ID: 976628042

View in Genome Browser
Species Human (GRCh38)
Location 4:87207825-87207847
Sequence ATTTGGCAGGTTTTTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 8, 1: 13, 2: 10, 3: 61, 4: 442}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976628042_976628051 29 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43
976628042_976628045 -5 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628045 4:87207843-87207865 CAAATATGATGACATCAAGAAGG 0: 10
1: 19
2: 14
3: 28
4: 245
976628042_976628049 17 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628049 4:87207865-87207887 GTGGTGAAGCAGACATCGGAGGG 0: 1
1: 2
2: 10
3: 19
4: 117
976628042_976628050 28 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628050 4:87207876-87207898 GACATCGGAGGGCCCCCTCAAGG 0: 1
1: 2
2: 5
3: 10
4: 55
976628042_976628048 16 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628048 4:87207864-87207886 GGTGGTGAAGCAGACATCGGAGG 0: 1
1: 3
2: 9
3: 19
4: 146
976628042_976628046 -2 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628046 4:87207846-87207868 ATATGATGACATCAAGAAGGTGG 0: 11
1: 17
2: 11
3: 30
4: 305
976628042_976628047 13 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628047 4:87207861-87207883 GAAGGTGGTGAAGCAGACATCGG 0: 1
1: 2
2: 10
3: 33
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976628042 Original CRISPR ATTTGGCAGGTTTTTCCAGA TGG (reversed) Intronic
902108610 1:14059112-14059134 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
902121842 1:14172952-14172974 ATATGGCAGCTTCTCCCAGAAGG + Intergenic
902149556 1:14431993-14432015 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
902568298 1:17330331-17330353 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
903566704 1:24272872-24272894 ATTTGGTATGTTTTTGCAGTGGG + Intergenic
904017432 1:27433170-27433192 ATTTGGCAGGTTTTTCCTGGAGG + Intronic
905414625 1:37795332-37795354 ATTTTGCTGGATTTTACAGATGG + Intronic
906865212 1:49410945-49410967 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
907089027 1:51707384-51707406 ATTTGGCAGGGTTTTCTGGATGG + Intronic
907966602 1:59336942-59336964 ATTTGTCAGGTTTCTCCAGAGGG + Intronic
908231491 1:62109836-62109858 ATTTGATAGGTTTTGCCAGATGG - Intronic
908918485 1:69161451-69161473 ATTTGGGTAGTTTTTCCAGGTGG + Intergenic
909173030 1:72318697-72318719 ATTAGGCAGGGTTCTCTAGAGGG + Intergenic
909464232 1:75954897-75954919 TTTGGGCAGTTTGTTCCAGATGG + Intergenic
909466854 1:75982444-75982466 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
909488791 1:76203644-76203666 ATTTAGCATGTTTATTCAGATGG + Intronic
910533678 1:88271246-88271268 ATTTGGATGGTTTTGCTAGAAGG - Intergenic
910939172 1:92514767-92514789 ATTTTGCTGGTATTTCTAGAAGG + Intronic
911150400 1:94592600-94592622 ATTTGGGTGGTTTTTCTTGAAGG - Intergenic
911380259 1:97105643-97105665 ATTTGGTAGCAATTTCCAGAAGG + Intronic
911738054 1:101359132-101359154 ATTAGTCAGGATTTTCTAGAGGG + Intergenic
911857504 1:102898730-102898752 ACTGGGCCGGTTTTTCCAGGAGG + Exonic
912109092 1:106318131-106318153 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
912935726 1:114002340-114002362 AATTGGAAGGGTTTTCCAGAGGG - Intergenic
913499872 1:119462271-119462293 ATTTGGCAGGTTTTTCCAGATGG + Intergenic
913503677 1:119496080-119496102 ATTTGGCAGGTATTTTCTGATGG + Intergenic
913510697 1:119558996-119559018 ATTTGGCAGGTTTTTCCAGATGG + Intergenic
913514913 1:119596411-119596433 ATTTGGCATGCTTTTCCTGAGGG + Intergenic
915023052 1:152799280-152799302 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
915683171 1:157602641-157602663 ATTTGGTCAGTTTTTCCTGAGGG + Intergenic
915790975 1:158671006-158671028 ATCTGGAAAGTTTTTCTAGATGG - Intronic
915802699 1:158810781-158810803 ATTTGGCTGTTCTTACCAGAAGG - Intergenic
915992052 1:160528057-160528079 ATTTGGTATGTTTTTGCAGTGGG + Intergenic
916467553 1:165086981-165087003 ATTTGGCATGATTTTTCAGTGGG - Intergenic
917394235 1:174575241-174575263 TTTTTGTAGTTTTTTCCAGATGG + Intronic
917682152 1:177378253-177378275 ATTTGTCAGGGTTGTCTAGAGGG - Intergenic
918353553 1:183683279-183683301 ATTTGGTATGTTTTTGCAGTGGG + Intronic
918555471 1:185794301-185794323 ATTTGTCAGGGTTCTCTAGAGGG + Intronic
918804321 1:189019456-189019478 ATTTGTCAGGGTTCTCCAGAGGG - Intergenic
918811841 1:189132552-189132574 ATTTGGCAGGTTTCTCCAAATGG + Intergenic
919268406 1:195304580-195304602 ATTTGTCAGGGTTATCTAGAGGG - Intergenic
920595511 1:207265222-207265244 ATTAGCCAGGGTTCTCCAGAGGG - Intergenic
920638367 1:207727418-207727440 AGTAGGCAGGTTTTACGAGATGG - Intronic
921407902 1:214800912-214800934 ATTTGGCAAGGTTTACAAGAAGG - Intergenic
921447349 1:215262200-215262222 ATTTGTCACGTTATTCCACATGG - Intergenic
921940007 1:220829515-220829537 ATTAGTCAGGTTTCTCTAGAGGG + Intergenic
922050308 1:221983078-221983100 ATCTCTCAGGTTCTTCCAGATGG - Intergenic
922546281 1:226459697-226459719 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
924813741 1:247425123-247425145 ATTTGCCATAGTTTTCCAGAAGG - Exonic
1063021662 10:2135079-2135101 ATTGGTCAGGTCTCTCCAGAGGG - Intergenic
1063279547 10:4611599-4611621 ATTTGGCCGTTTTTTTCAGATGG + Intergenic
