ID: 976696876

View in Genome Browser
Species Human (GRCh38)
Location 4:87926397-87926419
Sequence CTTAGGACTTTATTACCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976696872_976696876 -2 Left 976696872 4:87926376-87926398 CCCCAGTGGGGTTTGTGGCTACT No data
Right 976696876 4:87926397-87926419 CTTAGGACTTTATTACCCCACGG No data
976696873_976696876 -3 Left 976696873 4:87926377-87926399 CCCAGTGGGGTTTGTGGCTACTT No data
Right 976696876 4:87926397-87926419 CTTAGGACTTTATTACCCCACGG No data
976696874_976696876 -4 Left 976696874 4:87926378-87926400 CCAGTGGGGTTTGTGGCTACTTA No data
Right 976696876 4:87926397-87926419 CTTAGGACTTTATTACCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976696876 Original CRISPR CTTAGGACTTTATTACCCCA CGG Intergenic
No off target data available for this crispr