ID: 976705201

View in Genome Browser
Species Human (GRCh38)
Location 4:88012761-88012783
Sequence CACAGAAAGGGGAAGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1285
Summary {0: 1, 1: 1, 2: 13, 3: 150, 4: 1120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976705201 Original CRISPR CACAGAAAGGGGAAGTAGAA TGG (reversed) Intronic
900535049 1:3172749-3172771 CATAGAGACGGAAAGTAGAATGG + Intronic
901342538 1:8508278-8508300 AACAGAGAGAGGAAGGAGAATGG + Intronic
902266909 1:15273927-15273949 CACAGAGACAGGAAGTAGAACGG - Intronic
902819320 1:18933956-18933978 CACAGAGACAGAAAGTAGAAGGG - Intronic
903042971 1:20545489-20545511 CACAGAAATGGAAAGTTGAATGG + Intergenic
903664048 1:24995927-24995949 CACAGACAGGGGCCGTACAATGG + Intergenic
903669499 1:25027153-25027175 AAAAGACAGGGGATGTAGAATGG - Intergenic
903784467 1:25849124-25849146 CACAGAAGCAGGAAGTATAAGGG - Intronic
903968671 1:27105152-27105174 CACAGCATGGGGAACTGGAAAGG - Intronic
904107004 1:28093436-28093458 CATAGATATGGAAAGTAGAATGG + Intergenic
905073105 1:35245229-35245251 CATAGAGACAGGAAGTAGAATGG - Intergenic
905101150 1:35523146-35523168 CACAGTAAAGGGAGGAAGAATGG - Intronic
905772087 1:40644890-40644912 CACAGAAAGGGGAGGGAGAATGG + Intronic
906014706 1:42564856-42564878 CACAGAAGCAGCAAGTAGAATGG - Intronic
906275928 1:44515621-44515643 CACACAAAGGGAAAATAAAAGGG - Intronic
906289799 1:44612236-44612258 AAGAGAAAGGGGGAGAAGAAAGG - Intronic
906340290 1:44973769-44973791 CATAGAAATAGGAAGTAGAATGG + Intronic
906570511 1:46834131-46834153 CATAGAAACAGAAAGTAGAAAGG - Intergenic
906721928 1:48013097-48013119 CAGAAAACGGGGAAATAGAATGG - Intergenic
906927923 1:50138795-50138817 CATAGAGATGGAAAGTAGAATGG + Intronic
906989484 1:50722864-50722886 TACTGAAAGAGGAAGTAAAATGG - Intronic
907131645 1:52102584-52102606 CATAGAAACAGAAAGTAGAATGG - Intergenic
907177195 1:52535583-52535605 CACAGAAAGAAGAAAGAGAAGGG + Intronic
907559001 1:55371279-55371301 CAAGGAAAGTGGAAGTAAAACGG + Intergenic
907931451 1:59004871-59004893 CATAGAAACAGGAAGCAGAATGG + Intergenic
908002814 1:59697380-59697402 CACAGAGACAGAAAGTAGAATGG - Intronic
908387632 1:63657662-63657684 CACAGACACAGGAAGGAGAAAGG - Intronic
908602017 1:65750096-65750118 CACAGAAGTAGAAAGTAGAATGG + Intergenic
908642092 1:66236295-66236317 CAAAGAAGGGGGAAATAGAAGGG - Intronic
908737940 1:67295699-67295721 GACAGTAAGGGGAATTAAAAGGG + Intergenic
908957689 1:69653915-69653937 CATAGAAACAGAAAGTAGAATGG + Intronic
909491468 1:76231525-76231547 CACAGAAACAGAAAGTAAAATGG - Intronic
909620360 1:77660411-77660433 CATAGAAACAGAAAGTAGAAAGG - Intronic
910397019 1:86803773-86803795 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
910573326 1:88730315-88730337 CCCAGAAACAAGAAGTAGAAAGG + Intronic
910834326 1:91493139-91493161 CATAGAAACAGAAAGTAGAATGG + Intergenic
911051544 1:93675722-93675744 CATGGAAAGGGAAAGGAGAATGG + Intronic
