ID: 976668761

View in Genome Browser
Species Human (GRCh38)
Location 4:87628641-87628663
Sequence AAATTTCAACAAATGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976668761_976668773 29 Left 976668761 4:87628641-87628663 CCCCCATTCATTTGTTGAAATTT No data
Right 976668773 4:87628693-87628715 GGAGCCTGTGGAAGGTAAGTAGG No data
976668761_976668769 5 Left 976668761 4:87628641-87628663 CCCCCATTCATTTGTTGAAATTT No data
Right 976668769 4:87628669-87628691 CCTAATGTGATGGTGTTAAGAGG No data
976668761_976668771 17 Left 976668761 4:87628641-87628663 CCCCCATTCATTTGTTGAAATTT No data
Right 976668771 4:87628681-87628703 GTGTTAAGAGGTGGAGCCTGTGG No data
976668761_976668765 -5 Left 976668761 4:87628641-87628663 CCCCCATTCATTTGTTGAAATTT No data
Right 976668765 4:87628659-87628681 AATTTGAACCCCTAATGTGATGG No data
976668761_976668772 21 Left 976668761 4:87628641-87628663 CCCCCATTCATTTGTTGAAATTT No data
Right 976668772 4:87628685-87628707 TAAGAGGTGGAGCCTGTGGAAGG No data
976668761_976668770 8 Left 976668761 4:87628641-87628663 CCCCCATTCATTTGTTGAAATTT No data
Right 976668770 4:87628672-87628694 AATGTGATGGTGTTAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976668761 Original CRISPR AAATTTCAACAAATGAATGG GGG (reversed) Intergenic
No off target data available for this crispr