ID: 976680362 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:87749047-87749069 |
Sequence | CGTTTAAGACTGATGGAACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
976680358_976680362 | 9 | Left | 976680358 | 4:87749015-87749037 | CCAGCAACATCAGTCAGGTTGCC | No data | ||
Right | 976680362 | 4:87749047-87749069 | CGTTTAAGACTGATGGAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
976680362 | Original CRISPR | CGTTTAAGACTGATGGAACA TGG | Intergenic | ||
No off target data available for this crispr |