911214258 1:95175227-95175249 CATAGAAACAGAAAGTAGAAAGG - Intronic
911399246 1:97353997-97354019 CTCAGAAAGGGTAAGTAACATGG - Intronic
911648167 1:100357351-100357373 CACTGAAGGGGAAAGGAGAAAGG + Intronic
911718525 1:101164172-101164194 CACAGAATGTGAAAGTATAAAGG + Intergenic
912221211 1:107678012-107678034 CACGGAAAAGGGAATCAGAAAGG + Intronic
912264346 1:108140778-108140800 CACACAAAGGGAAATGAGAAGGG + Intronic
912394856 1:109334490-109334512 CACAGAAGCAGGGAGTAGAATGG + Intronic
912648423 1:111416849-111416871 CACAGAAACAGAAAATAGAATGG + Intronic
912870285 1:113298006-113298028 CAGAGAAAGAGGAAGTGCAAAGG - Intergenic
913174125 1:116258376-116258398 CACAGAGACAGAAAGTAGAATGG + Intergenic
913277257 1:117150807-117150829 CACAGAAACAGAAAGTAGAATGG - Intronic
914327573 1:146635266-146635288 AACAGGAAGAGGAAGTGGAAAGG - Intergenic
914955150 1:152155320-152155342 CACAGACTGGGGAAATACAAGGG - Exonic
915144943 1:153791117-153791139 CATAGAAACAGAAAGTAGAATGG + Intergenic
915230172 1:154439782-154439804 CACAGAAAAAGCAAGTAGACTGG - Intronic
915790200 1:158661296-158661318 AACAGAAAGGGGAAACAAAATGG - Exonic
915953845 1:160207291-160207313 GACTGAAAGATGAAGTAGAAAGG + Intronic
915973375 1:160369130-160369152 CATAGAAACAGAAAGTAGAATGG - Intronic
915986223 1:160467812-160467834 CACAGAAACAGAAAGTAGAATGG - Intergenic
916030756 1:160875763-160875785 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916030762 1:160875787-160875809 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916088198 1:161286554-161286576 CTTAGAAATAGGAAGTAGAATGG - Intergenic
916188703 1:162158184-162158206 CACAGAAACAGAGAGTAGAAAGG - Intronic
916198382 1:162246765-162246787 CACAGATTGGGGAGCTAGAAGGG - Intronic
916350450 1:163843710-163843732 CAAAGAAATGGGAAGTAAATGGG - Intergenic
916593633 1:166219781-166219803 CACACAAAGGAGAAAGAGAAAGG - Intergenic
917152413 1:171959165-171959187 TACAGAAGGGGGAAGTATATGGG + Intronic
917716339 1:177741587-177741609 TAAGGAAAGGGGGAGTAGAAAGG - Intergenic
917992483 1:180396101-180396123 CACAGAAATAGAAAGTAGAATGG + Intronic
918102931 1:181392106-181392128 CACAGAAAGGGTAAGGAATAGGG + Intergenic
918189366 1:182157530-182157552 CATAGACACAGGAAGTAGAATGG - Intergenic
918403829 1:184192269-184192291 CACAGAATGGGGTAGAAAAAGGG + Intergenic
918462049 1:184786871-184786893 CAGAGAAAGAGGAAGTAAAAGGG - Intergenic
918467215 1:184832979-184833001 CTTAGAAAGGGGAAATAAAAGGG + Intronic
918641693 1:186848762-186848784 CACAGAAAGGGGGCAGAGAAGGG + Intronic
918744761 1:188185165-188185187 GATAGAAAGGAGAAGTAGAGTGG + Intergenic
919127662 1:193415833-193415855 CATAAAAAGTGGAAGTAGCATGG + Intergenic
919138259 1:193537877-193537899 CACAGAAACAGAAAGTAGAACGG - Intergenic
919287429 1:195581917-195581939 CATAGAAACAGAAAGTAGAATGG - Intergenic
919422976 1:197394156-197394178 CAGAGGAAGTGGAAGTAGAAGGG - Intronic
