ID: 976628051

View in Genome Browser
Species Human (GRCh38)
Location 4:87207877-87207899
Sequence ACATCGGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 7, 3: 11, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976628044_976628051 12 Left 976628044 4:87207842-87207864 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43
976628043_976628051 16 Left 976628043 4:87207838-87207860 CCTGCCAAATATGATGACATCAA 0: 11
1: 12
2: 12
3: 18
4: 178
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43
976628042_976628051 29 Left 976628042 4:87207825-87207847 CCATCTGGAAAAACCTGCCAAAT 0: 8
1: 13
2: 10
3: 61
4: 442
Right 976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 7
3: 11
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976628051 Original CRISPR ACATCGGAGGGCCCCCTCAA GGG Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903287625 1:22286628-22286650 CCAACTGAGGGCCCCCTCACTGG - Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
908375432 1:63533554-63533576 ACATCGAAGGGTCCCCTGAAAGG + Exonic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
923267419 1:232328143-232328165 ACATCGGAGAGCCCACTCCTAGG + Intergenic
1067214974 10:44293833-44293855 CCACCTGAGGGCCCCCTGAAAGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1077595893 11:3531416-3531438 TCATGGGAGGGCCCCCCCATGGG - Intergenic
1083615545 11:64024357-64024379 AAATCATAGGACCCCCTCAACGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1090199369 11:124843320-124843342 CCTTCGGAGGACCCCCTCCAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1115536669 14:34379622-34379644 AGATGGGAGGTCTCCCTCAAAGG - Intronic
1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG + Intronic
1126187541 15:45845162-45845184 CCATCGGACAGCCCCCACAAAGG - Intergenic
1142180951 16:88669858-88669880 ACATGGGTGGGCCCCTTCAGAGG - Intergenic
1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG + Intronic
1146601986 17:34225390-34225412 ACAGAGGTGGGCCCCCTTAAAGG - Intergenic
1147210266 17:38869286-38869308 AAATCCGGGTGCCCCCTCAATGG - Intergenic
1148085593 17:44991961-44991983 AGATGGGAGGGCCCTCTCAGTGG + Intergenic
1160120848 18:76129453-76129475 ACATCTGAGGGCCTCATCACAGG - Intergenic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
945037995 2:205720739-205720761 ACTCCTGAGGGCCTCCTCAATGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG + Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1181498769 22:23303444-23303466 ACATCAGAGACCCCCCTGAATGG - Intronic
1184515575 22:44959988-44960010 ACAGCGGAGGGCCCGCTCTCTGG - Intronic
952969585 3:38642321-38642343 ACCTCGGAGGCCCACCTCTAGGG + Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
982084341 4:151818344-151818366 ACATCTGTGGGCCCCAGCAAGGG - Intergenic
985282488 4:188301098-188301120 ACAAGGGTGGGGCCCCTCAATGG - Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
997247894 5:132366729-132366751 ACATCACATGGACCCCTCAAAGG + Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1006393652 6:33773282-33773304 ACAACGGAGGGCCCCTTCAGTGG + Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1053415405 9:37944193-37944215 ACATCTCAGAGCCCCCTCCATGG - Intronic
1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG + Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1197221570 X:123919494-123919516 AAATCTGAGGGCCCCTTGAATGG - Intergenic