ID: 976638684

View in Genome Browser
Species Human (GRCh38)
Location 4:87313889-87313911
Sequence CTTCAGGCCTTGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976638684_976638688 12 Left 976638684 4:87313889-87313911 CCAGTTTTTCCCAAGGCCTGAAG 0: 1
1: 0
2: 0
3: 15
4: 211
Right 976638688 4:87313924-87313946 ACCTCTGTGAAAGCCAACAGCGG 0: 1
1: 0
2: 2
3: 17
4: 181
976638684_976638690 24 Left 976638684 4:87313889-87313911 CCAGTTTTTCCCAAGGCCTGAAG 0: 1
1: 0
2: 0
3: 15
4: 211
Right 976638690 4:87313936-87313958 GCCAACAGCGGCAAATTTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976638684 Original CRISPR CTTCAGGCCTTGGGAAAAAC TGG (reversed) Exonic
900120235 1:1045717-1045739 CTGCAGGCTTTGGGGAAAATCGG - Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902798630 1:18815740-18815762 CTTGAAGCCTTGGGGAAACCAGG + Intergenic
903014422 1:20352698-20352720 CCTCAGGGCTTGGGAAACAGAGG + Intronic
903096584 1:20981209-20981231 TTTGAGGCCTCTGGAAAAACTGG + Exonic
904671902 1:32172283-32172305 CTTCAGGTCCTGGGACAATCAGG - Exonic
906251606 1:44314934-44314956 CTTCATGCCTGAGGCAAAACAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907934817 1:59032781-59032803 CTTGAGGCCTGGGGAAATATGGG - Intergenic
909030022 1:70528712-70528734 CTCAAGGACATGGGAAAAACTGG - Intergenic
912280493 1:108308083-108308105 CTACAGGCCATGGGGAATACTGG + Intergenic
912287733 1:108386274-108386296 CTACAGGCCATGGGGAATACTGG - Intronic
916185891 1:162132501-162132523 CTTCAGGTCTAGTGAAACACAGG + Intronic
916295923 1:163219987-163220009 GTTCAGGCATTCTGAAAAACTGG - Intronic
916886991 1:169079279-169079301 CTTCCAGCCTTTGGAGAAACAGG + Intergenic
919584132 1:199415538-199415560 CTCCAGGGCTTGGGACAAGCAGG - Intergenic
919787818 1:201271109-201271131 TTTCAGGCCTTGGCAACAATGGG - Intergenic
919866029 1:201783609-201783631 CTCCAGGCCCTGGGAGAAGCTGG - Exonic
920227941 1:204451389-204451411 CTTCAGTCCTTGGGTATATCTGG + Intronic
924129206 1:240888473-240888495 CTCCAGGCCTTAGGAAAAGCCGG - Intronic
1064138488 10:12770800-12770822 CTTCAGGCTTTCGCACAAACTGG - Intronic
1065811629 10:29448511-29448533 CTTCAGGCCCTTGGAAAATCGGG + Intergenic
1065960156 10:30727635-30727657 CTTCAGGCCCTTGGAAAATCAGG - Intergenic
1066278738 10:33893768-33893790 CTTCAACCCTTGGGAAAAGAAGG + Intergenic
1066804232 10:39227938-39227960 TTTGAGGCCATTGGAAAAACTGG + Intergenic
1066814250 10:39383441-39383463 TTTGAGGCCTATGGAAAAACAGG - Intergenic
1069255016 10:66322198-66322220 CTTCTGGCTTTGAGAATAACTGG + Intronic
1075736714 10:124668901-124668923 CATCAGGCCTTGGGAAGGAGTGG - Intronic
1076429070 10:130388958-130388980 CGGCAGGCCTGGGGAGAAACAGG - Intergenic
1077997831 11:7469161-7469183 GATCAGACCTTGGGAAAAGCTGG + Intergenic
1078422505 11:11224070-11224092 GCTCAGGCCTTGGGAAGAGCAGG - Intergenic
1078471284 11:11588913-11588935 CATCAGGCCTGGGCAAAAACAGG - Intronic
1081731274 11:45373411-45373433 CAACAGGCTTTGAGAAAAACTGG - Intergenic
1083840629 11:65302214-65302236 CTTCAGCCCCTGGGAAGATCTGG - Intronic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1086177322 11:83907005-83907027 CTGCAGACCTTGGAAGAAACTGG - Intronic
1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG + Intergenic
1089595139 11:119573814-119573836 CTGCAGGCCCTGGGAAATGCAGG + Intergenic
1090188356 11:124752378-124752400 CTTCAGACCTTGGGGAGAAGAGG - Intergenic
1090868701 11:130724329-130724351 CTTGAGGCTGTGGGAAACACAGG - Intergenic
1092655071 12:10675257-10675279 CTTCAGGGCTTTTTAAAAACAGG + Intergenic
1094863935 12:34505906-34505928 CTTCAGCTGTTTGGAAAAACTGG - Intergenic
1095064755 12:37757006-37757028 TTTCAGGCCTATGGAAAAATAGG + Intergenic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1097199026 12:57262508-57262530 GTTCAGGCCTGGGGGTAAACAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098979500 12:76939756-76939778 CTTCAGGCCTTGTCAAGAAGAGG + Intergenic
1100343714 12:93706579-93706601 CTTCAGGCCCTGTGAATAAGTGG - Intronic
1100451116 12:94707206-94707228 CTACAGCCCTTATGAAAAACAGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102192612 12:111000236-111000258 CTTCAGGGGTTGGGAAATAGAGG + Intergenic
1104625741 12:130352773-130352795 CTTAAGGCCTTGGGTGAAATAGG + Intronic
1105070874 12:133233961-133233983 CCCCAGGCCTTGGAAAAACCTGG - Intronic
1107000025 13:35532770-35532792 CTTCAGGCCTTGGGGATGATGGG + Intronic
1107000361 13:35537148-35537170 GATCAGGCCTTCTGAAAAACTGG + Intronic
1109249175 13:59997685-59997707 CTGTCGGCCTTTGGAAAAACTGG - Intronic
1109605376 13:64687710-64687732 CTTCAGACCTTGAGAAACACAGG + Intergenic
1110108497 13:71711153-71711175 CTTCATGCACTGGGAAAATCTGG + Intronic
1111058765 13:82984221-82984243 GTTCAGGACTTTGGAAAAAATGG - Intergenic
1112494364 13:99893752-99893774 CTACAGACCTGGGGAAAAGCAGG + Exonic
1113294981 13:108949255-108949277 CATCAGGCTTTGTGAAAAAGGGG + Intronic
1113408311 13:110062220-110062242 CCTGAGGCCTTGGTAAAACCAGG + Intergenic
1116793680 14:49366558-49366580 CTCAAGTCCTTGAGAAAAACAGG - Intergenic
1118913277 14:70079703-70079725 CCTCAGTCCTTGAGAAACACAGG + Intronic
1120958779 14:90105882-90105904 GTCCAGGCCTTGGCAAAAGCAGG + Intronic
1121422582 14:93825594-93825616 CTTCTGCCCTTGGGAGACACTGG + Intergenic
1123770700 15:23525559-23525581 CTTCAGGCTTTTGGAAATTCTGG + Intergenic
1124169218 15:27357954-27357976 CTTCAGGCATTGGAAAATATTGG + Intronic
1124892314 15:33744683-33744705 CTGCCGGCCTTGGGAACAGCAGG + Intronic
1125349963 15:38756161-38756183 CTCCGGGCCTTGGGAAGAACTGG - Intergenic
1125428499 15:39573443-39573465 CTTCAAGTCTTGGGACAAAGAGG + Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1126564937 15:50085087-50085109 CTGAAGGCCTTGGTAACAACTGG - Intronic
1131126528 15:89862798-89862820 CTTCAGGCTGTTGGAAATACAGG + Intronic
1137241610 16:46659465-46659487 CATCATGCCTTGGGAAAAGCAGG + Exonic
1140156232 16:72429556-72429578 CTACAGCTCTTGGGACAAACAGG + Intergenic
1143013144 17:3877285-3877307 CCCCAGGCCTTGGGACAAGCAGG + Intronic
1144452257 17:15390873-15390895 ATTGAGGCCTTGGAAACAACAGG + Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1147056446 17:37838855-37838877 CTCCACGCCTTGGGACAGACTGG + Intergenic
1148458942 17:47826773-47826795 CTTCAGGACCTGGGAACAGCAGG + Exonic
1148834730 17:50460102-50460124 CTACAGGCCTGTGGAATAACAGG + Intronic
1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG + Intronic
1151312884 17:73305001-73305023 CTTCAGGCCAGGGGAGAAGCAGG + Intronic
1159407152 18:68018866-68018888 ATTAAGGCTTGGGGAAAAACAGG + Intergenic
1161178417 19:2862724-2862746 CTTAAGGACTTGGGAAAATATGG - Intergenic
1161309028 19:3583754-3583776 CTCCAGTCCTGGGGACAAACAGG + Intergenic
1164075746 19:21816574-21816596 CTCCAGGCCTTTTGAAGAACAGG - Intronic
1167832686 19:52038945-52038967 CTTCCAGCCTTTGGAAAAACTGG + Intronic
1168264510 19:55214887-55214909 CATCAAGCCTTGGAAAACACAGG + Intergenic
1168416420 19:56172020-56172042 CCCCAGGCATTGGGAAACACCGG - Intergenic
926197451 2:10772441-10772463 CTTCAGGCCTTCAGGAAAAGGGG + Intronic
927258326 2:21060240-21060262 CTTCAGACCTAGGGAAGACCAGG + Intergenic
929277632 2:40042976-40042998 CTTCCTACCTTGGGAGAAACCGG - Intergenic
929454507 2:42056252-42056274 CTCCAGGCAGTGGGAAAGACAGG + Intronic
929994821 2:46818653-46818675 CTTCAGGCCCTGGGCAAATGTGG + Intronic
932771433 2:74502857-74502879 CATCAAGCCCTGGGAAAGACTGG + Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935219915 2:101003225-101003247 ATTCAGGCATAGGGAAAAAAAGG - Intronic
936641406 2:114316113-114316135 ATTCAGGCTGTGGGAAAAAATGG - Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
942123435 2:172801087-172801109 TTTCAAGCCTTTGGTAAAACAGG - Intronic
943284781 2:185983694-185983716 CTTTAGCCCTTGGGAAAGTCTGG + Intergenic
944459798 2:199935975-199935997 CTTCTAGCCTTGGAAAAAAGTGG + Exonic
944731039 2:202517772-202517794 GTTCTGGCCTTGGGAAACTCAGG - Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
1174983432 20:55422677-55422699 ATTCATGTCTTGAGAAAAACAGG + Intergenic
1176388134 21:6149890-6149912 CTCCAGGCCTTGGGAAGACGCGG + Intergenic
1177363921 21:20109201-20109223 CTTTAGGCCATTGGAAATACTGG + Intergenic
1179735338 21:43388358-43388380 CTCCAGGCCTTGGGAAGACGCGG - Intergenic
1179943709 21:44656045-44656067 CTTAAGGCCTAGGGACAAGCCGG + Intronic
1179946941 21:44684992-44685014 CTTAAGGCCTAGGGACAAGCCGG - Intronic
1181169022 22:20997971-20997993 CTTCAGCCCCTGTGAAAACCAGG - Exonic
1183008859 22:34928362-34928384 CATTAGGCCTTTGGAAATACTGG - Intergenic
1183826794 22:40394670-40394692 CTTCTAGCCATGGCAAAAACTGG - Intronic
1184642565 22:45880242-45880264 CCTCAGGCCCTGGGAACAGCAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951777510 3:26325918-26325940 CTCCAGGGCTTGGGAGAAACAGG - Intergenic
951964961 3:28371820-28371842 CTCCAGGCCTAGGGGAAAAGAGG + Intronic
953918142 3:46933671-46933693 CTTAAGGCGTTAGAAAAAACTGG + Intronic
955157730 3:56433687-56433709 CTTCATGCCACAGGAAAAACAGG - Intronic
955541394 3:59980399-59980421 CTTCAGGAACTGGGCAAAACTGG - Intronic
956678806 3:71759129-71759151 CTGTAGGCCTTGGGAAAACAGGG - Intergenic
960307471 3:116079290-116079312 CTTCAGGCCTTGGTACAGATTGG + Intronic
961715106 3:128852561-128852583 CTTCTGGCCTTGGGAATATGTGG + Intergenic
962676380 3:137761454-137761476 CTTCAGGCCGTGGACAAAGCAGG + Intergenic
962894966 3:139705815-139705837 CTTCAGGCCTTGGACAGAATTGG - Intergenic
963377044 3:144480658-144480680 CTTCAGGCATTGTGAAAATGAGG + Intergenic
963687027 3:148449029-148449051 TTTCAGTACTTGGGAAAAATAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966541880 3:181101128-181101150 CTTAAGTCCTTGGGACAAGCAGG + Intergenic
966552338 3:181219225-181219247 GTCCAGGCCTTGGGCAAATCTGG + Intergenic
966644400 3:182227221-182227243 CTTCAGTACGTGGGAAGAACAGG + Intergenic
966672360 3:182541477-182541499 ATTCAGGCTTTGGGAAGAATAGG + Intergenic
966816414 3:183893408-183893430 CTTCAGGCTTTGTGAAATCCTGG - Intergenic
968718247 4:2177949-2177971 TACCAGGCCTTGGGAAGAACAGG - Intronic
969210106 4:5680905-5680927 CTGCAGGCTTTGGGAAGATCTGG + Intronic
970421705 4:15911083-15911105 GTTCAGGCTTAGGGAAACACAGG + Intergenic
976047537 4:80968883-80968905 ATTCTGGACTTGGGAAAAAGTGG - Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
976972650 4:91125887-91125909 CTACAGGCCTAGTGAAAGACTGG + Intronic
977095639 4:92740252-92740274 CTTCAGTCCTTGTGACACACAGG - Intronic
977862214 4:101976119-101976141 CTTCAGATCTTTGGACAAACTGG - Intronic
978373198 4:108049919-108049941 CTTCAGGCTTTTGGAAAGAGAGG + Intronic
979568843 4:122191514-122191536 CATCATGCATTGGGAAATACGGG - Intronic
981019914 4:140015331-140015353 CTTCAGGACTTATGCAAAACAGG - Intronic
981884043 4:149651267-149651289 CTTGAGACCTTGGGAAAATGTGG - Intergenic
982163707 4:152595306-152595328 CTCCAAGCCTTGGGAAGAATTGG + Intergenic
983833248 4:172358208-172358230 CTTGAGGCCTTGCAAAGAACTGG + Intronic
984580037 4:181501127-181501149 CTTCAGGACTTGGCTAAAAGTGG + Intergenic
985546827 5:514159-514181 CTTCAGATCTTGAGAAAACCAGG + Intronic
985790731 5:1925748-1925770 CCCCAGGTCTTGGGAACAACAGG - Intergenic
986949568 5:13066422-13066444 CTTCAGGCCATGATAGAAACGGG - Intergenic
987204124 5:15607607-15607629 CTTCAAGCCTTAGGAAAACCTGG + Intronic
988203266 5:28097584-28097606 CTTCAGGCATTGAGAAACTCAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
992488731 5:77220283-77220305 CTTCATCCCTTGGGAGGAACAGG + Intronic
993087267 5:83378518-83378540 CTTCAGCCATTGGGAAATGCTGG - Intergenic
993775177 5:91985496-91985518 CTTTAGTACTTTGGAAAAACGGG - Intergenic
995002392 5:107149926-107149948 CTTCATGTCTGGAGAAAAACTGG + Intergenic
997214750 5:132101403-132101425 ATGCAGGCCTTTGGAAAAAGAGG + Intergenic
997619457 5:135276126-135276148 CTTCAAGGCCTGGGAAGAACAGG - Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000027086 5:157368689-157368711 TATCAGGACTTGGGAAAAAATGG + Intronic
1000129033 5:158276942-158276964 CTTCAGGCCTTGGTTCACACTGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1003874937 6:10426601-10426623 CTCCAGGCAGTGGGAAAACCGGG - Intergenic
1004571155 6:16846610-16846632 CTTCTGCCCTAGGGAAAAAATGG - Intergenic
1004878046 6:19976074-19976096 CTCCAGGCCTTGGGGGAAAATGG - Intergenic
1006810571 6:36817869-36817891 CTCCAGGCCTTGGGAGGAAGGGG - Intronic
1007804314 6:44428426-44428448 CTTCATGGCTTATGAAAAACTGG - Intronic
1008467633 6:51848331-51848353 CTTCAAGTCGTGGGAAAAGCTGG - Intronic