919514250 1:198501916-198501938 CATAGAAATGAAAAGTAGAATGG - Intergenic
919751438 1:201040472-201040494 CACAGAAAGGGGAGGATGGAGGG + Intronic
919831489 1:201543862-201543884 CATAGAGATGGGAAGTAAAATGG - Intergenic
920005555 1:202831150-202831172 CATAGAAACAGGAAGTAGATTGG + Intergenic
920034714 1:203058431-203058453 CACAGACAGGGGAAGCTGAACGG + Intronic
920285592 1:204876635-204876657 CAAAGAGAGAGAAAGTAGAATGG - Intronic
920394610 1:205635146-205635168 CCCAGAAAGGGTAAGTCGCAAGG - Intergenic
920404608 1:205699771-205699793 TACAGAAAGGGGAATGGGAAGGG + Intergenic
920503661 1:206501346-206501368 CACAGGGAGAGGAAGCAGAAAGG + Intergenic
920633565 1:207677015-207677037 GAGAGAAAGAGGAAGTAGAGTGG + Intronic
920916736 1:210263808-210263830 CACAGCAAGTGGCAGGAGAAGGG + Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921800226 1:219394517-219394539 CACAGAGACAGAAAGTAGAATGG - Intergenic
923112169 1:230900292-230900314 TACAGAAAGGGAAAGAAGAAGGG + Intergenic
923379561 1:233402183-233402205 CACAGAAACAGAAAGTAGAATGG + Intergenic
923438316 1:233991217-233991239 GACAGAAAGGGAAAGTGGGAGGG + Intronic
923443143 1:234040312-234040334 CACAGAATGGGGGAGCAGGATGG + Intronic
923535112 1:234843461-234843483 CACAGAGACAGAAAGTAGAATGG + Intergenic
923766850 1:236900459-236900481 CACAGAAGGAGGAAGTGGAAGGG + Exonic
923767918 1:236910048-236910070 CACAGAGAGGGAAGGTAGAATGG - Intergenic
924199575 1:241644946-241644968 CACAGAGACAGAAAGTAGAATGG + Intronic
924387974 1:243518220-243518242 CAGGGACAGGGGAAGTGGAAGGG - Intronic
924399127 1:243659223-243659245 CACAGAAGCAGAAAGTAGAACGG + Intronic
924664392 1:246055809-246055831 CAGAGAGACAGGAAGTAGAATGG + Intronic
924813019 1:247419606-247419628 CACAGAGATGGCAAATAGAATGG - Intronic
924871467 1:248051194-248051216 CACAGAGATGGAAAGTGGAATGG - Intronic
1062767171 10:74690-74712 GAAAGTAAGGGGAAGGAGAAGGG + Intergenic
1063086179 10:2819967-2819989 CACACAAACAAGAAGTAGAAAGG - Intergenic
1063138403 10:3236608-3236630 CAAAGGAAGGGGACGGAGAACGG - Intergenic
1063456731 10:6188675-6188697 CACAGAAACAGAAAGCAGAACGG - Intronic
1063500580 10:6550095-6550117 CACAGAAACGGGAAGTAGAACGG - Intronic
1063542539 10:6948868-6948890 CACAGAGACAGAAAGTAGAATGG + Intergenic
1063571386 10:7217134-7217156 CATAGAGACGGGAAGGAGAATGG + Intronic
1063725861 10:8637000-8637022 CACAGCAAGGGAAGGCAGAATGG - Intergenic
1063997342 10:11632370-11632392 CATAGAAACAGAAAGTAGAATGG - Intergenic
1064007597 10:11710893-11710915 CACAGAAACAGAAAGGAGAATGG + Intergenic
1064008734 10:11718185-11718207 CATAGAAACAGAAAGTAGAATGG - Intergenic
1064181076 10:13116262-13116284 CACAGGAAGGAGAAGCAGAAGGG + Exonic
1064467736 10:15601375-15601397 CACAGAGACAGAAAGTAGAATGG + Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065031382 10:21589909-21589931 CAGACAAAGGGGAAGGGGAAGGG - Intronic
1065176801 10:23084994-23085016 CATAGAAACAGAAAGTAGAATGG + Intergenic