1063804523 10:9623228-9623250 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1064020786 10:11806888-11806910 TCTTGGCAGGCATTTCCAGATGG - Intergenic
1064170762 10:13030373-13030395 ATTTGGCATGTTTTTGCAGTGGG - Intronic
1064338853 10:14468865-14468887 ATTTGGCAGGGTTTGCGGGAGGG - Intergenic
1064409615 10:15093497-15093519 ATTTGGCAGGTTTTTCCAGATGG + Intergenic
1064836621 10:19539292-19539314 GCTGGGCAGGTTTTTCCACATGG + Intronic
1064881913 10:20065048-20065070 ATTTGGAAGGTGATCCCAGATGG - Intronic
1065075796 10:22078428-22078450 ATTTGGTATGTTTTTGCAGTGGG + Intergenic
1065107267 10:22402698-22402720 ATTTAGTTGGTTTTTCAAGAGGG - Intronic
1065864544 10:29902695-29902717 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1067554172 10:47256197-47256219 ACTGGGCTGGTTCTTCCAGATGG - Intergenic
1068937499 10:62650188-62650210 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
1069097011 10:64271294-64271316 ATTTGGCAGGTGATTCCAGCAGG + Intergenic
1069817334 10:71206771-71206793 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1071804694 10:89105317-89105339 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1071884546 10:89935642-89935664 ATTTGGCATGTTTTTGCGGTGGG + Intergenic
1072046999 10:91667023-91667045 ATTTGGCAGCTTTCTCCAGATGG + Intergenic
1072358743 10:94638458-94638480 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
1075665484 10:124226957-124226979 ATTTGACATGGTATTCCAGATGG - Intergenic
1076103358 10:127800423-127800445 ATTAGTCAGGGTTTTCTAGACGG - Intergenic
1078864618 11:15285666-15285688 AATTGGCAGGTTTTCCAAGCTGG - Intergenic
1078925161 11:15868295-15868317 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1079622454 11:22570729-22570751 CTTTGGAAGTTTGTTCCAGATGG + Intergenic
1079797878 11:24829046-24829068 AGTTGGCTAGTTTTTCCTGAAGG - Intronic
1080455479 11:32415106-32415128 ATTTGGCATGTATTTGCAGCTGG - Intronic
1080727461 11:34912859-34912881 ATTTAGCAGGGTTCTCTAGAGGG - Intronic
1081062616 11:38499285-38499307 ATTTGTCAGGGTTCTCTAGAGGG - Intergenic
1081414626 11:42799690-42799712 AATTGGCAGGTTCTTTGAGAAGG - Intergenic
1081550768 11:44109799-44109821 ATTTGGAAGGTTTTTCTGGAAGG - Intronic
1083813533 11:65118789-65118811 CTCTGGCAGGTTTTTCTGGAGGG - Intergenic
1084677148 11:70642111-70642133 ATTTCACAGGCTTTTCCAGTTGG + Intronic
1085187919 11:74592112-74592134 TTAGGGAAGGTTTTTCCAGAGGG - Intronic
1086581801 11:88408422-88408444 ATTTGGCAGGTTTTTCCAGATGG + Intergenic
1086831979 11:91577296-91577318 ATTTGGCATGTTTTAGCAGTGGG - Intergenic
1087259816 11:95998614-95998636 AAGTGGCAGGATTTTCCAGCAGG - Intronic
1088946015 11:114513138-114513160 ATATGGCAGGGATTTCCTGAGGG - Intergenic
1090321672 11:125850053-125850075 ATTTGTCAGGGTTCTCTAGAGGG + Intergenic
1090356909 11:126146567-126146589 ACTTGGCAGGTCTGTGCAGAGGG - Intergenic
1091071769 11:132571413-132571435 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
1092139654 12:6174266-6174288 ATTTTGCATTTTTTTCCATATGG - Intergenic
1092193918 12:6537799-6537821 ATTTGGCAGGTTTTTCTAGACGG - Exonic
1093563240 12:20568984-20569006 ATATGCCAGCTTTTTCCAGGTGG - Intronic
1094312016 12:29094386-29094408 ATTTGGCATGTTTTTGCAGTGGG - Intergenic
1094361363 12:29634772-29634794 ATTTGTCAGGTTCTTTTAGAGGG + Intronic
1094472021 12:30811775-30811797 ATTAGTCAGGGTTTTCCAGAGGG + Intergenic
1095103958 12:38209238-38209260 ATTTGGCATGTTTTTGCAGTGGG - Intergenic
1095105498 12:38228955-38228977 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
1095581075 12:43799810-43799832 ATTGGGCAGTTTTCTCCAGAAGG - Intronic
1095640788 12:44483065-44483087 ATTTTGCAGGTTCATGCAGAAGG - Intergenic
1095698338 12:45165325-45165347 ATTTGCCAGTGTTTTCCAGCTGG - Intergenic
1095833459 12:46612136-46612158 CTTTGGCAGTCTATTCCAGAAGG - Intergenic
1096457962 12:51802993-51803015 ATCTGTCAGGGTTTTCTAGAGGG + Intronic
1096735281 12:53648614-53648636 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
1097531959 12:60812686-60812708 ATTTGGCATGATTTTGCAGTGGG + Intergenic
1097554614 12:61121706-61121728 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1099221031 12:79914631-79914653 AGTAGGCATGTTTTTTCAGAGGG + Intronic
1099735361 12:86561770-86561792 ATTAGTCAGGGTTTTCTAGAGGG - Intronic
1099821745 12:87719970-87719992 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1100043786 12:90353586-90353608 ATTTGTTTTGTTTTTCCAGAGGG + Intergenic
1100384808 12:94095967-94095989 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1101080237 12:101173983-101174005 TTTTGGCAGGTTTTTCATGGTGG + Intronic
1101227835 12:102707812-102707834 ATTTGTCAAGGTTCTCCAGAAGG + Intergenic
1101328015 12:103733507-103733529 AGTTCTCAAGTTTTTCCAGATGG + Intronic
1101503837 12:105329169-105329191 ACTTGGCAGGTTTTTGAACATGG - Intronic
1101696411 12:107131420-107131442 ATTTGGCTTGTTTTTAAAGAGGG + Intergenic
1101709448 12:107251270-107251292 ATTAGTCAGGGCTTTCCAGAGGG + Intergenic
1102789623 12:115634016-115634038 ATTAGTCAGGGTTCTCCAGAAGG + Intergenic
1102855872 12:116292864-116292886 TTTTGGTAGGTTTTTGCAAAAGG + Intergenic
1105547114 13:21359052-21359074 ATTTGGCAGCTTTCTGCAGATGG - Intergenic
1107236516 13:38177041-38177063 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1107400631 13:40065565-40065587 ATTAGTCAGGTTTCTCCTGAGGG + Intergenic
1107638161 13:42414239-42414261 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1107933089 13:45322471-45322493 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1108732157 13:53246408-53246430 ATTAGCCAGGGTTCTCCAGAGGG + Intergenic
1108815936 13:54290150-54290172 ATTTGTCAGGGTTCTCCAGAGGG + Intergenic
1109283117 13:60379972-60379994 ATTTGGGAGAGCTTTCCAGAGGG - Intergenic
1109914508 13:68963159-68963181 ATTTGTCAGGGTTCTCTAGAGGG + Intergenic
1110009572 13:70314808-70314830 AGTTTGCAGGATTTTCCTGATGG + Intergenic
1110816073 13:79861169-79861191 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1111031549 13:82606594-82606616 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1111150391 13:84246051-84246073 ATTAGGCAGGGTTCTCAAGAGGG + Intergenic
1111576159 13:90156055-90156077 ATTTGTCAGGGTTGTCTAGAGGG + Intergenic
1111802323 13:92996109-92996131 ATTAGGCAGGGTTCTCTAGAGGG + Intergenic
1111941916 13:94618496-94618518 ATTTTGAAGGTTTGTCCAAATGG + Intronic
1113134597 13:107075556-107075578 ATAAGTCAGGGTTTTCCAGAGGG + Intergenic
1114764154 14:25351177-25351199 ATTAGTTAGGGTTTTCCAGAGGG - Intergenic
1116127890 14:40812848-40812870 ATTGGTCAGGGTTTTCCAGAGGG + Intergenic
1116266095 14:42692449-42692471 ATTAGGCAGGGTTCTCTAGAGGG + Intergenic
1116307816 14:43281381-43281403 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1116352245 14:43877775-43877797 ATTTGGCAAGCTTATGCAGAGGG + Intergenic
1116754538 14:48929537-48929559 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1117110063 14:52443427-52443449 ATTAGTCAGGTTTCTCTAGACGG - Intronic
1117215075 14:53543020-53543042 ATTGGAAAGGTCTTTCCAGAAGG - Intergenic
1117417127 14:55507539-55507561 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1117834488 14:59788201-59788223 ATTTTGCAAGTTTATCAAGAAGG + Intronic
1118983502 14:70734179-70734201 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
1119532838 14:75375009-75375031 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1119960031 14:78844784-78844806 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
1120423136 14:84313836-84313858 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1121514342 14:94539387-94539409 ATCAGGAAAGTTTTTCCAGAAGG + Intergenic
1202900659 14_GL000194v1_random:34736-34758 ATTAGTCAGGTTTCTCCAGAGGG - Intergenic
1123917459 15:25047130-25047152 ATTAGTCAGGGTTTCCCAGAAGG - Intergenic
1126981118 15:54244255-54244277 TTTTGTCAGGTTTTGTCAGATGG + Intronic
1128477846 15:68012665-68012687 TTTTGGAAGGTTTTTGGAGAAGG + Intergenic
1129420973 15:75426423-75426445 ATTTGGCAGTTTGTGTCAGATGG - Intronic
1129574270 15:76724032-76724054 ATTTGACATGTTTTTGCAGTGGG + Intronic
1131860060 15:96644073-96644095 ATTTAGTAGATATTTCCAGATGG - Intergenic
1134269984 16:12724628-12724650 AATGGGCAAGGTTTTCCAGAAGG - Intronic
1136062997 16:27739457-27739479 ATTTGGCAGGTGATTCCAAGAGG - Intronic
1136133507 16:28239933-28239955 ATTCGACAGGTTTTTCCAGGCGG + Intergenic
1137816369 16:51401614-51401636 ATTAGTCAGGGTTTTCCAGAGGG + Intergenic
1139257152 16:65553143-65553165 ATTTGGTATGTTTTTGCAGTGGG - Intergenic
1140382602 16:74503962-74503984 ATTAATCAGGTTTTTCTAGAAGG - Intronic
1140869744 16:79095647-79095669 ACCTGGCAGGTTTTTCAACATGG + Intronic
1141148739 16:81549811-81549833 ATTTGCCTGGTTTCTCCACATGG - Intronic
1141233744 16:82196315-82196337 AAAGGGCAGGTTTTCCCAGAGGG - Intergenic
1143169091 17:4916178-4916200 ATTTGTCAGATGTTTCCACAAGG - Intergenic
1144229902 17:13191602-13191624 ATTAGTCAGGTTTCTCTAGAGGG + Intergenic
1149077831 17:52617461-52617483 ATTAGTCAGGTTTCTCTAGAGGG + Intergenic
1150765537 17:67998910-67998932 CTCTGGCAGGTTCTTCCAGCTGG - Intergenic
1150890769 17:69146450-69146472 CTTTGGCAGGGTTCTCTAGAGGG + Intergenic
1151174404 17:72275297-72275319 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1151182693 17:72341097-72341119 ATTGGGCAGGATGTTCCAAAGGG - Intergenic
1156130661 18:33969478-33969500 ATTTCTCAGCTTTTTCCAAAAGG + Intronic
1156872139 18:41957679-41957701 ACTTGTCAAGTTTTTGCAGAAGG + Exonic
1157340942 18:46777959-46777981 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1157634217 18:49133781-49133803 ATTAGACTGGTTATTCCAGATGG - Intronic
1157641373 18:49217786-49217808 ATTTGGCATGTTTTTGCAGTGGG - Intronic
1158126042 18:54100530-54100552 ATTAGCCAGGGTTCTCCAGAGGG - Intergenic
1158747429 18:60217667-60217689 TTTAGGCAAGTTTTTCCAGGTGG + Intergenic
1159004995 18:63003632-63003654 ATTAGACAGGGTTCTCCAGAGGG - Intergenic
1159404576 18:67983628-67983650 ATTGCACAGGTTTTTTCAGAGGG - Intergenic
1159720782 18:71887924-71887946 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1159780733 18:72657577-72657599 ATTTGTCAAGATTTTCTAGATGG - Intergenic
1160090707 18:75824298-75824320 ATATGGCAGCTATTTCCAAACGG + Intergenic
1160654061 19:251978-252000 ATTAGTCAGGGTTCTCCAGAAGG + Intergenic
1162590221 19:11586571-11586593 ATTTGGCAGGTTTCTCCAGATGG - Intronic