1014969525 6:127797166-127797188 CTTAGGGCCTTGGGAGAAAGTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1021948788 7:25754130-25754152 AGTCAGGCCTTGGGGAAAGCGGG - Intergenic
1022051848 7:26682641-26682663 CTTCAAGCCTTGCAAAACACTGG + Intronic
1023754439 7:43402818-43402840 CTCCAGGCAGTGGTAAAAACAGG - Intronic
1025501117 7:61299389-61299411 CTTGAGGCCTATGGAGAAACGGG - Intergenic
1025515977 7:61645612-61645634 CTTGAGGCCTATGGAGAAACGGG - Intergenic
1025540315 7:62074438-62074460 CTTGAGGCCTATGGAGAAACGGG - Intergenic
1025571731 7:62581005-62581027 TTTCAGGCCTTTGGTGAAACAGG - Intergenic
1025589361 7:62836864-62836886 CTTCAGGACTATGGCAAAACAGG + Intergenic
1025595495 7:62919205-62919227 CTTCAGGCCTATGGAGAAAAAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025791748 7:64694229-64694251 CTCCAGGCCTCTGGAAAGACAGG + Intronic
1030088146 7:105834938-105834960 CTTTTAGCCCTGGGAAAAACTGG - Intronic
1031405534 7:121381219-121381241 CTTCTTGGCTTGTGAAAAACTGG - Intronic
1034627492 7:152504618-152504640 CCTATGGCCTTGGGGAAAACTGG + Intergenic
1034706776 7:153152650-153152672 CTTCAGCCCTGGGGAGAATCTGG + Intergenic
1038435119 8:27530228-27530250 CTTCAGGCCATGGGGACAGCTGG + Intronic
1039868198 8:41524030-41524052 CTTCATGCATTCAGAAAAACCGG + Intergenic
1041143682 8:54848325-54848347 CTTCAGGCCCCAGGAAGAACAGG - Intergenic
1042296189 8:67220812-67220834 CTTTGGGCCCTGGAAAAAACAGG - Intronic
1043130846 8:76459118-76459140 CTTCAGGTTCTGGGTAAAACTGG - Intergenic
1043558892 8:81467510-81467532 CTACAGGGCTTAGGAAAGACTGG + Intergenic
1045126623 8:99098237-99098259 CTTCAGTCACTGGGAAAGACAGG + Intronic
1046900069 8:119514375-119514397 CTTCAGGCAGTGGGAATATCTGG + Intergenic
1047355947 8:124121790-124121812 TTTCAGCATTTGGGAAAAACAGG - Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1050296290 9:4208744-4208766 CATAAGGCTTTGGGCAAAACTGG - Intronic
1050580135 9:7045563-7045585 CTAGAGGCCTTTGGAATAACTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056778181 9:89529271-89529293 TCACAGGGCTTGGGAAAAACAGG - Intergenic
1056903403 9:90622866-90622888 CCCCAGGCTTTGGGAAAAATTGG - Intronic
1059418275 9:114175348-114175370 CTTCAGGCCCTGGAAAGAAATGG + Intronic
1060146777 9:121259871-121259893 CTTCAGCTCTAGGGAAAAACAGG + Intronic
1061698388 9:132395545-132395567 CCTCAGGATTGGGGAAAAACAGG + Intronic
1187705547 X:22006116-22006138 CTTCAGCCCTTAGGAGAACCAGG - Intergenic
1188979216 X:36712175-36712197 TTTCAAGCCTAGGGAAGAACAGG + Intergenic
1189025631 X:37390822-37390844 CTTCAGGCATGGATAAAAACTGG + Intronic
1189845262 X:45130560-45130582 CTTAAGGCCATGGGAAACATAGG - Intergenic
1189908914 X:45790016-45790038 GTTGCGGCCCTGGGAAAAACAGG - Intergenic
1190508616 X:51154577-51154599 CTTTCGGCCTTGGGCAAAAGGGG + Intergenic
1192950582 X:76012048-76012070 CTTCAGAAGTTGGGAGAAACAGG + Intergenic
1194444142 X:93966522-93966544 CTCCAGAGCTTGGGAGAAACAGG + Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1195581424 X:106507932-106507954 CTAAAGCCCTTTGGAAAAACTGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic