ID: 976669158 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:87632867-87632889 |
Sequence | TCTCACATATTTAGGGTATT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
976669158_976669165 | 30 | Left | 976669158 | 4:87632867-87632889 | CCCAATACCCTAAATATGTGAGA | No data | ||
Right | 976669165 | 4:87632920-87632942 | TTTACCTTCAGCTTATGAAGGGG | No data | ||||
976669158_976669163 | 28 | Left | 976669158 | 4:87632867-87632889 | CCCAATACCCTAAATATGTGAGA | No data | ||
Right | 976669163 | 4:87632918-87632940 | CATTTACCTTCAGCTTATGAAGG | No data | ||||
976669158_976669164 | 29 | Left | 976669158 | 4:87632867-87632889 | CCCAATACCCTAAATATGTGAGA | No data | ||
Right | 976669164 | 4:87632919-87632941 | ATTTACCTTCAGCTTATGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
976669158 | Original CRISPR | TCTCACATATTTAGGGTATT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |