ID: 976663243

View in Genome Browser
Species Human (GRCh38)
Location 4:87562532-87562554
Sequence TTCAAACAGAAATGCTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976663243_976663244 19 Left 976663243 4:87562532-87562554 CCATGGAAGCATTTCTGTTTGAA No data
Right 976663244 4:87562574-87562596 AAACTTACATGCCTCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976663243 Original CRISPR TTCAAACAGAAATGCTTCCA TGG (reversed) Intergenic
No off target data available for this crispr