ID: 976671254

View in Genome Browser
Species Human (GRCh38)
Location 4:87656620-87656642
Sequence TGGAACATACACAGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976671254 Original CRISPR TGGAACATACACAGCCATCT TGG (reversed) Intronic
901534723 1:9874755-9874777 TGCAATATCCACACCCATCTAGG + Intronic
903262120 1:22136998-22137020 GGGACCATTCACAGTCATCTCGG + Intronic
904316083 1:29664619-29664641 TGCAACATGCACAGCAATCCAGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
911699927 1:100941051-100941073 TGGAACTGCCACAGCCACCTTGG + Intronic
912850946 1:113123895-113123917 TGGAACATAAACAGAGAACTAGG + Exonic
914684638 1:149967546-149967568 TAGAACATACACAGCCCACTTGG + Intronic
914812438 1:151038749-151038771 TCCAACACACACACCCATCTTGG + Intronic
917892858 1:179456259-179456281 TGGAACCTCCATAGCCACCTTGG + Intronic
918731295 1:188000727-188000749 TGGAGCATACACAGCTTTCCTGG - Intergenic
921555303 1:216591630-216591652 TGGAACATACAAAACCAGCCTGG + Intronic
923267303 1:232327292-232327314 TGTAACATGCACATCCTTCTGGG - Intergenic
1064070132 10:12221623-12221645 TGGCACATTCAAAGCCATCCCGG - Intronic
1064820714 10:19328538-19328560 CTGAACATTCACAGCCAACTTGG - Intronic
1064943226 10:20757871-20757893 TGGAATAAAAACAGCCATATAGG + Intergenic
1065736860 10:28761244-28761266 TGGAACCTCAGCAGCCATCTTGG - Intergenic
1065935551 10:30517649-30517671 TGGAACTGCCACAGCCACCTTGG + Intergenic
1066337974 10:34499819-34499841 TGGAGCATTCTCAGGCATCTGGG - Intronic
1068780684 10:60916332-60916354 TGGATAATGCAAAGCCATCTTGG + Intronic
1070017478 10:72548062-72548084 AGGAACATACTCAACCATGTTGG - Intronic
1070390854 10:75969147-75969169 GGCAACATAGACAACCATCTAGG - Intronic
1070488773 10:76956341-76956363 TGGAACATCCAGAGGCATCCAGG + Intronic
1073535726 10:104275120-104275142 TGGAGCTCCCACAGCCATCTTGG + Intronic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1075451745 10:122556655-122556677 AGCAACAAACACAGCCCTCTAGG - Intergenic
1075819068 10:125290352-125290374 TGGAATATACACAGCCATAAAGG + Intergenic
1078877339 11:15411699-15411721 TGGAAGATACACAGCTAACCAGG - Intergenic
1079574061 11:21981118-21981140 TGGATAATTCCCAGCCATCTTGG + Intergenic
1080409344 11:32009129-32009151 TGGGAAATACACATTCATCTTGG + Intronic
1080686766 11:34522464-34522486 TGGAACAGGCACAGCCAGCCTGG - Intergenic
1080735316 11:35008424-35008446 TGCAACAAGCACAGCGATCTTGG + Intronic
1083722305 11:64609382-64609404 AAATACATACACAGCCATCTGGG + Intronic
1088519907 11:110685124-110685146 TGGAAAATACACAGTCTTCTGGG + Intronic
1089142182 11:116294341-116294363 TAGAACATATACAGCCTTCTGGG - Intergenic
1089916384 11:122161027-122161049 TGGAAGATGCATAGCCTTCTTGG - Intergenic
1090735873 11:129611770-129611792 TGGATCAGCCACAGCCATCAGGG - Intergenic
1091495202 12:966363-966385 TGGAATATTCATGGCCATCTTGG + Intronic
1092777721 12:11958934-11958956 TGGAAACCAAACAGCCATCTGGG + Intergenic
1093034106 12:14316866-14316888 TGGCACTCAAACAGCCATCTGGG + Intergenic
1096276978 12:50217809-50217831 TGGGAAGTACACAGGCATCTAGG + Intronic
1097298455 12:57992365-57992387 TGCAACATACTTACCCATCTAGG - Intergenic
1097821156 12:64130530-64130552 CAGAGCATACACAGCCTTCTGGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1100734906 12:97516429-97516451 TGTAACATACACAGCCAGCAAGG + Intergenic
1101122006 12:101591931-101591953 TAGAAGATACACAGCTATTTTGG + Intronic
1104231540 12:126889331-126889353 TGGAATATAAACATCCATTTGGG - Intergenic
1106139004 13:26995067-26995089 TGCCACACACACAGCCACCTCGG + Intergenic
1107688583 13:42928908-42928930 TGGAACAGAGACAGCCCTCAAGG + Intronic
1107710152 13:43143351-43143373 TGAAATATACACACCAATCTAGG - Intergenic
1108474267 13:50798403-50798425 TGGGACATACACTGACACCTAGG + Intronic
1108754357 13:53482124-53482146 TGGATCTTAAGCAGCCATCTTGG - Intergenic
1109425284 13:62159137-62159159 TGGAAGATGCAAAGCCATGTGGG - Intergenic
1109618775 13:64872473-64872495 TGTAACATATACAGACATCAGGG - Intergenic
1109680575 13:65746858-65746880 TGGAAAATAGAGAGACATCTTGG - Intergenic
1109980457 13:69899647-69899669 AGGAACATACACGGCTTTCTAGG + Intronic
1110830628 13:80026370-80026392 TGGAAGGAACACAGCCTTCTTGG + Intergenic
1111235362 13:85401312-85401334 TGGGACATACACAGAGACCTGGG - Intergenic
1111822111 13:93227432-93227454 TGCAACATACAAATCCAGCTCGG - Exonic
1114031753 14:18585267-18585289 AGGAACATAGACACCCACCTAGG + Intergenic
1114314468 14:21496710-21496732 TGAAACATGAACAGCCATCATGG - Exonic
1115627345 14:35207075-35207097 TAAAAGATACACAGCCACCTTGG - Intronic
1117601106 14:57375666-57375688 TGGAACAGACACATGCATTTTGG + Intergenic
1122109983 14:99492727-99492749 TGGACCACACAAAGCCATGTTGG + Exonic
1122824939 14:104365127-104365149 TGGAAAATACCCGGCCATCTGGG + Intergenic
1123695284 15:22874517-22874539 TGCAACAGCCACAGCCATCACGG + Intronic
1124109955 15:26775795-26775817 TCCAACATAGGCAGCCATCTGGG + Intronic
1125262232 15:37839820-37839842 TGAAAGAGACACAGACATCTGGG + Intergenic
1126656474 15:50983231-50983253 TGGGGCATAAGCAGCCATCTTGG - Intronic
1128209731 15:65887857-65887879 TGGACTATACACAGCCTTCTAGG - Exonic
1135886700 16:26316632-26316654 TCCAACATACACAGCAATGTGGG + Intergenic
1139280739 16:65768289-65768311 TGCAACAGACACAGCCTTCCTGG + Intergenic
1139892180 16:70260378-70260400 TAGAACATACACTGCTATCCTGG + Intronic
1146054035 17:29572459-29572481 TTGAACAGACACAGCCCCCTGGG - Exonic
1146777533 17:35634956-35634978 AGAAACACACACACCCATCTTGG - Intronic
1153268621 18:3296686-3296708 TGGAACATACACTCCCACTTGGG + Intergenic
1153972587 18:10239811-10239833 TGGAAGATACACAGCCAGCATGG - Intergenic
1160585352 18:79910746-79910768 TGGAACACGCCCAGCCATATGGG - Intronic
1163349846 19:16769559-16769581 TGAGTCATACACAGCCATGTAGG - Intronic
1164996355 19:32722259-32722281 TGAAACATGCACAACCATCCCGG + Intronic
1167013876 19:46826932-46826954 TGGAACTGCCATAGCCATCTTGG + Intergenic
1167335877 19:48885477-48885499 TGGATCCTACACACCTATCTCGG - Exonic
925042626 2:744683-744705 TGGAACTTACACAACCATTGTGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926991510 2:18685581-18685603 TGGAGCATACAGTGCCAGCTTGG + Intergenic
929001453 2:37351044-37351066 TGGAAAGTAAACAGCCATCTCGG + Intronic
929785488 2:44987658-44987680 TGGAGCTTGCACAGCCACCTTGG - Intergenic
931692134 2:64844263-64844285 TGGAACTTCAGCAGCCATCTTGG - Intergenic
932912804 2:75822206-75822228 TGTCACATACCCTGCCATCTGGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
942950451 2:181715137-181715159 AGGAACATACACAGACTTATGGG - Intergenic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
945117155 2:206419321-206419343 TGGAACAGCCATAGCCACCTTGG + Intergenic
946479836 2:220044483-220044505 TGGTGCACACTCAGCCATCTGGG - Intergenic
946890802 2:224274159-224274181 TGGAACAACCAGAGTCATCTTGG + Intergenic
947141558 2:227023671-227023693 TAGCACATACACAGTCTTCTCGG - Intronic
948384796 2:237574758-237574780 TGGAACAGGCACAGGCATCGGGG + Exonic
1169281781 20:4273978-4274000 TGGAACACCTGCAGCCATCTTGG + Intergenic
1174903806 20:54528470-54528492 TGGAGCTTCAACAGCCATCTTGG - Intronic
1175369096 20:58475016-58475038 TGGAATAACCACACCCATCTAGG - Intronic
1175700540 20:61133592-61133614 TGGAAAATTCACAGCAATCTTGG + Intergenic
1176973617 21:15292552-15292574 TGGATAATACACAGCCATTGGGG - Intergenic
1177094739 21:16818807-16818829 CGAAAAATACCCAGCCATCTGGG - Intergenic
1180455867 22:15512324-15512346 AGGAACATAGACACCCACCTAGG + Intergenic
1183762092 22:39830833-39830855 ATGAACATACAGAACCATCTTGG - Intronic
1185058557 22:48593591-48593613 TGGTACCAACACAGCCACCTGGG - Intronic
1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG + Intergenic
950693926 3:14683204-14683226 GGGCACATACACAAACATCTGGG - Intronic
951583236 3:24187662-24187684 TGTGGGATACACAGCCATCTAGG + Intronic
952852010 3:37737290-37737312 TGGGAAATACACAGCCAAGTGGG - Intronic
956012171 3:64843639-64843661 TGGAACATACACATTCCTGTGGG + Intergenic
956093203 3:65689643-65689665 TGGAATATTCAAAGTCATCTTGG + Intronic
958574618 3:95932232-95932254 TGGAGGATGCACAGCTATCTGGG + Intergenic
958700114 3:97578319-97578341 TGCAACTTACACAACCATCCTGG - Intronic
959613862 3:108325531-108325553 TGGAACCATCATAGCCATCTTGG + Intronic
960130242 3:114048048-114048070 TGGAAGAAACACAGCAATCATGG - Intronic
961564852 3:127756109-127756131 TGGAACTCTCACAGCCATCTTGG + Intronic
965839686 3:172889781-172889803 TGGCACATACAAATCCATGTTGG + Intronic
965879922 3:173376429-173376451 TTGAACTTACACTGCCATTTTGG + Intergenic
966434859 3:179871701-179871723 AGGAACAGAAACAGCCATATTGG - Intronic
969213987 4:5708632-5708654 TGGAACAAACACCCGCATCTGGG + Intronic
972951952 4:44337378-44337400 TAGAACATATACAGTCAGCTGGG + Intronic
975240045 4:72046713-72046735 TGCTACATTCACAGCAATCTAGG - Intronic
975794080 4:77987898-77987920 TGGAACTTCCATAGCCACCTTGG + Intergenic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
976771171 4:88653972-88653994 TGAAATATACACAACTATCTTGG - Intronic
976840208 4:89423812-89423834 TTGAATATACACATACATCTAGG - Intergenic
978581085 4:110231978-110232000 TGTTACATACAGAGGCATCTAGG + Intergenic
978961482 4:114684835-114684857 AGGAACATAAACAGGTATCTTGG - Intergenic
980513644 4:133825285-133825307 CAGAGCATACACAGCCTTCTAGG - Intergenic
980812621 4:137902444-137902466 TGGAACTCTCACATCCATCTGGG + Intergenic
984494242 4:180474361-180474383 TGGAAAATTCATAACCATCTGGG + Intergenic
984841221 4:184069582-184069604 TGCACCATACAGAGCTATCTTGG - Intergenic
985785285 5:1890051-1890073 TGTAGCATGCACAGGCATCTGGG + Intergenic
986629080 5:9751984-9752006 TTGAACATAGAAAGCAATCTGGG + Intergenic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
997975849 5:138440839-138440861 TGGAACATGCCCAGCCAGGTAGG - Intronic
999876303 5:155810402-155810424 AATAACATACACAGCCTTCTAGG - Intergenic
1001982560 5:176046901-176046923 TGGGACCTACACAGCCACCTGGG - Intergenic
1002234901 5:177797156-177797178 TGGGACCTACACAGCCACCTGGG + Intergenic
1002272884 5:178084291-178084313 TGGAACACACCCAGCTTTCTTGG - Intergenic
1008793562 6:55271013-55271035 TCCAAAATACAAAGCCATCTGGG - Intronic
1011759493 6:90545971-90545993 TGGAACTTCAACAGCCATTTTGG + Intronic
1015213704 6:130725608-130725630 TGGAAAATACACAGTTTTCTGGG - Intergenic
1015580230 6:134716233-134716255 TGAAAGATACACAACCAACTAGG + Intergenic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1018264730 6:162011654-162011676 TGGAACAAACACCGCTATCAAGG - Intronic
1019822857 7:3258798-3258820 TGGAACATACAGAAACATATAGG - Intergenic
1027154569 7:75757444-75757466 TGGAACATAAACAGAGATCTGGG + Intergenic
1027926676 7:84473991-84474013 TGGAAAACACACAGCCATGGAGG - Intronic
1028115427 7:86991768-86991790 TGGAACATTAGCAGCCACCTTGG - Intronic
1028149519 7:87355805-87355827 TGCAATATACTCAGCCTTCTAGG - Intronic
1034283406 7:149868867-149868889 TGGATCATGCACAGGCTTCTTGG + Intergenic
1034571599 7:151960591-151960613 TGGAAGCTGCACTGCCATCTAGG - Intronic
1034818820 7:154198072-154198094 TTGCACATCTACAGCCATCTGGG - Intronic
1037352877 8:17981118-17981140 TGGAACGTACATGGCCATCAGGG + Intronic
1040960303 8:53024800-53024822 TGGAAGAGCCACAGCCAGCTAGG - Intergenic
1043289375 8:78577827-78577849 TGAAACAAAGACAGCCATCATGG - Intronic
1046197739 8:110885577-110885599 CAGAGCATACACAGCCATCTGGG - Intergenic
1047307193 8:123662418-123662440 AGGAACATCCACTGACATCTGGG - Intergenic
1047535865 8:125719102-125719124 TGGAACATGGACAGACAGCTGGG + Intergenic
1052937966 9:34109366-34109388 TGGCAACAACACAGCCATCTAGG - Intronic
1055715246 9:79110438-79110460 TGCTACATACCCAGCCTTCTGGG - Intergenic
1056189494 9:84170944-84170966 TGGAGCATGCACTGCCATATGGG - Intergenic
1058140233 9:101350010-101350032 TGGCAAATTCACAGTCATCTTGG - Intergenic
1058154801 9:101503186-101503208 TGGAACTCTTACAGCCATCTTGG + Intronic
1059852692 9:118362166-118362188 TGCATCATACACATCCTTCTAGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186467115 X:9792265-9792287 TGGAACATTCACACCCATAATGG - Intronic
1188151221 X:26678366-26678388 TAGAACATCCACATCCATTTGGG - Intergenic
1188681833 X:33017811-33017833 TGGAACCTACACAGTTATTTGGG - Intronic
1189899061 X:45687154-45687176 TGGAACATTGAGAGCCTTCTAGG - Intergenic
1193288109 X:79737603-79737625 CAGAGCATACACAGCCTTCTGGG - Intergenic
1193706190 X:84823292-84823314 TGTACCATACACAGCCATAGGGG - Intergenic
1194699360 X:97094739-97094761 AAGAACATACACAGCCCTTTTGG + Intronic
1194755781 X:97737660-97737682 TGTAACCTACACAGTCATATAGG - Intergenic
1198954842 X:142117401-142117423 TGTACCATACAGAACCATCTTGG + Intergenic
1199685060 X:150258279-150258301 TGAGACAGACACAGCCTTCTTGG + Intergenic