ID: 976627884

View in Genome Browser
Species Human (GRCh38)
Location 4:87206590-87206612
Sequence CTGTAGAAATGGTGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976627873_976627884 25 Left 976627873 4:87206542-87206564 CCTTATGGATGGTTCTAACATCC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 286
976627877_976627884 -6 Left 976627877 4:87206573-87206595 CCCAAGGCCACACAGTTCTGTAG 0: 1
1: 0
2: 4
3: 55
4: 434
Right 976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 286
976627875_976627884 4 Left 976627875 4:87206563-87206585 CCCTGACTTGCCCAAGGCCACAC 0: 2
1: 1
2: 26
3: 92
4: 317
Right 976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 286
976627878_976627884 -7 Left 976627878 4:87206574-87206596 CCAAGGCCACACAGTTCTGTAGA 0: 1
1: 0
2: 3
3: 28
4: 279
Right 976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 286
976627876_976627884 3 Left 976627876 4:87206564-87206586 CCTGACTTGCCCAAGGCCACACA 0: 1
1: 4
2: 20
3: 83
4: 314
Right 976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976627884 Original CRISPR CTGTAGAAATGGTGGGAGAT GGG Intronic
900468608 1:2839011-2839033 ATTTAGAAATGGTGCGATATAGG + Intergenic
901403920 1:9033400-9033422 TTGTAGACATGGTGGGGGGTGGG + Intergenic
905034610 1:34909460-34909482 CTATTGAAATCCTGGGAGATAGG - Intronic
907131671 1:52102880-52102902 CAGGACTAATGGTGGGAGATGGG - Intergenic
907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG + Intronic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
910406407 1:86895925-86895947 CTAAAGAAATAGTGGGATATAGG + Intronic
910630990 1:89354166-89354188 CAGTAGAAATGTTTGGTGATAGG + Intergenic
911183451 1:94881352-94881374 CTGAGGAAATGGTGGGAGAGAGG - Intronic
911636421 1:100240611-100240633 CTGGAAAAATGTGGGGAGATGGG + Intronic
912261122 1:108112293-108112315 CCCTTGAAATGGTAGGAGATAGG + Intergenic
912859908 1:113204665-113204687 TTGTGGATATGGTGAGAGATAGG + Intergenic
913345080 1:117800838-117800860 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
913542257 1:119832802-119832824 ATGCAGAATTGTTGGGAGATGGG + Intergenic
913566570 1:120078609-120078631 GTGTAGAAATGGTGAGGGCTAGG - Intergenic
913631561 1:120714935-120714957 GTGTAGAAATGGTGAGGGCTAGG + Intergenic
914250449 1:145917943-145917965 CTGGAGAAATGGTGAGATATGGG - Intronic
914269170 1:146063875-146063897 ATGCAGAATTGCTGGGAGATGGG + Intergenic
914287328 1:146239321-146239343 GTGTAGAAATGGTGAGGGCTAGG - Intergenic
914367925 1:146996990-146997012 ATGCAGAATTGCTGGGAGATGGG - Intergenic
914485054 1:148101218-148101240 ATGCAGAATTGCTGGGAGATGGG + Intergenic
914548360 1:148690063-148690085 GTGTAGAAATGGTGAGGGCTAGG - Intergenic
914585017 1:149053202-149053224 ATGCAGAATTGCTGGGAGATGGG + Intergenic
914618321 1:149381645-149381667 GTGTAGAAATGGTGAGGGCTAGG + Intergenic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
915462686 1:156079692-156079714 GAGTAGAAATGGTAGGAGAGGGG - Intronic
915969030 1:160339475-160339497 CTGGAGAAATGGTGAGAGAAGGG - Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916247167 1:162700146-162700168 AAGAAGAAATGGTGAGAGATAGG - Intronic
