ID: 976629749

View in Genome Browser
Species Human (GRCh38)
Location 4:87224235-87224257
Sequence GCAAATGTTGGCCGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976629749_976629753 4 Left 976629749 4:87224235-87224257 CCACCGCGCCGGCCAACATTTGC 0: 1
1: 0
2: 2
3: 16
4: 179
Right 976629753 4:87224262-87224284 TAAGTCTTTATCTTTAATCCTGG 0: 1
1: 0
2: 0
3: 21
4: 284
976629749_976629754 5 Left 976629749 4:87224235-87224257 CCACCGCGCCGGCCAACATTTGC 0: 1
1: 0
2: 2
3: 16
4: 179
Right 976629754 4:87224263-87224285 AAGTCTTTATCTTTAATCCTGGG 0: 1
1: 0
2: 3
3: 21
4: 349
976629749_976629755 13 Left 976629749 4:87224235-87224257 CCACCGCGCCGGCCAACATTTGC 0: 1
1: 0
2: 2
3: 16
4: 179
Right 976629755 4:87224271-87224293 ATCTTTAATCCTGGGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976629749 Original CRISPR GCAAATGTTGGCCGGCGCGG TGG (reversed) Intronic