ID: 976660501

View in Genome Browser
Species Human (GRCh38)
Location 4:87535544-87535566
Sequence CCACGGCCAAGGTGTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976660495_976660501 -2 Left 976660495 4:87535523-87535545 CCAGTTCTAGAGGCTGGAAATCC No data
Right 976660501 4:87535544-87535566 CCACGGCCAAGGTGTCAGGAGGG No data
976660493_976660501 2 Left 976660493 4:87535519-87535541 CCTCCCAGTTCTAGAGGCTGGAA No data
Right 976660501 4:87535544-87535566 CCACGGCCAAGGTGTCAGGAGGG No data
976660494_976660501 -1 Left 976660494 4:87535522-87535544 CCCAGTTCTAGAGGCTGGAAATC No data
Right 976660501 4:87535544-87535566 CCACGGCCAAGGTGTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976660501 Original CRISPR CCACGGCCAAGGTGTCAGGA GGG Intergenic