916621927 1:166508020-166508042 CTGTAAAAGTGGTAGTAGATGGG + Intergenic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
921817859 1:219584368-219584390 TTTTATATATGGTGGGAGATAGG + Intergenic
923173201 1:231436353-231436375 TTTTATATATGGTGGGAGATAGG - Intergenic
924482670 1:244451459-244451481 GTGGAGAAATGGCGGGAGGTCGG - Intronic
924721825 1:246630290-246630312 CTAAAGAAATGGTTGAAGATTGG + Intronic
924815239 1:247435767-247435789 ATGTAGTATTGGTGGGAGCTTGG + Intronic
1063173135 10:3527769-3527791 TTGCAAAAATGGTGGGAGAAAGG - Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1065619516 10:27566174-27566196 ATGTGGAGGTGGTGGGAGATGGG - Intergenic
1065883000 10:30053203-30053225 GTGTATAAATGGTGGGGGGTGGG + Intronic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066338010 10:34500398-34500420 CTTTAAAAATGGTGGAAGATTGG - Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1072696234 10:97605071-97605093 CAGTACAAATGGTGGGTCATAGG + Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1076631288 10:131853576-131853598 CAGGAGAAATGGAGGGAGAGGGG - Intergenic
1079645597 11:22860702-22860724 GGGTAGAAAAGGTGGGAAATTGG - Intergenic
1079712591 11:23705119-23705141 GTGTGGCAATGTTGGGAGATGGG - Intergenic
1079985408 11:27195121-27195143 CTGGAGAAATGCTGGCAGACTGG - Intergenic
1081730438 11:45368425-45368447 CTGTAGAATGGGTGGGTGAATGG - Intergenic
1082795077 11:57372887-57372909 CAGTGGAAATGGTGGGAGTGGGG - Intergenic
1083245139 11:61421042-61421064 CTGTGATAATGGTGGGTGATGGG - Intronic
1086004922 11:82026812-82026834 CTGTAGAAAAGGTCGGAAAGAGG - Intergenic
1086064299 11:82730972-82730994 CTGTAGAACTGCGGGGAGAAAGG - Exonic
1086801921 11:91186233-91186255 CTTTAGAAATTTTGAGAGATGGG - Intergenic
1089134329 11:116237301-116237323 CTGTAGCCATGGTCTGAGATTGG - Intergenic
1089243300 11:117099176-117099198 CTGTAGAATTGTTCAGAGATGGG - Intergenic
1090617555 11:128529330-128529352 AAGTAGAAATGGGGGGACATGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091046373 11:132329428-132329450 CTGTAGAAATGCTGGGAGGCTGG - Intronic
1091639698 12:2226755-2226777 CTCGAGAACTGGAGGGAGATGGG - Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1091779932 12:3207435-3207457 CAGTAGAAGTGGTGGGGGGTTGG + Intronic
1093043768 12:14417432-14417454 CTGTAACAATAGTGGTAGATGGG + Intronic
1094024115 12:25944166-25944188 CTGCAGAAATGTAGTGAGATTGG + Intergenic
1094675604 12:32617111-32617133 ATGCAGAAGTGTTGGGAGATGGG - Intronic
1095696146 12:45146434-45146456 CTGTAGAAAGGGAGAGTGATAGG + Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099454642 12:82849009-82849031 ATGGAGAAGTGATGGGAGATTGG + Intronic
1099783217 12:87227307-87227329 CTTGAGAAATGTTGGGAGAGCGG + Intergenic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1100994729 12:100292464-100292486 CTGTACAATTGAAGGGAGATGGG - Intronic
1101353587 12:103956347-103956369 CTGGTAAAATGGTGGCAGATAGG + Intronic
1102439231 12:112948768-112948790 CTGTACAAAGGGCGGGAGCTGGG + Intronic
