ID: 976700609

View in Genome Browser
Species Human (GRCh38)
Location 4:87965905-87965927
Sequence CCAAGGCAGAACTGGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976700597_976700609 16 Left 976700597 4:87965866-87965888 CCCATGGGCAGGGGAGCAGCTGT No data
Right 976700609 4:87965905-87965927 CCAAGGCAGAACTGGGTCCAGGG No data
976700592_976700609 29 Left 976700592 4:87965853-87965875 CCAGGCCAAGTCGCCCATGGGCA No data
Right 976700609 4:87965905-87965927 CCAAGGCAGAACTGGGTCCAGGG No data
976700596_976700609 24 Left 976700596 4:87965858-87965880 CCAAGTCGCCCATGGGCAGGGGA No data
Right 976700609 4:87965905-87965927 CCAAGGCAGAACTGGGTCCAGGG No data
976700598_976700609 15 Left 976700598 4:87965867-87965889 CCATGGGCAGGGGAGCAGCTGTC No data
Right 976700609 4:87965905-87965927 CCAAGGCAGAACTGGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976700609 Original CRISPR CCAAGGCAGAACTGGGTCCA GGG Intergenic
No off target data available for this crispr