ID: 976680362

View in Genome Browser
Species Human (GRCh38)
Location 4:87749047-87749069
Sequence CGTTTAAGACTGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976680358_976680362 9 Left 976680358 4:87749015-87749037 CCAGCAACATCAGTCAGGTTGCC No data
Right 976680362 4:87749047-87749069 CGTTTAAGACTGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976680362 Original CRISPR CGTTTAAGACTGATGGAACA TGG Intergenic
No off target data available for this crispr