1104769063 12:131349231-131349253 ATGCAGAAATGGAGGGAGAAGGG + Intergenic
1105262685 13:18791563-18791585 GTTTAGAAATAGTGGGAGTTGGG - Intergenic
1106996624 13:35491602-35491624 CTGTAAAGTTGGTGAGAGATGGG - Intronic
1107260996 13:38491010-38491032 ATGTAAAAATGGTGGGAGGCTGG - Intergenic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1107930800 13:45305793-45305815 TTGTAGAGATGGTGGGAGTGGGG - Intergenic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1110983797 13:81938242-81938264 CTTTACATATGGTGGGTGATGGG + Intergenic
1111288358 13:86126660-86126682 CTGTAGACATGATGTGAGCTGGG + Intergenic
1111707986 13:91775327-91775349 CAGTAGAAATGGTGGTAAAATGG - Intronic
1112099414 13:96170555-96170577 GTTTAAAAATGGTGGGAGAGAGG + Intronic
1113054311 13:106251658-106251680 CTATAGAAGTGAGGGGAGATAGG + Intergenic
1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG + Exonic
1116225528 14:42146497-42146519 CTGTAAAAATTGTTGGATATTGG - Intergenic
1117157719 14:52957377-52957399 GAGTAGAAATGGTGGGTTATGGG - Intergenic
1117226674 14:53668204-53668226 TGTTGGAAATGGTGGGAGATTGG + Intergenic
1118889275 14:69894466-69894488 CTGTGGCAGCGGTGGGAGATAGG + Intronic
1119074091 14:71618455-71618477 CTATTTAAATGGTGGGAGATAGG + Intronic
1119781803 14:77280767-77280789 GTGTGAAAATGGTGGGAGAGAGG + Intronic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1120764094 14:88312515-88312537 CAGTAGAAATGCTGGGGAATGGG - Intronic
1122056305 14:99100678-99100700 ATGTAGAAAGGGTGACAGATTGG - Intergenic
1122794418 14:104198831-104198853 CTGTTGAGAGGGTGGGATATTGG + Intergenic
1123803667 15:23849934-23849956 ATATAGACATGGTGGCAGATAGG - Intergenic
1124990129 15:34664932-34664954 ATGTGGTAATGGTGGGAGGTGGG + Intergenic
1125051265 15:35300188-35300210 ATGAAAAAATGGTAGGAGATGGG + Intronic
1126619106 15:50618774-50618796 CTTTACAAAAGGTGGGAGGTTGG - Intronic
1128026566 15:64442344-64442366 CTTAAGAAATGGTGAGATATTGG + Intronic
1128534879 15:68482593-68482615 GTGTAGAAATGGTTCCAGATGGG - Intergenic
1128643003 15:69353692-69353714 GGGTAGAAATGGAGGGAGGTGGG + Intronic
1128963764 15:72036900-72036922 CTGTAGAGATGGTGGGGGAAGGG + Intronic
1129321593 15:74778004-74778026 CTGGGGAGATGGTGCGAGATGGG - Intergenic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1131239289 15:90724748-90724770 ATGTAGAGATGGTGGGAGGCTGG - Intronic
1131831716 15:96359024-96359046 CTTTAGAAATGGTGGCAGCAGGG + Intergenic
1132416527 15:101624147-101624169 CAGTATAAATGGTGGGAGTGAGG + Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135851753 16:25970112-25970134 CTGTATAAATGATTGGAGAAGGG - Intronic
1138034656 16:53592244-53592266 TTGTAGAAATTGTGAGACATTGG + Intergenic
1140390436 16:74582046-74582068 CAGTAGAGAGGGTGAGAGATTGG - Intronic
1140732748 16:77871332-77871354 CTGTAGAAATGCCGAGAGAGAGG + Intronic
1141057746 16:80834315-80834337 TTGTAACAATGGTGGGAGATGGG - Intergenic
1141061814 16:80880257-80880279 TTGTAGAGATGGTGGGGGCTGGG + Intergenic
1144444470 17:15314422-15314444 GTGTAGACAAGGTGGGAGTTAGG - Intronic
1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG + Intergenic
1147858045 17:43498059-43498081 CTCTAGAAATGGCTGGTGATGGG + Intronic
1148466184 17:47866565-47866587 ATGTAGAAATGTTTGGGGATTGG + Intergenic
1149206248 17:54252090-54252112 GTGGAGAAATGGGGGTAGATAGG + Intergenic
1149280097 17:55094115-55094137 CAGTACAAATGCTGTGAGATAGG + Intronic
1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG + Intronic
1152013326 17:77734408-77734430 CTGGGGAGGTGGTGGGAGATGGG - Intergenic
1152611744 17:81318247-81318269 CTTTAGCAAGGGAGGGAGATGGG - Intronic
1152972944 18:182869-182891 ATGTAGAAACGGTGATAGATGGG + Intronic
1153712494 18:7814158-7814180 CTATAGGGATTGTGGGAGATGGG + Intronic
1154213139 18:12396876-12396898 CTGTTGGAGTGGTGGGCGATTGG + Intergenic
1155727081 18:29100079-29100101 CTGCAGACAAGATGGGAGATGGG - Intergenic
1157289736 18:46400929-46400951 AGGTGGAAGTGGTGGGAGATGGG + Intronic
1157505473 18:48223161-48223183 CTGCAGAGGTAGTGGGAGATGGG + Intronic
1158303072 18:56074604-56074626 CTGTGAAAATTGTGAGAGATGGG + Intergenic
1158674659 18:59507291-59507313 TTGTAGAAATGGAGAGACATAGG - Intronic
1158767862 18:60477117-60477139 TTGTGTAAATGGTGAGAGATAGG + Intergenic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160893257 19:1390587-1390609 CTGTTGAAATGGTGGGACTTAGG + Intronic
1161692175 19:5742607-5742629 TTGTAGATATGGTGGGGGGTGGG - Intronic
1164389784 19:27808009-27808031 TTTTGGATATGGTGGGAGATAGG - Intergenic
1164477940 19:28589702-28589724 CTGTTGAAAGGGAGAGAGATGGG - Intergenic
1165149616 19:33753296-33753318 CTGAAGAAAAGATTGGAGATGGG - Intronic
1165817677 19:38652377-38652399 CTGAAGAAAAGGTGGGGTATGGG + Intronic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG + Exonic
927877808 2:26670490-26670512 CTCTAGAGAAGGTGGGAGAAGGG + Intergenic
928021533 2:27708693-27708715 CGGTAGAGATGGGGAGAGATGGG - Intronic
929152273 2:38758100-38758122 CTGTAGAGATGGTGGGGGTCAGG + Intronic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
932263269 2:70344670-70344692 ATGGAGAAATAGTGGGAGAGAGG + Intergenic
932320110 2:70815829-70815851 TTGTAGAGATGGTGTGAGGTGGG - Intronic
933804513 2:85988493-85988515 CTGGAGCACAGGTGGGAGATGGG - Intergenic
935029856 2:99311467-99311489 TTGTAGAGATGGTGGGGGAGGGG + Intronic
939475273 2:142678789-142678811 CAGTAGAAGTGCTGGGAGGTTGG + Intergenic
939789263 2:146551020-146551042 CTGAAACAAGGGTGGGAGATGGG - Intergenic
940394196 2:153168699-153168721 CTTTAAAAATCATGGGAGATAGG - Intergenic
943799597 2:192041789-192041811 CCGTAGAAAAGGAGAGAGATGGG + Intronic
944627208 2:201583336-201583358 CTGTAGATGTGATGGGAGAAGGG - Intronic
945816309 2:214608987-214609009 CTATGGAAATGATGGTAGATTGG - Intergenic
946906661 2:224423613-224423635 TTTTAAATATGGTGGGAGATAGG - Intergenic
947085645 2:226448907-226448929 CTGCAGAAATGATGAAAGATTGG - Intergenic
947143265 2:227039767-227039789 CTGTAGAGATGGTCAGAGACAGG + Intronic
947406451 2:229782296-229782318 CTGTAGAAGTGTTGGGAGAAGGG - Intronic
948046745 2:234951620-234951642 CCGGAGAAGGGGTGGGAGATGGG + Intergenic
948178556 2:235962358-235962380 CAGGAGAGATGGTGGGAGAAGGG + Intronic
1169278907 20:4250736-4250758 CTGCAGAAATGTTTAGAGATGGG + Intergenic
1169663057 20:8001495-8001517 CTGAAAAAATGCTGGGAGAGTGG + Exonic
1170851365 20:20007514-20007536 TTGTAGAAGTGGTGAGAAATCGG - Intergenic
1172956979 20:38767873-38767895 CTGTAGACATTGTGGGGCATGGG + Intronic
1173925233 20:46776368-46776390 CTGGAGAAATACTGAGAGATGGG + Intergenic
1174525015 20:51163658-51163680 TTGTAGAGATGGTGGGGGGTGGG - Intergenic
1176104463 20:63379400-63379422 CTGTGGAGCTGGTGGGAGCTGGG + Intergenic
1177661645 21:24091457-24091479 CAGGAGAAAGGGTGGGAGTTGGG + Intergenic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181745887 22:24954573-24954595 CTGTAGAAATGGTGTGGCCTAGG + Intronic
1182639022 22:31752088-31752110 CTTTAGCAATGGTGGTTGATGGG - Intergenic
1184022483 22:41830260-41830282 CAGTAGAAATGGTGGAAGAAGGG - Intergenic
1184439013 22:44497627-44497649 CTGTAGAAATGGGGGCAGTGTGG + Exonic
1185097916 22:48821811-48821833 CTGCAGATATGGTGGGATGTGGG + Intronic
949331611 3:2929908-2929930 CTGTAATTATGGTGGGAGTTTGG - Intronic
949698419 3:6726893-6726915 CTGTAGAAATAGTGGTTGACAGG + Intergenic
951630104 3:24710584-24710606 CTCTATAAATTGTGAGAGATAGG + Intergenic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955471193 3:59288080-59288102 GAGGAGAAATGGTAGGAGATGGG - Intergenic
955522450 3:59788161-59788183 CAGGAGAAATGATGGGAGAGGGG - Intronic
956724450 3:72145681-72145703 CTCTAGAAATCCTGGGAGCTTGG - Intergenic
956775960 3:72565727-72565749 GAGGTGAAATGGTGGGAGATGGG + Intergenic
958029921 3:88096277-88096299 CTCTAGAAATGGAGGGACAAAGG + Intronic
958639673 3:96789558-96789580 GTTTATAAATGGTGAGAGATAGG + Intergenic
960163089 3:114371690-114371712 CAGCATAAATGGTGGGAGAAAGG + Intronic
962150263 3:132885381-132885403 TTCTGTAAATGGTGGGAGATGGG - Intergenic
963827175 3:149969261-149969283 CAGAAAAAATGGAGGGAGATTGG + Intronic
964945253 3:162214738-162214760 CTGTTAAAATTGTGGGAGTTAGG - Intergenic
965557692 3:170035036-170035058 CTTAAGAAATGGTGGGAGAGTGG + Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970080440 4:12278220-12278242 CTGTAAAAATGGTTTGTGATGGG - Intergenic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
972371717 4:38430512-38430534 CTGAAGAAATGGTGCCAAATTGG + Intergenic
972392412 4:38626300-38626322 CTGGGGAAATAGTGGGAGAGAGG + Intergenic
972761821 4:42113782-42113804 CTGTAGAGTTAGTGGGTGATCGG - Exonic
973024601 4:45251509-45251531 ATCTAGAAATGGTGGGAGGCTGG + Intergenic
974109542 4:57510900-57510922 CTGCAGAGATGGTGGCAGAGAGG + Intergenic
974790195 4:66678634-66678656 CTTTTGTAATGGTGAGAGATAGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977072562 4:92409777-92409799 CTGCAGAAATTCTGGGAGAGAGG + Intronic
978827988 4:113047736-113047758 CTGAAGCAATGGTGAGAGAATGG + Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
981203321 4:142009619-142009641 TTTTATATATGGTGGGAGATAGG + Intergenic
983129088 4:163992546-163992568 GCGTAGAGATGGTGTGAGATTGG + Intronic
