ID: 976661962

View in Genome Browser
Species Human (GRCh38)
Location 4:87548973-87548995
Sequence GTGTCCTAGCAGAAGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976661962_976661966 12 Left 976661962 4:87548973-87548995 CCTGCTTACTTCTGCTAGGACAC No data
Right 976661966 4:87549008-87549030 CAAATAAACACTAGAGGAAAAGG No data
976661962_976661964 6 Left 976661962 4:87548973-87548995 CCTGCTTACTTCTGCTAGGACAC No data
Right 976661964 4:87549002-87549024 AATCCTCAAATAAACACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976661962 Original CRISPR GTGTCCTAGCAGAAGTAAGC AGG (reversed) Intergenic
No off target data available for this crispr