ID: 976672186

View in Genome Browser
Species Human (GRCh38)
Location 4:87665920-87665942
Sequence CTATTGCCCCCAAGCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976672184_976672186 4 Left 976672184 4:87665893-87665915 CCGGCCTGCAAGTTGGATTTGAC No data
Right 976672186 4:87665920-87665942 CTATTGCCCCCAAGCCTTCCTGG No data
976672185_976672186 0 Left 976672185 4:87665897-87665919 CCTGCAAGTTGGATTTGACTCTT 0: 1
1: 0
2: 0
3: 6
4: 165
Right 976672186 4:87665920-87665942 CTATTGCCCCCAAGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976672186 Original CRISPR CTATTGCCCCCAAGCCTTCC TGG Intergenic
No off target data available for this crispr