ID: 976699830

View in Genome Browser
Species Human (GRCh38)
Location 4:87957978-87958000
Sequence TAGCATTACCATTAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976699830_976699832 2 Left 976699830 4:87957978-87958000 CCTTGCTCCTAATGGTAATGCTA No data
Right 976699832 4:87958003-87958025 ATATAATGTAGAATACTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976699830 Original CRISPR TAGCATTACCATTAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr