ID: 976681178

View in Genome Browser
Species Human (GRCh38)
Location 4:87757858-87757880
Sequence TGAGATATTAAAACAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976681178_976681179 -4 Left 976681178 4:87757858-87757880 CCAGCATCTGTTTTAATATCTCA No data
Right 976681179 4:87757877-87757899 CTCATGTCATCATTTATAAATGG No data
976681178_976681180 -3 Left 976681178 4:87757858-87757880 CCAGCATCTGTTTTAATATCTCA No data
Right 976681180 4:87757878-87757900 TCATGTCATCATTTATAAATGGG No data
976681178_976681181 19 Left 976681178 4:87757858-87757880 CCAGCATCTGTTTTAATATCTCA No data
Right 976681181 4:87757900-87757922 GAACTAACCATTGAGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976681178 Original CRISPR TGAGATATTAAAACAGATGC TGG (reversed) Intergenic
No off target data available for this crispr