ID: 976654142

View in Genome Browser
Species Human (GRCh38)
Location 4:87469718-87469740
Sequence CTATTTCAACACCTCTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976654142_976654144 9 Left 976654142 4:87469718-87469740 CCTATTTAGAGGTGTTGAAATAG No data
Right 976654144 4:87469750-87469772 TAAATCCTGCCTCCAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976654142 Original CRISPR CTATTTCAACACCTCTAAAT AGG (reversed) Intergenic
No off target data available for this crispr