ID: 976669158

View in Genome Browser
Species Human (GRCh38)
Location 4:87632867-87632889
Sequence TCTCACATATTTAGGGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976669158_976669165 30 Left 976669158 4:87632867-87632889 CCCAATACCCTAAATATGTGAGA No data
Right 976669165 4:87632920-87632942 TTTACCTTCAGCTTATGAAGGGG No data
976669158_976669163 28 Left 976669158 4:87632867-87632889 CCCAATACCCTAAATATGTGAGA No data
Right 976669163 4:87632918-87632940 CATTTACCTTCAGCTTATGAAGG No data
976669158_976669164 29 Left 976669158 4:87632867-87632889 CCCAATACCCTAAATATGTGAGA No data
Right 976669164 4:87632919-87632941 ATTTACCTTCAGCTTATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976669158 Original CRISPR TCTCACATATTTAGGGTATT GGG (reversed) Intergenic
No off target data available for this crispr