ID: 976635360

View in Genome Browser
Species Human (GRCh38)
Location 4:87281807-87281829
Sequence GGGTGTTCCCAGAACTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976635360_976635366 -3 Left 976635360 4:87281807-87281829 CCATGACAGTTCTGGGAACACCC No data
Right 976635366 4:87281827-87281849 CCCATATTTGGGGTAAAAATGGG No data
976635360_976635368 0 Left 976635360 4:87281807-87281829 CCATGACAGTTCTGGGAACACCC No data
Right 976635368 4:87281830-87281852 ATATTTGGGGTAAAAATGGGTGG No data
976635360_976635364 -4 Left 976635360 4:87281807-87281829 CCATGACAGTTCTGGGAACACCC No data
Right 976635364 4:87281826-87281848 ACCCATATTTGGGGTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976635360 Original CRISPR GGGTGTTCCCAGAACTGTCA TGG (reversed) Intergenic
No off target data available for this crispr