ID: 976696873

View in Genome Browser
Species Human (GRCh38)
Location 4:87926377-87926399
Sequence AAGTAGCCACAAACCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976696873_976696882 20 Left 976696873 4:87926377-87926399 CCCAGTGGGGTTTGTGGCTACTT No data
Right 976696882 4:87926420-87926442 CCCTTGGCAATAGAAAATTGTGG No data
976696873_976696877 4 Left 976696873 4:87926377-87926399 CCCAGTGGGGTTTGTGGCTACTT No data
Right 976696877 4:87926404-87926426 CTTTATTACCCCACGGCCCTTGG No data
976696873_976696876 -3 Left 976696873 4:87926377-87926399 CCCAGTGGGGTTTGTGGCTACTT No data
Right 976696876 4:87926397-87926419 CTTAGGACTTTATTACCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976696873 Original CRISPR AAGTAGCCACAAACCCCACT GGG (reversed) Intergenic
No off target data available for this crispr