ID: 976629749 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:87224235-87224257 |
| Sequence | GCAAATGTTGGCCGGCGCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 198 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 179} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 976629749_976629753 | 4 | Left | 976629749 | 4:87224235-87224257 | CCACCGCGCCGGCCAACATTTGC | 0: 1 1: 0 2: 2 3: 16 4: 179 |
||
| Right | 976629753 | 4:87224262-87224284 | TAAGTCTTTATCTTTAATCCTGG | 0: 1 1: 0 2: 0 3: 21 4: 284 |
||||
| 976629749_976629754 | 5 | Left | 976629749 | 4:87224235-87224257 | CCACCGCGCCGGCCAACATTTGC | 0: 1 1: 0 2: 2 3: 16 4: 179 |
||
| Right | 976629754 | 4:87224263-87224285 | AAGTCTTTATCTTTAATCCTGGG | 0: 1 1: 0 2: 3 3: 21 4: 349 |
||||
| 976629749_976629755 | 13 | Left | 976629749 | 4:87224235-87224257 | CCACCGCGCCGGCCAACATTTGC | 0: 1 1: 0 2: 2 3: 16 4: 179 |
||
| Right | 976629755 | 4:87224271-87224293 | ATCTTTAATCCTGGGATAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 976629749 | Original CRISPR | GCAAATGTTGGCCGGCGCGG TGG (reversed) | Intronic | ||