ID: 976638983

View in Genome Browser
Species Human (GRCh38)
Location 4:87317650-87317672
Sequence CTTTGTGAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976638983_976638989 11 Left 976638983 4:87317650-87317672 CCTTCCACCTTGGCCTCACAAAG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
Right 976638989 4:87317684-87317706 CATGTGTGAACCACCGCACCTGG 0: 2
1: 192
2: 5512
3: 35168
4: 102805
976638983_976638992 24 Left 976638983 4:87317650-87317672 CCTTCCACCTTGGCCTCACAAAG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
Right 976638992 4:87317697-87317719 CCGCACCTGGTCTAAAGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976638983 Original CRISPR CTTTGTGAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr