-93955452 GGCCTTCAGCCCCTTCATTTTGG + Intergenic
1197284548 X:124581015-124581037 GGCCTCCAGTTCCATCCGTGTGG + Intronic
1197608219 X:128609089-128609111 GGCCTGGGGGTCCTTTCTTGAGG + Intergenic
1197896860 X:131325219-131325241 GGCCTTCAGTTTCTTCTTTTTGG - Intronic
1198369735 X:135978852-135978874 GGCCTGAAGGTCCTTTCCTGAGG - Intergenic
1201458048 Y:14192781-14192803 TCCCTTCAGGACCTTCCATGAGG + Intergenic
1202003063 Y:20184273-20184295 GGCCTGCAGCTTCTTTCTTGAGG - Intergenic