ID: 976629317

View in Genome Browser
Species Human (GRCh38)
Location 4:87220527-87220549
Sequence CAGGAGAGCGCGCGTCCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976629317_976629324 2 Left 976629317 4:87220527-87220549 CCCGGCGGACGCGCGCTCTCCTG 0: 1
1: 0
2: 1
3: 9
4: 74
Right 976629324 4:87220552-87220574 CGGCCCCGCGGAGCCCCGGCGGG 0: 1
1: 1
2: 1
3: 55
4: 283
976629317_976629323 1 Left 976629317 4:87220527-87220549 CCCGGCGGACGCGCGCTCTCCTG 0: 1
1: 0
2: 1
3: 9
4: 74
Right 976629323 4:87220551-87220573 GCGGCCCCGCGGAGCCCCGGCGG 0: 1
1: 0
2: 3
3: 33
4: 262
976629317_976629328 9 Left 976629317 4:87220527-87220549 CCCGGCGGACGCGCGCTCTCCTG 0: 1
1: 0
2: 1
3: 9
4: 74
Right 976629328 4:87220559-87220581 GCGGAGCCCCGGCGGGCGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 260
976629317_976629320 -10 Left 976629317 4:87220527-87220549 CCCGGCGGACGCGCGCTCTCCTG 0: 1
1: 0
2: 1
3: 9
4: 74
Right 976629320 4:87220540-87220562 CGCTCTCCTGCGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 129
976629317_976629322 -2 Left 976629317 4:87220527-87220549 CCCGGCGGACGCGCGCTCTCCTG 0: 1
1: 0
2: 1
3: 9
4: 74
Right 976629322 4:87220548-87220570 TGCGCGGCCCCGCGGAGCCCCGG 0: 1
1: 1
2: 4
3: 28
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976629317 Original CRISPR CAGGAGAGCGCGCGTCCGCC GGG (reversed) Exonic
901711758 1:11121210-11121232 CAGGAGAGCGCAGGTCTGCAGGG + Intronic
901825455 1:11858378-11858400 CAGGAGAGCCCCCGTCCCACAGG - Exonic
904199759 1:28812184-28812206 GAGGAGAGCGGGCGGACGCCGGG + Exonic
904560605 1:31394831-31394853 TAGGAGAGCGCGCGGGCTCCCGG + Intergenic
905308883 1:37036217-37036239 CAGCAGAGGGCGCGGCCTCCCGG + Intergenic
915323946 1:155070977-155070999 CGGGAGCGAGCGCGCCCGCCTGG - Intergenic
921707987 1:218345882-218345904 CGGGTCAGCGCGCGCCCGCCAGG + Intergenic
923119587 1:230978367-230978389 CAGGAGGGCGCGCGGCGGCGTGG + Intronic
1076618602 10:131772526-131772548 CAGGAGGGAGGGCGTCAGCCTGG + Intergenic
1076636628 10:131885389-131885411 CAGGAGCGCGGGCCTCGGCCCGG + Intergenic
1079689380 11:23403468-23403490 GACGGGAGCGCGCGCCCGCCTGG + Intergenic
1080386215 11:31812618-31812640 CAGGAGAGCGAGCGGCTGCCTGG + Intronic
1083970505 11:66070997-66071019 CAGGAGAGGGCGGGTCCCCGTGG - Intronic
1085641618 11:78196531-78196553 CAGGCGAGCGCGCGGGGGCCCGG - Exonic
1088914606 11:114217951-114217973 CAGGAGAGCGCTCCTCACCCTGG - Intronic
1089499897 11:118925754-118925776 CAGGCGTGCGGGCGTCCGGCCGG + Intronic
1090818114 11:130315858-130315880 GTGGAGAGCGCTCGCCCGCCTGG - Intergenic
1094536520 12:31326289-31326311 CGGGAGCGCGCGCGGTCGCCGGG - Exonic
1097004817 12:55908572-55908594 CAGGAGTGGGCCCGTGCGCCTGG - Intronic
1103577613 12:121890058-121890080 CAGGCGAGCGCCAGTACGCCAGG + Intronic
1106187800 13:27424536-27424558 CGGGAGATCGCGCATGCGCCAGG - Exonic
1113607479 13:111620722-111620744 CAGGAGAGGGCCCTGCCGCCGGG - Intronic
1118725804 14:68628392-68628414 CAGGAGAGTGCGCATGCGCGCGG - Intronic
1118808926 14:69260059-69260081 CCCGAGCGCGCGCGTCCCCCGGG - Exonic
1122629808 14:103102483-103102505 CAGGAGCGCGTGCGGCGGCCGGG + Exonic
1124629373 15:31327998-31328020 CAGGCGACCGCGCCCCCGCCGGG + Intronic
1127906746 15:63381765-63381787 CTGGAGAGCGAGCGGCCACCGGG - Exonic
1129742456 15:77996023-77996045 CAAGAGAGGGCGGCTCCGCCTGG - Exonic
1129843027 15:78755454-78755476 CAAGAGAGGGCGGCTCCGCCTGG + Intergenic
1130312096 15:82764926-82764948 CAGGAGAGGGCGCGGTCCCCTGG - Intronic
1131816139 15:96223247-96223269 CTGCAGAGCGCGTGTCAGCCCGG + Intergenic
1132552813 16:560364-560386 GAGGCGGGCGCGCGTGCGCCTGG - Intergenic