1163255793 19:16155059-16155081 ATATGGCAGGTCCTTTCAGAGGG - Intronic
1164117758 19:22238615-22238637 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1164875579 19:31683678-31683700 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1164987389 19:32658456-32658478 CTTTGAAAGGTTTTTCCAAAGGG - Intronic
1167882579 19:52472819-52472841 ATTTGGGAGGTTTTTTGAAAAGG - Intronic
925080251 2:1057330-1057352 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
925418173 2:3688228-3688250 ATTTGTCAAGTTTCTCCAGATGG + Intronic
925516242 2:4685941-4685963 ATTGGCAAGGTTTTTCAAGAAGG + Intergenic
925755220 2:7127264-7127286 ATTGGTCAGGGTTCTCCAGAGGG + Intergenic
926283644 2:11470277-11470299 ATTAGTCAGGGTTTTCTAGAGGG + Intergenic
926390743 2:12389864-12389886 TTTTTGCAGATTTTGCCAGAGGG - Intergenic
926453388 2:13035175-13035197 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
926631885 2:15144085-15144107 ATTAGTCAGGTTTCTCTAGAGGG - Intergenic
926971875 2:18474717-18474739 ATTTTGCAGCCTTTTCCAAATGG + Intergenic
927218755 2:20687015-20687037 ATTAAGAAGGATTTTCCAGAAGG - Exonic
928172663 2:29013313-29013335 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
928721509 2:34126417-34126439 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
928865923 2:35917667-35917689 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
928950726 2:36810959-36810981 ATTTGGCAGGATTTTCTGAATGG + Intronic
929098447 2:38286151-38286173 ATTTGGCAGGATTTTCCAGATGG - Intergenic
929323953 2:40582775-40582797 ATTGGGCAAGTCTTTCTAGATGG + Intronic
929333974 2:40717480-40717502 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
931142838 2:59482565-59482587 ATTATGGAGGTTTTACCAGATGG + Intergenic
931182090 2:59912807-59912829 ATTAGTCAGTTTCTTCCAGATGG - Intergenic
932021609 2:68093422-68093444 ATTTGGTAGGTGTTTCTAAAAGG - Intronic
932543754 2:72685411-72685433 AATTAGCAAGTTTGTCCAGAGGG + Intronic
932801093 2:74743169-74743191 ATTAGAAAGGATTTTCCAGAAGG - Intergenic
932868512 2:75372994-75373016 ATTTGGCACGCTTTTGCAGTCGG + Intergenic
932938751 2:76137815-76137837 ATTTGGTATGTTTTTGCAGTGGG + Intergenic
934025101 2:87996040-87996062 ATTAGTCAGGGCTTTCCAGACGG + Intergenic
934506210 2:94896810-94896832 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
934877462 2:97938060-97938082 ATTTGGCATGATTTTGCAGGTGG - Intronic
937841058 2:126525112-126525134 CTTGGGCAGGGTTTTCCATAAGG - Intergenic
938700248 2:133871547-133871569 ATTTGGCAGTTTTCTTCAAAAGG - Intergenic
939074697 2:137586445-137586467 ATTTGGCATGTTTGTGCAGTGGG + Intronic
939410376 2:141816699-141816721 ATTTGTCAGGTTTCTCTAAAGGG - Intronic
940646410 2:156397223-156397245 ATTAGTCAGGGTTTTCCAGAGGG + Intergenic
940759440 2:157721141-157721163 ATTTAACAGATTTATCCAGAGGG + Intergenic
941163536 2:162061312-162061334 ATTTGAGAAGTTTGTCCAGATGG - Intronic
941178237 2:162226936-162226958 AGTTGTCAAGGTTTTCCAGAAGG + Intronic
941416373 2:165226511-165226533 TTTTTGAAGATTTTTCCAGAGGG + Intergenic
942837358 2:180316060-180316082 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
943401365 2:187415581-187415603 AATTGGCAGGTTTTTCCAGACGG - Intronic
943517241 2:188904387-188904409 ATTAGTCAGGCTTCTCCAGAGGG + Intergenic
943994300 2:194739245-194739267 ATTAGTCAGGATTCTCCAGAGGG - Intergenic
944624502 2:201557517-201557539 ATTAGCCAGTTGTTTCCAGAAGG - Intronic
945495988 2:210507409-210507431 ATTTGGCATGTTTTTGCAGTGGG - Intronic
945783752 2:214208141-214208163 ATTTTTCAGGGTTCTCCAGAAGG - Intronic
945815683 2:214602570-214602592 ATGTGACATGTTTTTCCAAATGG + Intergenic
946710888 2:222504110-222504132 ATTTGGCACCTTTCTCCAGATGG + Intronic
947007042 2:225524021-225524043 ATTAGTCAGGATTCTCCAGAGGG + Intronic
947015326 2:225612990-225613012 ATTAGTCAAGTTTCTCCAGAGGG + Intronic
947034416 2:225835926-225835948 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
947256021 2:228164433-228164455 ATTAGTCAGGGCTTTCCAGAGGG - Intronic
1170049915 20:12130697-12130719 ATTTTGCAGCTTTTACCATATGG + Intergenic
1170169308 20:13393413-13393435 ATTTGGCAGGTTTCTCCAGACGG - Intronic
1170572282 20:17639115-17639137 AGCTGGAATGTTTTTCCAGAAGG + Intronic
1171236305 20:23527911-23527933 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1173564769 20:44030782-44030804 ATTTTTCAGGTTTTTCAGGAAGG - Intronic
1173628535 20:44491975-44491997 ATTTCTTAGGTTTTTCCAGTTGG + Exonic
1174732672 20:52933154-52933176 GTTTGGGTGGTTTTTCCAGATGG + Intergenic
1175924227 20:62464163-62464185 GTTTGGACAGTTTTTCCAGAGGG - Exonic
1176620034 21:9049514-9049536 ATTAGTCAGGTTTCTCCAGAGGG - Intergenic
1177219182 21:18168310-18168332 ATTAGTCAGGGTTTTCTAGAGGG - Intronic
1177296834 21:19186856-19186878 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1177321606 21:19528865-19528887 ATTTGCCACCTTTTTCCTGAAGG - Intergenic
1177451260 21:21269953-21269975 ATTTGTCAGGTTTCTACACAAGG + Intronic
1177912770 21:27052892-27052914 ATTTGTCAGGGTTCTCTAGAGGG + Intergenic
1177998904 21:28135769-28135791 ATTAGTCAGGATTTTCTAGAGGG - Intergenic
1178096698 21:29223018-29223040 ATTTGGCAGGTTTCTCCAGATGG - Intronic
1178121937 21:29477980-29478002 ATTAGTCAGGGTTCTCCAGAAGG + Intronic
1178477685 21:32951580-32951602 ATTTGGAAGGTTCCTGCAGAAGG + Intergenic
1178627268 21:34228442-34228464 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1178857359 21:36261512-36261534 ATTCCGCAGGTTTTTCCCCATGG + Intronic
1179325362 21:40337865-40337887 TTTTGGCTTGGTTTTCCAGAGGG - Intronic
1180257359 21:46641358-46641380 AGTTGGAGAGTTTTTCCAGAAGG + Intronic
1180419855 22:12803353-12803375 ATTTGGCATGTTTTTGCAGTGGG - Intergenic
1181373377 22:22436426-22436448 ATTAGTCAGGGTTTTCTAGATGG + Intergenic
1181825451 22:25511663-25511685 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1181909562 22:26227913-26227935 CATTGGCACGTTTTTACAGATGG - Intronic
1182419720 22:30243054-30243076 ATCTGGCAGAAGTTTCCAGAAGG - Exonic
1182665141 22:31952760-31952782 TTTTGGCAGCTTATTCCTGATGG + Intronic
1182862387 22:33571274-33571296 AATTGGCAGCTTCTTCAAGAAGG - Intronic
1182959032 22:34454783-34454805 ATTAGAAAGGATTTTCCAGATGG + Intergenic
1183861518 22:40673708-40673730 ATTTGGCAGGTTTCTCCAGATGG + Intergenic
949140048 3:620901-620923 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
949669711 3:6385132-6385154 TATTGGCAGGTTATTCCAAAAGG + Intergenic
949985208 3:9535675-9535697 TTTAGGAAGGTTTTTCCAGAAGG + Intronic
950121235 3:10483770-10483792 TTTTGGAAGTTTTTTCCGGAAGG - Intronic
951286422 3:20819511-20819533 ATTTGCCATGTTTTTGCAGTGGG + Intergenic
953050475 3:39337272-39337294 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
953180661 3:40591393-40591415 AGTAGTCAGGTTTTTCTAGAGGG + Intergenic
955174886 3:56604386-56604408 ATTTGGTATGTTTTTGCAGTGGG + Intronic
955611879 3:60766165-60766187 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
956521768 3:70111976-70111998 ATTTGCTAGATTTTTCCTGAAGG + Intergenic
956560868 3:70572800-70572822 ACTTGGCAGGTCTGTCCAGGTGG - Intergenic
956901084 3:73716858-73716880 ACTTGGGAGGTTTTTCAAGAAGG - Intergenic
957453807 3:80415355-80415377 ATTAGTCAGGGTTATCCAGAAGG + Intergenic
957683769 3:83473595-83473617 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
957706432 3:83792220-83792242 ATTGGCCAGGAATTTCCAGAAGG - Intergenic
957712332 3:83877445-83877467 ATTAATCAGGGTTTTCCAGAGGG - Intergenic
958006228 3:87814615-87814637 ATTTTGCAGAATTTTACAGATGG - Intergenic
958601936 3:96305805-96305827 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
959071354 3:101704806-101704828 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
959263169 3:104105525-104105547 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
959527019 3:107388716-107388738 ATGTGTCAGGGTTCTCCAGAGGG + Intergenic
959540151 3:107527068-107527090 ATTTTGCAGATTTTTCCACTTGG - Intronic
960495142 3:118364062-118364084 ATTAAGCAGGGTTCTCCAGAGGG + Intergenic
962513677 3:136128045-136128067 ATTTGGCATGTTTTTGCAGTGGG - Intronic
962786923 3:138777193-138777215 ATTTGGCAGGTCTCTCCAGATGG - Intronic
962787092 3:138778555-138778577 ATTTGGCAGGTCTCTCCAGATGG - Intronic
963432640 3:145229484-145229506 ATTAGTCAGGTTTCTCTAGAGGG + Intergenic
963575546 3:147057854-147057876 ATGTGGGATGTTTTTCAAGATGG + Intergenic
964442087 3:156722398-156722420 ATTCAGCAGGAATTTCCAGAGGG - Intergenic
967745256 3:193047836-193047858 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
968418215 4:459182-459204 GTTTGGTATGTTTTTGCAGAGGG - Intronic
968828835 4:2920945-2920967 ATTTGGTATGTTTTTGCAGTGGG + Intronic
971549223 4:27928116-27928138 ATTCTTCAGGGTTTTCCAGAGGG - Intergenic
971559896 4:28064746-28064768 ATTTGGCGGGGTTCTCTAGAGGG - Intergenic
971785028 4:31090112-31090134 AACTGGCAGGTTATTCCTGAAGG - Intronic
971920123 4:32928007-32928029 ATGTGGCAGTCATTTCCAGATGG + Intergenic
972039814 4:34578937-34578959 ATTAGTCAGGTTTCTCTAGAGGG - Intergenic
972276932 4:37566143-37566165 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
972920737 4:43938447-43938469 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
973027282 4:45288510-45288532 ATTTGTCAGGGTTCTCTAGAGGG - Intergenic
973252133 4:48071644-48071666 ATGTGGGAAGTTTTTACAGAAGG - Exonic
973684457 4:53355196-53355218 ATTAGTCAGGATTCTCCAGAGGG - Intronic
974362075 4:60894238-60894260 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
974438194 4:61883994-61884016 CTTTGGTAGCTTTTTCCATAAGG + Intronic
974975723 4:68888696-68888718 ATTAGTCAGGGTTCTCCAGAAGG + Intergenic
975424762 4:74213307-74213329 ATTTGGTATGTTTTTGCAGTGGG + Intronic
975524448 4:75333242-75333264 ATTTGGTATGTTTTTGCAGTGGG - Intergenic
975806332 4:78116940-78116962 ATTTGGCATGTTTTTGCAGTGGG + Intronic
975876172 4:78839573-78839595 ATTAGTCAGGGTTTTCTAGAGGG + Intronic
975979901 4:80145395-80145417 CTTTAGCAGGTGATTCCAGAAGG + Intergenic
976628042 4:87207825-87207847 ATTTGGCAGGTTTTTCCAGATGG - Intronic
977702154 4:100033162-100033184 ATTAGTCAGGGTTTTCTAGAGGG + Intergenic
977973871 4:103242192-103242214 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
977985377 4:103376457-103376479 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
978213711 4:106171599-106171621 ATTTGGCAGATTTTTAAATAAGG - Intronic
979362088 4:119776656-119776678 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
979625841 4:122844492-122844514 AATTGTCAGTTATTTCCAGAAGG + Intronic
979859404 4:125675622-125675644 ATTTGTTAGGGTTTTCCAGAGGG + Intergenic
980091137 4:128444024-128444046 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
980365747 4:131802743-131802765 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
981598722 4:146458972-146458994 ATTTTGTAGTTTTTTTCAGAAGG - Intronic
983094096 4:163541728-163541750 ATTTTAAAGGTTTTTCAAGATGG + Intronic
983304863 4:165973066-165973088 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
983415219 4:167443632-167443654 ATTAGTCAGGTTTCTCTAGAGGG - Intergenic
983581823 4:169316964-169316986 ATTTGTCAGGGTTCTCTAGAGGG - Intergenic
983583040 4:169327617-169327639 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
983701197 4:170596298-170596320 ATTAGTCAGGTTTCTCTAGAGGG - Intergenic
984432799 4:179669279-179669301 ATTAGTCAGGGATTTCCAGAGGG - Intergenic
984793738 4:183638338-183638360 ATTCGGCCAGTGTTTCCAGAGGG - Intergenic
985007823 4:185551741-185551763 ATATAGCAGGGTTCTCCAGAGGG - Intergenic
985520357 5:371258-371280 TGTTGGGAGGTGTTTCCAGATGG - Intronic
985830596 5:2225581-2225603 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
986187356 5:5457324-5457346 CTTTGGCAGGTTTTTCTATGTGG - Exonic
986191782 5:5503138-5503160 ATTAGTCAGGATTCTCCAGATGG - Intergenic
986777600 5:11032073-11032095 ATTAGTCAGGATTCTCCAGAGGG - Intronic
988716599 5:33834976-33834998 ACTTGGCAGGTGTTGCCACACGG - Intronic
988783459 5:34544343-34544365 TTTTGAGATGTTTTTCCAGAGGG - Intergenic
988840756 5:35081437-35081459 ATTTGGCAGGTTTATCCAGATGG - Intronic
991116403 5:62960809-62960831 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
991946465 5:71902670-71902692 ATTAGTCAGGTTTGTCTAGAGGG - Intergenic
991951134 5:71947864-71947886 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
992287860 5:75254097-75254119 GTTTGGCATGTTTTTGCAGTGGG + Intergenic
992329163 5:75697587-75697609 TTTTGGCATGTTTTTGCAGTGGG - Intronic
992948120 5:81829571-81829593 ATTAGTCAGGGTTTTTCAGAGGG - Intergenic
992968035 5:82023125-82023147 ATTGGGCAGATTCTTCCAGTGGG + Intronic
993241870 5:85399024-85399046 ATTAGTCAGGTCTCTCCAGAGGG - Intergenic
993578739 5:89634030-89634052 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
994041811 5:95267489-95267511 AAATGGCATGTTTTTCCAGGGGG + Intronic
994588906 5:101748913-101748935 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
996110903 5:119565430-119565452 ATTTGTCAGGGTTCTCTAGAGGG + Intronic
996556000 5:124779383-124779405 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
996606900 5:125334021-125334043 ATTAGGCAGGGTTCTCTAGAGGG + Intergenic
996642383 5:125771668-125771690 ATTTGAGAGGGTTTTCCAAATGG - Intergenic
999266592 5:150270688-150270710 AGTTGGCAGACTTTTCCAGAAGG + Intronic
999805513 5:155077573-155077595 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1000300319 5:159950738-159950760 ATTTGGCAGGTTTTTCGAGACGG + Intronic
1000598916 5:163248650-163248672 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1000604389 5:163312687-163312709 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1001797428 5:174514036-174514058 ATTTGGCAGGTTTTTCCAGATGG - Intergenic
1003404565 6:5817661-5817683 ATTTCGCAGCTTTCTGCAGAAGG + Intergenic
1005178157 6:23071796-23071818 ATTAGTCAGGGTTTTCTAGAAGG + Intergenic
1005204124 6:23381099-23381121 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1005358236 6:25005645-25005667 ATGTGGCAGGTATTTCCAAGGGG + Intronic
1005622887 6:27636317-27636339 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1006745363 6:36337936-36337958 AGCTGGCAGGTGTCTCCAGATGG - Intergenic
1008756394 6:54799472-54799494 ACTTGGAAGTTTTCTCCAGATGG - Intergenic
1008963435 6:57289837-57289859 ATTTGGCATGTTTTTGTAGTGGG - Intergenic
1009023233 6:57967932-57967954 ATTTGGCAGGTTTCTTTATATGG + Intergenic
1009198801 6:60719466-60719488 ATTTGGCAGGTTTCTTTAGATGG + Intergenic
1009446434 6:63748058-63748080 ATTTGGTATGTTTTTGCAGTTGG + Intronic
1009850505 6:69192044-69192066 ATTAGTCAGGTTTCTCTAGAGGG + Intronic
1009895730 6:69746584-69746606 ATTTGGCAAGTTTCTCCAGATGG - Intronic
1010325980 6:74562280-74562302 ATTAGTCAGGATTTTCTAGAGGG - Intergenic
1010370851 6:75105595-75105617 ATTTTGGATTTTTTTCCAGATGG - Intronic
1010580461 6:77590328-77590350 ATTAGTCAGGTTTCTCTAGAGGG + Intergenic
1010781837 6:79953250-79953272 ATTTGGCAGGTTTTTCCAGATGG + Intergenic
1010818175 6:80384790-80384812 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1011071801 6:83393143-83393165 ATTTGGTAGGTTTTTCCAGACGG - Intronic
1011209373 6:84938032-84938054 ATTTGGCATGTTTTTGCAGTGGG - Intergenic
1011491288 6:87896143-87896165 ATTTGTCAGGGTTTCCTAGAGGG + Intergenic
1012096792 6:94972410-94972432 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1012720567 6:102737104-102737126 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1012900800 6:105003883-105003905 ATTTGTCAGGGTTCTCTAGAGGG + Intronic
1013038617 6:106411566-106411588 ATTAGTCAGGATTTTCCAGAGGG + Intergenic
1013066442 6:106688599-106688621 ATTTAGGAGTTGTTTCCAGAGGG + Intergenic
1013226530 6:108122920-108122942 ATTTGGAAACTTTTTCCACAAGG - Intronic
1013234732 6:108187577-108187599 AATTGGCATTTTTTTCCTGAAGG - Exonic
1014042887 6:116850230-116850252 ATTAGTCAGGGTTCTCCAGACGG - Intergenic
1014529378 6:122541292-122541314 TTTTGGCATGTTTTTGCAGTGGG + Intronic
1016119582 6:140329787-140329809 ATTTGTCAGGGTTATCTAGAGGG + Intergenic
1016585109 6:145675317-145675339 ATTTGGCATGTTTTTGCAGTGGG - Intronic
1016624343 6:146148139-146148161 ATTTGGGAAATTTTTCCAGAAGG - Intronic
1016789219 6:148050304-148050326 ATTAGTCAAGGTTTTCCAGAGGG - Intergenic
1016908660 6:149175981-149176003 ATTTGTCAGGGTTCTCTAGAGGG + Intergenic
1017618867 6:156274332-156274354 ATTAGTCAGGTTTCTCTAGAGGG - Intergenic
1018654517 6:166021137-166021159 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1018658680 6:166065030-166065052 ATTTGGTAGGTTTTTCCAGATGG - Intergenic
1020437698 7:8183445-8183467 ATATAGAAGGTTTTTGCAGAGGG + Intronic
1020551770 7:9615718-9615740 ATTTGGCAGGTTTCTCCAGATGG - Intergenic
1020786992 7:12585864-12585886 ATTTGGCAACTTTCTCCAGCAGG + Intronic
1020886321 7:13822926-13822948 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1021367271 7:19795359-19795381 ATTAGTCAGGGTTTCCCAGAAGG - Intergenic
1022708648 7:32831192-32831214 ATCTGTCAGGATTTTCCAGAGGG + Intergenic
1022914523 7:34934285-34934307 ATCTGCCAGGGTTTTCCAGAGGG - Intronic
1022951478 7:35342753-35342775 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1023750569 7:43368292-43368314 ATGATGCAGGGTTTTCCAGAAGG + Intronic
1024090694 7:45937582-45937604 CCCTGGCAGGTTTGTCCAGAGGG - Intergenic
1027676370 7:81163338-81163360 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1027840730 7:83308028-83308050 ATTTGTCATGCTTCTCCAGAGGG + Intergenic
1028122176 7:87068691-87068713 ATTAGTCAGGTTTCTTCAGAGGG + Intergenic
1028559249 7:92155568-92155590 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
1029902250 7:104053863-104053885 ATTTGGATGTTTTTCCCAGAGGG - Intergenic
1030183589 7:106736944-106736966 ATTTGGCAGCTGTTGCCAAAGGG - Intergenic
1031009146 7:116505981-116506003 ATTAGGCAGGTCTTTACAAAAGG - Exonic
1031312487 7:120216023-120216045 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1032248884 7:130235845-130235867 ATTAGTCAGGGTTCTCCAGAAGG - Intergenic
1032286020 7:130539026-130539048 TTTTGGAAACTTTTTCCAGAGGG + Intronic
1032591416 7:133195227-133195249 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1033403586 7:141050661-141050683 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1034098146 7:148428070-148428092 ATTTGGTATGTTTTTGCAGTGGG - Intergenic
1034949375 7:155286743-155286765 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1035430360 7:158815506-158815528 ATTTGGCAGGGATATCCAGAGGG - Intronic
1036603246 8:10282924-10282946 ATTTGGGGGGTTTTTCTGGAGGG - Intronic
1037183524 8:16034519-16034541 GTTTGGCATGTTTTTGCAGCAGG - Intergenic
1038339437 8:26672746-26672768 ATTTGGAACATTTTTCAAGATGG - Intergenic
1038910428 8:31957209-31957231 CTTTGGCAGGTTTTACAAGGGGG + Intronic
1038920692 8:32080719-32080741 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
1039131699 8:34272279-34272301 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1039651826 8:39349313-39349335 ATTTGTCAGGGTTCTCTAGAGGG - Intergenic
1040356149 8:46620436-46620458 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1040814634 8:51494312-51494334 ATTTGGCATGTTTTTGCAGTGGG - Intronic
1041314826 8:56550309-56550331 TTTTGTCAGGTTTGTCAAGATGG + Intergenic
1041925403 8:63230869-63230891 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1042412741 8:68482978-68483000 AATTGGCATTTTTTTCCAGTAGG + Intronic
1042970867 8:74407686-74407708 ATTAGTCAGGGTTTTCTAGAGGG - Intronic
1043273342 8:78361817-78361839 ATTAGTCAGGGTTTTCTAGAGGG + Intergenic
1044861831 8:96531323-96531345 ATAGGGCACGTTTTTCCAAAAGG + Intronic
1045160485 8:99536993-99537015 ATTTGACATGGTTTACCAGAAGG - Intronic
1045258538 8:100550959-100550981 ATTTGGCAGGTTTCTCCAGATGG + Intronic
1046001685 8:108427716-108427738 ATTAGTCAGGGTTTTCTAGAGGG - Intronic
1046119824 8:109831794-109831816 ATTAGTCAGGGTTCTCCAGAAGG - Intergenic
1047054040 8:121144694-121144716 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1047406161 8:124587315-124587337 ATTTGACATTTTTTTTCAGATGG - Intronic
1047425878 8:124746384-124746406 ATTTGGCAGCCTTTTCCAGATGG - Intergenic
1047845757 8:128803243-128803265 ATTTGGCATGATTTTGCAGCAGG - Intergenic
1048358438 8:133673476-133673498 AATTGGCAGGATGTTTCAGAGGG + Intergenic
1048734418 8:137482746-137482768 ATTTGTCAGGGTTCTCTAGAGGG + Intergenic
1050213800 9:3297552-3297574 ATTTGTCATTTTTTCCCAGATGG + Intronic
1050498331 9:6267642-6267664 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1050870236 9:10558648-10558670 ATTTGGTAGGTTCTTCCCAAAGG + Intronic
1050975746 9:11936109-11936131 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1051551718 9:18337469-18337491 ATTTGTCAGGGTTCTCTAGAAGG - Intergenic
1052003325 9:23315304-23315326 ATTAGTCAGGGTTTCCCAGAGGG - Intergenic
1052411680 9:28129303-28129325 ATTAGTCAGGGTTCTCCAGAGGG - Intronic
1052736473 9:32347489-32347511 AGCTGGCAGTTTCTTCCAGATGG - Intergenic
1052757569 9:32556747-32556769 ATCTTGCTGGTTTTTCCAGCTGG - Intronic
1053630096 9:39928612-39928634 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1053775676 9:41534920-41534942 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1054213791 9:62322090-62322112 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1055752350 9:79521168-79521190 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1055791073 9:79923783-79923805 ATTAGTCAGGGTTCTCCAGATGG - Intergenic
1055836140 9:80445257-80445279 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1055883005 9:81024285-81024307 ATTAGTCAGGTTTCTCCAGAGGG - Intergenic
1057390977 9:94641240-94641262 TTTTGGTTGGTTTTTCCAGTTGG - Intergenic
1058094736 9:100846811-100846833 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1058096222 9:100863075-100863097 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1058124914 9:101180260-101180282 ATTAATCAGGGTTTTCCAGAGGG - Intronic
1058558961 9:106203596-106203618 ATCTGGAAGCTTCTTCCAGAGGG + Intergenic
1058586201 9:106508391-106508413 ATTTGGCAGGAATTTTCTGAGGG - Intergenic
1058750004 9:108030696-108030718 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
1058797319 9:108511265-108511287 ATTAGTCAGGGTTCTCCAGAGGG - Intergenic
1058799829 9:108534766-108534788 ATTTGGTAGGTTTATCTACAAGG - Intergenic
1059005295 9:110395384-110395406 ATTTGGCATGTTTTTGCAGTGGG - Intronic
1059616844 9:115960936-115960958 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
1060865755 9:126995062-126995084 ATTTGGCATGTTTTTGCAGTGGG - Intronic
1203566872 Un_KI270744v1:99543-99565 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1185989384 X:4876005-4876027 ATTAGTCAGGGTTTTCCAGAGGG - Intergenic
1186347133 X:8705284-8705306 ATTTGTGAGGTTTTTCCACAAGG + Intronic
1186597134 X:10994744-10994766 ATTTGGTAGGGTTATCGAGAGGG - Intergenic
1187319494 X:18227038-18227060 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1187660267 X:21538527-21538549 ATTAGTCAGGGTTCTCCAGAGGG + Intronic
1188109110 X:26176504-26176526 ATTTGGCATGTTTTTGCAGTGGG - Intergenic
1188775762 X:34216355-34216377 ATTAGTCAAGTTTCTCCAGAGGG - Intergenic
1188797366 X:34482772-34482794 ATTAGTCAGGTTTCTCTAGAGGG - Intergenic
1189060222 X:37745858-37745880 ATTTTTCAGGCTTTTCAAGATGG - Intronic
1189276125 X:39787377-39787399 ATTTGGCAGGTTTTTCCAGACGG + Intergenic
1189785608 X:44556486-44556508 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1190010501 X:46780600-46780622 TTTAGTCAGGGTTTTCCAGAGGG + Intergenic
1190592331 X:52017328-52017350 AATAGTCAGGTTTCTCCAGAGGG + Intergenic
1190880390 X:54487943-54487965 GTTTGGTTGGTTTTTTCAGACGG - Intronic
1190921543 X:54858047-54858069 ATTTGGCATGTTTTTGCATTGGG + Intergenic
1191060717 X:56292977-56292999 ATTTGGCATGTTTTTGCAGTGGG - Intergenic
1191063384 X:56321672-56321694 ATTTGGCATGATTTTCCAGTGGG - Intergenic
1191065086 X:56339754-56339776 ATTTGGTATGTTTTTCCAGTGGG + Intergenic
1191144353 X:57150870-57150892 ATTTGGCATGTTTTTGCAGTGGG + Intergenic
1193413527 X:81195035-81195057 ATTAGTCAGGGTTTTCTAGAGGG + Intronic
1194161364 X:90456317-90456339 ATTAGTCAGGGTTTTCCAGAGGG + Intergenic
1194486111 X:94489215-94489237 ATCAGGCTGGTTTTTCCAGTGGG - Intergenic
1194515683 X:94851021-94851043 ATTTGGCAGGTTTTTCCATTTGG - Intergenic
1194634343 X:96325555-96325577 TTATGGCATGTTTTTCCTGATGG - Intergenic
1195179474 X:102342869-102342891 ATTTGACAGTATTTTCCACATGG - Intergenic
1195420491 X:104670009-104670031 ATTAGTCAGAGTTTTCCAGAGGG + Intronic
1196512239 X:116525349-116525371 ATTAGTCAGGTTTCTCTAGAGGG + Intergenic
1196564821 X:117192799-117192821 ATTTGTCAGGGTTCTCTAGAGGG + Intergenic
1196924014 X:120614094-120614116 ATTTGGCTGGCTGTTCCAGCTGG + Intronic
1197347028 X:125336490-125336512 ATTTGTCAGGGTTCTCTAGAGGG - Intergenic
1197405496 X:126042950-126042972 ATTAGTCAGGGTTTTCTAGAGGG - Intergenic
1197633225 X:128886251-128886273 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1197685054 X:129430173-129430195 CTTAGGCAGTTCTTTCCAGAGGG - Intergenic
1197861032 X:130970900-130970922 ATTAGTCAGGGTTCTCCAGAGGG + Intergenic
1198380441 X:136078350-136078372 ATTTGCCAGGTCTTTCCAGAAGG - Intergenic
1198472657 X:136963137-136963159 ATCTGGCAGGGGTTCCCAGAAGG - Intergenic
1198509635 X:137337095-137337117 ATTTAGCAGGTGTTTCAAGCTGG + Intergenic
1198511399 X:137355225-137355247 ATGTGCCAGGCTTTTTCAGAAGG - Intergenic
1199100108 X:143789720-143789742 ATGTGTCAGAGTTTTCCAGAGGG + Intergenic
1199589815 X:149456930-149456952 ATTCGACAGGTATTTCCTGAGGG - Intergenic
1200332910 X:155316617-155316639 ATTTGTCAGGGTTCTCTAGAGGG + Intronic
1200507648 Y:4033252-4033274 ATTAGTCAGGGTTTTCCAGAGGG + Intergenic
1201590860 Y:15612901-15612923 ATTGGGCATGTTTTTGCAGTGGG - Intergenic
1201929643 Y:19328297-19328319 ATTTGGTAGGTTTTCACATATGG - Intergenic
1201942861 Y:19478549-19478571 ACTGGGCAGCTTTTGCCAGATGG - Intergenic