983404053 4:167302603-167302625 CTGTAAAAGTGGTGGGAGTGAGG - Intergenic
984624152 4:181986930-181986952 CTGGAGCAATGATGGGAGAATGG + Intergenic
985026401 4:185743623-185743645 ATGTAGAATTTGTGGGAGTTGGG - Intronic
985796659 5:1967095-1967117 CTGGAGTTATGCTGGGAGATGGG + Intergenic
985827481 5:2203719-2203741 CACTAGAAATGGAGGGAGAGAGG - Intergenic
986450990 5:7865196-7865218 CTTTAGAAATGGTAAGAGATCGG + Intronic
988598292 5:32615757-32615779 CGGTGGAAAAAGTGGGAGATTGG + Intergenic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
990073007 5:51808133-51808155 ATGTAGAAATTGAGAGAGATGGG + Intergenic
990889026 5:60628903-60628925 CTGCTGAAATGGTGGGAGAAAGG + Intronic
991428341 5:66515677-66515699 CTGAAGAAAGGGGGAGAGATGGG + Intergenic
992350906 5:75928348-75928370 CTGCAGAAATGTTGGGAGTTTGG + Intergenic
993029791 5:82692944-82692966 TTGTAGAAATGCTGGGAGACTGG + Intergenic
993679547 5:90859128-90859150 TTGTAGAGATGGTGGGAGTGAGG + Intronic
994431295 5:99664856-99664878 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
994760309 5:103843766-103843788 CTGAAGAAGTGGTGGGGGCTGGG + Intergenic
997285360 5:132674193-132674215 CTGGAGAGATGGTGCCAGATAGG - Intronic
997820717 5:137063290-137063312 CTGAAGAGATGGTGGAAGGTGGG - Intronic
998566782 5:143223002-143223024 CTTTAGAGATGGTGAGAGATTGG - Exonic
1000600627 5:163270561-163270583 CTGTACAAATTGTGGCATATAGG + Intergenic
1001499875 5:172222615-172222637 CTGTAGAAATGGTGTGTTCTGGG + Intronic
1001722224 5:173866402-173866424 CTGTAGAAATGGTTGGAAGGCGG + Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG + Intergenic
1006224426 6:32524621-32524643 CTTTAGAAATGATGGCAGAGAGG + Intronic
1006275667 6:33003662-33003684 GTGAGGATATGGTGGGAGATGGG + Intergenic
1007139086 6:39553893-39553915 CTACAGAAGTGGTGGGAGCTTGG - Intronic
1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG + Intergenic
1007755231 6:44095157-44095179 GAGTAGAACTGGCGGGAGATGGG + Intergenic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1010917433 6:81637650-81637672 GTGTACACATGGTGGGAGGTAGG - Intronic
1011214330 6:84988796-84988818 CTTTAGAAATGTTGGAATATTGG - Intergenic
1011232182 6:85174637-85174659 TTGTATATATGGTGAGAGATAGG + Intergenic
1011383061 6:86763526-86763548 CTGTAGGAATGGTGTGGGACAGG + Intergenic
1011817143 6:91205684-91205706 CAGGAGAAAGGGTGGGAGGTGGG - Intergenic
1012035933 6:94139419-94139441 CTATAGAAGTGGTGGGGAATTGG - Intergenic
1012900535 6:105000110-105000132 CTGCAAAAATGGTGGGGGAGGGG + Intronic
1013904068 6:115194261-115194283 AAGTAGAATGGGTGGGAGATAGG + Intergenic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG + Intronic
1015536948 6:134276180-134276202 CTGAAGAAATGGTTGCTGATTGG + Intronic
1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG + Intergenic
1016842039 6:148534304-148534326 CTGGAGTGATGGTGGGAGAGAGG - Intronic
1018846437 6:167560087-167560109 CTGCAGAGATGCTGGGAGAAGGG - Intergenic
1019622452 7:1999255-1999277 CTGTAGAAATACTGGGGGGTGGG - Intronic
1020851637 7:13360868-13360890 TTGTATAAATGGTGTGAGGTAGG + Intergenic
