ID: 976660457

View in Genome Browser
Species Human (GRCh38)
Location 4:87535243-87535265
Sequence TCTGAAATGGAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976660449_976660457 24 Left 976660449 4:87535196-87535218 CCAGTTACCTCTCCCCAAATACA No data
Right 976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG No data
976660451_976660457 17 Left 976660451 4:87535203-87535225 CCTCTCCCCAAATACAATGGCAT No data
Right 976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG No data
976660452_976660457 12 Left 976660452 4:87535208-87535230 CCCCAAATACAATGGCATAGTAT No data
Right 976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG No data
976660453_976660457 11 Left 976660453 4:87535209-87535231 CCCAAATACAATGGCATAGTATA No data
Right 976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG No data
976660454_976660457 10 Left 976660454 4:87535210-87535232 CCAAATACAATGGCATAGTATAA No data
Right 976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976660457 Original CRISPR TCTGAAATGGAGAAAATGGA AGG Intergenic
No off target data available for this crispr