1132724470 16:1332992-1333014 CAGGAGACCGCGGGCCCGCTGGG + Intergenic
1133209208 16:4253804-4253826 CGAGAGAGCGCGCGGGCGCCAGG + Intergenic
1135298301 16:21301830-21301852 CTGAAGGGCGCGCGTCCACCCGG - Intronic
1135335647 16:21599391-21599413 AAAGGGAGCGCGCATCCGCCCGG - Intronic
1136523672 16:30814297-30814319 CAGGGGAACGTGCGTTCGCCAGG + Intergenic
1138214509 16:55191508-55191530 CAGGAGAGCGTGATTCTGCCAGG + Intergenic
1140504874 16:75464836-75464858 CAGGAGGGGGCGCGTCCGTGGGG - Intronic
1140512394 16:75517476-75517498 CAGGATAGCGCGCGTCCGAGGGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142264460 16:89057413-89057435 CAGGGGATCCCGCGTCCACCTGG - Intergenic
1150904935 17:69327146-69327168 CAGGAGCGCGCGGGTGCGCGCGG - Intronic
1154136656 18:11785750-11785772 CAGGAGAGGGGGCGTCAGACTGG - Intronic
1160859317 19:1230985-1231007 CAGGCGAGCGCGTGTCCACGGGG + Exonic
1162033186 19:7925997-7926019 CCTGAGAGAGCGCGGCCGCCGGG - Exonic
1166017882 19:39996975-39996997 CAGGCGCGCGCGCATCCGGCGGG - Intronic
931116889 2:59174768-59174790 CAGGCAACCGCGCGTCAGCCTGG + Intergenic
931870069 2:66446809-66446831 CTGGAGAGCGCAGGGCCGCCAGG + Intronic
944414915 2:199471086-199471108 CAGGAGAGAGCGCGTCAGCGGGG - Intronic
1173166378 20:40689495-40689517 CAGGCGAGCGTGCGTGGGCCGGG - Intergenic
1178334693 21:31732370-31732392 GAGCGGAGCGCGCGTGCGCCAGG - Intergenic
1178914535 21:36699223-36699245 CAGGAGAGCGCGCCCGGGCCAGG + Exonic
949987870 3:9553863-9553885 CTCGGGAGCGCGCCTCCGCCGGG - Intergenic
950316368 3:12004845-12004867 CGGGAGCGGGCGCGTCCACCAGG - Exonic
950527875 3:13535240-13535262 CAGGACAGCGTGTGTCCTCCAGG - Intergenic
958942953 3:100334960-100334982 CGGGAGTGCGCCCGGCCGCCCGG - Intronic
961603160 3:128076136-128076158 CAGAATAGCGCTGGTCCGCCGGG - Intronic
963888068 3:150603206-150603228 CAGGAGTGTGCGCGGGCGCCGGG + Intronic
968879917 4:3293368-3293390 CAGGAGGCCGCGCACCCGCCCGG - Intronic
976629317 4:87220527-87220549 CAGGAGAGCGCGCGTCCGCCGGG - Exonic
982573282 4:157076437-157076459 CAGGGCAGCGCGCGTCCTCCCGG - Intronic
984680898 4:182608518-182608540 CAGGAGAGCTCACGTGCGCTGGG + Intronic
985783815 5:1883940-1883962 CAGGGGAGGGCGCCTCCGCCAGG - Intronic
993646863 5:90473807-90473829 AACGAGAGCGCGCGCCCGCGGGG + Intronic
997608188 5:135191666-135191688 CAGGAGAGCCCGGGACGGCCTGG - Intronic
998199512 5:140108197-140108219 CAGGACAGCGCCCGCCCGCCCGG + Intronic
998517710 5:142770721-142770743 CCGGGGGGCGCGCCTCCGCCGGG - Exonic
1002638584 5:180619923-180619945 CAGGAGGCCGCGCATCCTCCCGG + Intronic
1005039309 6:21587468-21587490 CTGGGGCGCGCGCGTCTGCCAGG - Intergenic
1008885103 6:56424015-56424037 CAGGAGAGCACTCTTCTGCCAGG - Intergenic
1013220723 6:108074867-108074889 CTGGAGAGCGCGCGGCCGCAGGG - Intronic
1014019526 6:116571487-116571509 CGGGAGAGCGGGCGGCGGCCAGG - Exonic
1016010676 6:139135211-139135233 CCGGAGAGGGCGCGGCGGCCAGG + Exonic
1018995899 6:168710210-168710232 CAGGAGAGCGGACGTCCCCATGG - Intergenic
1019313879 7:375831-375853 CCCGAGAGAGCGCGTCCGTCAGG + Intergenic
1019639511 7:2095940-2095962 AAGGAGAGCGCGGGTCCGCGGGG + Intronic
1035431700 7:158828425-158828447 CCGGAGCGCGCGCTTCCTCCTGG - Intronic
1040587327 8:48756246-48756268 CCGGAGAGCGCGGGAGCGCCGGG + Intergenic
1047423896 8:124728529-124728551 CGCGAGAGCGCGCCTCCGCTTGG - Intergenic
1048456161 8:134580064-134580086 CAGGAGAGCAGGAGGCCGCCAGG + Intronic
1049195373 8:141312872-141312894 CAGTAGAGCCCGCGGGCGCCAGG + Intergenic
1049552723 8:143267849-143267871 CGGCACAGAGCGCGTCCGCCCGG - Intronic
1057832823 9:98419890-98419912 CAGGAGAGCGCGAGTCCTCCAGG + Intronic
1185501565 X:600469-600491 GAGGAGAGGGAGCGTCCGCCCGG + Intergenic