1021172876 7:17417340-17417362 CTGTAGAAAGGGTTGGGGTTTGG - Intergenic
1022316867 7:29253580-29253602 CTCTGGAATAGGTGGGAGATTGG + Intronic
1024280944 7:47719271-47719293 GCGTAGAAGTGGTGAGAGATTGG + Intronic
1025822281 7:64977932-64977954 GTGTAGAAAGGGTTGAAGATTGG + Exonic
1026312216 7:69196373-69196395 CTGTAGCATTGTTGGGAGTTTGG - Intergenic
1026374046 7:69732280-69732302 CTGTTGTAAAGGTGGGGGATGGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1029914019 7:104188136-104188158 ATGTAGAAATGGTATGAGATAGG - Intronic
1031026195 7:116682806-116682828 CTTAAGAAATGGTGAGAGTTTGG - Intronic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033003073 7:137528891-137528913 CCCTAAAAATGGTGGTAGATGGG - Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1033966891 7:146986148-146986170 ATGGAGAAAGGGTGGGAGAGGGG - Intronic
1034051483 7:147988786-147988808 CTCTTCAAATGGTGAGAGATTGG - Intronic
1035713491 8:1736719-1736741 CGGGAGAAAGGGAGGGAGATGGG + Intergenic
1036742976 8:11382136-11382158 GTGTAGAATTGCTGGGACATAGG + Intergenic
1037541557 8:19876735-19876757 CTTTGGAAATGGAGGGAGACAGG - Intergenic
1038006327 8:23433470-23433492 CTGTAAAAATGGTGAGTCATGGG - Intronic
1040416467 8:47200391-47200413 CAGTTGAGAGGGTGGGAGATGGG - Intergenic
1040887493 8:52281887-52281909 TCGGGGAAATGGTGGGAGATGGG + Intronic
1042200590 8:66276579-66276601 CTGTAGACATGGGAGGAGACAGG - Intergenic
1043785550 8:84394101-84394123 CTGTAGAAACAGTGGAAGACTGG - Intronic
1044755974 8:95461595-95461617 CTGTAGAAAGGCTGGAAGAGAGG + Intergenic
1046860892 8:119090236-119090258 CTGGAGAAATGGTGGGGTACGGG + Intronic
1047060255 8:121217529-121217551 ATGTAGAAATGGTGGGGGTGGGG - Intergenic
1048719983 8:137312483-137312505 CTCCAGAAATCCTGGGAGATAGG + Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1052120221 9:24705612-24705634 CTGGAGAATTGGGGGGAAATGGG + Intergenic
1053491156 9:38504424-38504446 CTGAAGAAATGATGGGATTTAGG - Intergenic
1056548439 9:87632378-87632400 ATGTAGAAATGAAGGAAGATGGG + Intronic
1056555658 9:87685163-87685185 CTGTAGGAAAGTTGGCAGATAGG - Intronic
1057202472 9:93149652-93149674 CTGTAGCAATTGTGGAAGTTTGG - Intergenic
1057671469 9:97093623-97093645 CTGAAGAAATGATGGGATTTAGG - Intergenic
1058533631 9:105932077-105932099 CTGGAGAAATGGGGGCAGCTAGG + Intergenic
1059781686 9:117535433-117535455 CTGTTGAAATGTTGGAAGATAGG - Intergenic
1060826264 9:126689712-126689734 CTGCAGAGATGATGGGAGATGGG + Intronic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1186591376 X:10933525-10933547 CTGGAGAAAAATTGGGAGATAGG - Intergenic
1188515958 X:30986200-30986222 TTATATAAATGGTGGGAGTTGGG + Intergenic
1190472439 X:50796428-50796450 GAGTGGAAATGGTGGGAGGTGGG + Intronic
1192495610 X:71615045-71615067 CTGCAGAAACGGCCGGAGATGGG - Intergenic
1194616467 X:96110060-96110082 CTCTAGAAATGGTGTGTGGTTGG - Intergenic
1195416830 X:104629699-104629721 CTTTATATATGGTGAGAGATAGG + Intronic
1195617692 X:106926089-106926111 AGGTAGAACTGGTGGGACATAGG + Intronic
1199876751 X:151937256-151937278 ATGTAAAAATGTTGGGATATGGG - Intergenic