ID: 976703385

View in Genome Browser
Species Human (GRCh38)
Location 4:87995510-87995532
Sequence ATCAAGAAACAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976703378_976703385 4 Left 976703378 4:87995483-87995505 CCCCAGATTTTGCTTAAGGTAAA No data
Right 976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG No data
976703379_976703385 3 Left 976703379 4:87995484-87995506 CCCAGATTTTGCTTAAGGTAAAA No data
Right 976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG No data
976703380_976703385 2 Left 976703380 4:87995485-87995507 CCAGATTTTGCTTAAGGTAAAAG No data
Right 976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG No data
976703376_976703385 12 Left 976703376 4:87995475-87995497 CCAGATTTCCCCAGATTTTGCTT No data
Right 976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976703385 Original CRISPR ATCAAGAAACAGGAGGAGGA GGG Intergenic
No off target data available for this crispr