ID: 976651364

View in Genome Browser
Species Human (GRCh38)
Location 4:87438503-87438525
Sequence CTGCACAATAACCCTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976651362_976651364 21 Left 976651362 4:87438459-87438481 CCAGATGTTGTACAAATTTATTT 0: 1
1: 0
2: 4
3: 40
4: 428
Right 976651364 4:87438503-87438525 CTGCACAATAACCCTGTTGGTGG 0: 1
1: 0
2: 1
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976651364 Original CRISPR CTGCACAATAACCCTGTTGG TGG Intronic
901682047 1:10918841-10918863 CTGCACATTCAACCAGTTGGGGG + Intergenic
903380421 1:22892921-22892943 CTGCACGGTGACCGTGTTGGTGG - Exonic
905189937 1:36225479-36225501 CTCCACAATAACCCTGTAAAGGG - Intronic
906010926 1:42524843-42524865 CTAAACAATAATCCTGCTGGTGG - Intronic
908281067 1:62535542-62535564 CTGCCAAATAATGCTGTTGGCGG + Exonic
908916701 1:69135929-69135951 ATGCAAAATAACCCAGATGGTGG - Intergenic
910938954 1:92512395-92512417 CTGTTCAAAAACACTGTTGGTGG - Exonic
911268720 1:95775092-95775114 ATGGACAACAAACCTGTTGGTGG - Intergenic
911558881 1:99379987-99380009 CTGCAAAAGAATCATGTTGGGGG + Intergenic
912383618 1:109260633-109260655 GTGCACATTTACCCTCTTGGGGG + Intronic
913014418 1:114718204-114718226 CTGCACCAAACCCCTGTGGGGGG + Exonic
913320094 1:117582079-117582101 CTTCACACCAACCCTGTAGGAGG + Intergenic
915251955 1:154596886-154596908 CTGAACACCAACCCTGTGGGTGG - Exonic
916313351 1:163420794-163420816 CAGCATAATTATCCTGTTGGGGG + Intergenic
920970627 1:210740858-210740880 CTTCACAATCACCGTGATGGAGG + Intronic
921809499 1:219496548-219496570 CTGCTCCATAAACCTCTTGGTGG + Intergenic
922806351 1:228391919-228391941 CTGCACAACAACCCTGTCTTTGG + Intergenic
1067998664 10:51305397-51305419 CTGCACAGAAAAGCTGTTGGGGG + Intronic
1068048021 10:51912450-51912472 CTGCAAAATAACCCAGGTGAGGG + Intronic
1069035557 10:63642581-63642603 CTACACCTTACCCCTGTTGGTGG - Intergenic
1078667820 11:13340895-13340917 CTGCACAACAACCCAGTGCGGGG + Intronic
1079451272 11:20601552-20601574 CGGAACAATACCCCTGTTGTGGG + Exonic
1080602159 11:33830427-33830449 CTGCCCAATAACCCCACTGGAGG - Intergenic
1080729501 11:34935009-34935031 CTTCAGAATAACCCTGGTTGAGG + Intronic
1082026660 11:47577736-47577758 CAGCACAATCACCCGGTTGTGGG + Exonic
1084530105 11:69722151-69722173 CTGCACAACTACACAGTTGGTGG + Intergenic
1088124365 11:106405514-106405536 CTGGACTATAACCTTGTGGGAGG - Intergenic
1088738734 11:112749445-112749467 CTGCACAACAGCCCAGATGGTGG - Intergenic
1091862315 12:3796954-3796976 CTGCATAATAACCCTCTCAGGGG + Intronic
1092611921 12:10181692-10181714 AATCACAATAACCCTCTTGGTGG - Intronic
1096846813 12:54411952-54411974 CAGCACACTGACCCTGTGGGGGG + Exonic
1098339679 12:69439096-69439118 GTGCACAATAACCCTGTAACAGG + Intergenic
1101364019 12:104054930-104054952 CTCCACCATTACCCTATTGGAGG - Intronic
1103867921 12:124068111-124068133 CTGCAAAATACCCCTTTTAGAGG + Intronic
1104439379 12:128782404-128782426 CTGCACAATTTCGTTGTTGGAGG + Intergenic
1108698184 13:52921128-52921150 CTGCACAATAACTCCATTGAGGG - Intergenic
1108930661 13:55814150-55814172 CTTCAGAATAACCCAGTTTGTGG + Intergenic
1113151459 13:107268534-107268556 CTGCAAGATAATACTGTTGGAGG + Intronic
1113339642 13:109409568-109409590 CTGCACAGTCAGCCTGTTTGTGG - Intergenic
1113622949 13:111776241-111776263 CTGCACTTTAACCCTTGTGGTGG + Intergenic
1115824300 14:37249277-37249299 CTGAACAGGAGCCCTGTTGGGGG - Intronic
1115896108 14:38089292-38089314 TTGCACAATAACTCTTTTGGAGG + Intergenic
1116739483 14:48736053-48736075 CTGCACAATAAGCATGGTTGGGG + Intergenic
1119608487 14:76041899-76041921 ATGCACTATTCCCCTGTTGGTGG + Intronic
1119626528 14:76181738-76181760 CTGCATAACAGCCCTGTAGGGGG - Intronic
1121607311 14:95250704-95250726 CTGCAGATTAACTCTATTGGAGG + Intronic
1122060763 14:99135303-99135325 CTGCAGAATGATGCTGTTGGAGG - Intergenic
1122462583 14:101907762-101907784 CTGCACAGTCACCCTGCTGCCGG + Intronic
1202866660 14_GL000225v1_random:124033-124055 CTTCATAATACCCCTGTAGGTGG - Intergenic
1126580209 15:50235952-50235974 CCGCAAAATGACCCTGGTGGAGG + Exonic
1127327126 15:57906601-57906623 TTTTACAAAAACCCTGTTGGTGG + Intergenic
1130895929 15:88170513-88170535 CCTCACAATAACCCTGTAGGGGG + Intronic
1132613272 16:828276-828298 CTTTACAACAACCCTGTTGTAGG - Intergenic
1133598983 16:7320819-7320841 CCGCACAACAACCCTGTAAGGGG + Intronic
1135325274 16:21521667-21521689 CTGAACAATAGCCGTGGTGGAGG + Intergenic
1136336760 16:29614935-29614957 CTGAACAATAGCCGTGGTGGAGG + Intergenic
1142037485 16:87870719-87870741 CTGAACAATAGCCGTGGTGGAGG + Intergenic
1148821697 17:50363739-50363761 CTGCACAATAACTGCTTTGGAGG + Intergenic
1155610040 18:27656453-27656475 CTGAACAATAACACTTTTGTAGG - Intergenic
1156390336 18:36644513-36644535 CAGCACAATGACCCACTTGGAGG - Intronic
1160050764 18:75431208-75431230 CTGCACCGTGACCCTGTTTGTGG + Intergenic
1166186233 19:41140975-41140997 CTTCAAAACAACCCTGTGGGTGG - Intergenic
927769844 2:25850101-25850123 CTTCAGAATAACCCAGTTTGTGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
931663546 2:64592909-64592931 ATGCACATTAACCTTGTTAGAGG - Exonic
936011193 2:108926498-108926520 CTGCACACCAACACGGTTGGAGG - Intronic
937015951 2:118605646-118605668 CTGCACCCTAACCCTTTTTGGGG - Intergenic
942483568 2:176415825-176415847 CTGCACCATGACACTCTTGGAGG - Intergenic
946001794 2:216488588-216488610 CTGCACCAAAACTCTGGTGGGGG - Intergenic
948382146 2:237558303-237558325 CTGCACATTTACCATGTTGAGGG + Intergenic
1168806180 20:673607-673629 CTGCAGAAACACCCTGCTGGTGG + Intronic
1169046267 20:2536684-2536706 CTGCCCAGGAACCCTGTGGGCGG - Intronic
1170089961 20:12579909-12579931 CTGCACAAAATGCCTGTTGAGGG - Intergenic
1172188168 20:33044435-33044457 CTACACAATAACTCTATTGGTGG + Intergenic
1172290721 20:33774435-33774457 CTGCACTATTAACCTCTTGGTGG + Intronic
1174172011 20:48623677-48623699 CTGCCCAATAGGCCTGTTTGTGG + Intergenic
1178483372 21:33000262-33000284 GAGGACAATAACCCTCTTGGAGG - Intergenic
1178804495 21:35827250-35827272 CAGGACAATAAGCCTGGTGGAGG + Intronic
956207992 3:66773647-66773669 CTGCACAATGACACTGTTCTAGG - Intergenic
957206821 3:77209679-77209701 TTGCACAAAAACCATGTTTGTGG + Intronic
959243115 3:103825357-103825379 CTGCACAATAACCTTTTTAATGG - Intergenic
967399633 3:189046247-189046269 CTGGACAACATCTCTGTTGGTGG + Intronic
974573563 4:63687717-63687739 CTGTGCAAGAACCCTCTTGGTGG - Intergenic
976221148 4:82757735-82757757 CTTCACAATACCTCTGATGGAGG - Intronic
976313843 4:83638437-83638459 CTGGACAAGAACCCTGTTTAGGG + Intergenic
976651364 4:87438503-87438525 CTGCACAATAACCCTGTTGGTGG + Intronic
993694206 5:91041017-91041039 TTGCCCAATTACACTGTTGGTGG + Intronic
998005319 5:138653054-138653076 CTTCACAATAACCCTGAAGCAGG - Intronic
999038977 5:148385596-148385618 CAGCACCATCATCCTGTTGGGGG + Intronic
999657931 5:153828836-153828858 CTGCACACTAATGCTCTTGGGGG - Intergenic
1000099395 5:158000757-158000779 CTGCACAATGACCTTGTTGGGGG + Intergenic
1002366907 5:178720031-178720053 CTGCACATAAACCATGATGGGGG + Intronic
1004555056 6:16688638-16688660 TTGCACAATTACCCTGTTTTGGG - Intronic
1009758912 6:67978456-67978478 CAACACAATAAACCTGTTGCTGG - Intergenic
1011392337 6:86867766-86867788 CAGCTCAATAACTCTGGTGGGGG - Intergenic
1015439564 6:133232610-133232632 CTGTATCATAACCCTGGTGGAGG + Intergenic
1015915390 6:138210940-138210962 CCTCACCCTAACCCTGTTGGTGG + Intronic
1020014066 7:4820839-4820861 CTGCACAGTGACCCTGTGGTGGG - Intronic
1026075505 7:67163464-67163486 CTGCACACTAACCAAGTTGCCGG + Intronic
1026701349 7:72648747-72648769 CTGCACACTAACCAAGTTGCCGG - Intronic
1030956773 7:115862781-115862803 CTGCACAATAACCCACTTTTGGG - Intergenic
1033056322 7:138058307-138058329 CTCCACAATTATCCTGTTGCTGG + Intronic
1035893893 8:3375611-3375633 CTGCACAAGATTCCTTTTGGTGG - Intronic
1040978037 8:53215430-53215452 GTGCACAATAGCCCTGTGTGGGG + Intergenic
1041192394 8:55366775-55366797 CTGCTCAATCACCCTGTTCTTGG + Intronic
1047172677 8:122509251-122509273 TTACACAATAACTCTGTTTGTGG - Intergenic
1048856407 8:138690042-138690064 CTGCACAGCAACCCTGCTGGAGG - Intronic
1048900272 8:139030886-139030908 TTGCACAATTACCCTATTGATGG + Intergenic
1051934463 9:22429320-22429342 ATGCACAATAACCCTGTCAGAGG + Intergenic
1055226822 9:74007090-74007112 CTTTATAATAACCCTGTGGGTGG - Intergenic
1058479877 9:105381165-105381187 TTGCACATTCACCCTCTTGGAGG - Intronic
1058762548 9:108149172-108149194 CTTCCCAATAATCCTTTTGGAGG - Intergenic
1060112605 9:120917444-120917466 CCTCACAATAACCCTGTAAGGGG - Intronic
1203455460 Un_GL000219v1:163124-163146 CTGCAGAACACCCCTGTTGTGGG - Intergenic
1192055477 X:67769141-67769163 TGGCTCAATAACCCTGGTGGGGG - Intergenic
1193585175 X:83311991-83312013 CAGCACAATCACAGTGTTGGTGG + Intergenic
1198393970 X:136205008-136205030 TAGCACAATAACCATGTTTGTGG + Intronic
1199049594 X:143221472-143221494 CTGCACAAGAAGCATGATGGTGG - Intergenic