ID: 976628051

View in Genome Browser
Species Human (GRCh38)
Location 4:87207877-87207899
Sequence ACATCGGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 7, 3: 11, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976628044_976628051 12 Left 976628044 4:87207842-87207864 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43
976628042_976628051 29 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43
976628043_976628051 16 Left 976628043 4:87207838-87207860 CCTGCCAAATATGATGACATCAA 0: 11
1: 12
2: 12
3: 18
4: 178
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976628051 Original CRISPR ACATCGGAGGGCCCCCTCAA GGG Intronic