1065265128 10:23966688-23966710 CAGAGAAAGAGGAAGAAGACTGG + Intronic
1065303406 10:24345995-24346017 CACAGAGACAGAAAGTAGAATGG - Intronic
1065598237 10:27339057-27339079 CACAGAAAAGGGAGAAAGAAGGG - Intergenic
1065938422 10:30542299-30542321 CACCAAAAGGGGCAGTGGAAAGG - Intergenic
1066019388 10:31282779-31282801 CATAGAATGTGGAAGAAGAATGG + Intergenic
1066463111 10:35629761-35629783 CACAGAGACAGGAAGCAGAATGG + Intergenic
1066603255 10:37132097-37132119 CACAGAAAAGGGAGAAAGAAGGG + Intronic
1067218593 10:44324527-44324549 GAAAGAAAGGGGAAGTGAAAGGG + Intergenic
1068543546 10:58322695-58322717 CACAGAAACAGGAAGTACAATGG - Intergenic
1068718178 10:60211351-60211373 CACAGAAAAAGGAAGGAGAATGG + Intronic
1069307684 10:66991934-66991956 CACTGAAAGGGGAGGTATGAAGG - Intronic
1069317904 10:67130696-67130718 CATGGAAATGGGAACTAGAACGG + Intronic
1069399155 10:68023509-68023531 CACAGAGACAGGAAGTAGAATGG + Intronic
1069444376 10:68459556-68459578 CACAGAGATAGAAAGTAGAATGG + Intronic
1069863963 10:71489236-71489258 AACAGAAAGGCTAAGAAGAATGG - Intronic
1069984608 10:72274657-72274679 CACAGGAAGGGGTATTAGAGCGG - Intronic
1070018827 10:72563531-72563553 TACAGAAACAGAAAGTAGAATGG + Intronic
1070103496 10:73411291-73411313 CTCAGAAAGGGGAGGGTGAAAGG + Intronic
1070294119 10:75144430-75144452 CACAGAAACAGAAAGTAGAATGG - Intronic
1070353030 10:75611556-75611578 CACAGAGACAGGAAGTGGAATGG - Intronic
1070435617 10:76389659-76389681 CACAGATATAGAAAGTAGAATGG - Intronic
1070568864 10:77625544-77625566 CATAGAAACAGAAAGTAGAAGGG - Intronic
1070695447 10:78559956-78559978 CAAACAAAAGGTAAGTAGAATGG + Intergenic
1071011105 10:80941587-80941609 GGCAGAGAGGGGCAGTAGAAGGG + Intergenic
1071483816 10:86084832-86084854 CACAGAGACAGAAAGTAGAATGG + Intronic
1071529748 10:86380104-86380126 CACAGAGACAGAAAGTAGAATGG + Intergenic
1071861720 10:89680840-89680862 CACAGAAGCAGAAAGTAGAATGG + Intergenic
1071913417 10:90262477-90262499 CATAGAGATAGGAAGTAGAATGG + Intergenic
1072628613 10:97130561-97130583 CACGGAAACAGAAAGTAGAATGG + Intronic
1072758533 10:98037158-98037180 CAGAGACAGGGGAAAAAGAAGGG - Intergenic
1072918690 10:99557264-99557286 CCCAGAAAGGTGAAATAGATAGG - Intergenic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073438483 10:103536950-103536972 CACAGAGACAGAAAGTAGAATGG - Intronic
1073695238 10:105859426-105859448 CATAGAAAGTGAAAGTAGATGGG + Intergenic
1073759732 10:106616522-106616544 CCCAGAAAGGAGATGGAGAAGGG + Intronic
1074134881 10:110617614-110617636 CACTGAAGTGGGAGGTAGAAGGG + Intergenic
1074327433 10:112465664-112465686 CATAGAAACAGAAAGTAGAATGG + Intronic
1074417267 10:113278133-113278155 CATAGAGATGGAAAGTAGAATGG - Intergenic
1074638301 10:115346294-115346316 CACAGAAACAGAAAGTAGAATGG - Intronic
1074970327 10:118531265-118531287 CACTGAAAGGGGAAAAGGAAGGG - Intergenic
1075316681 10:121458920-121458942 AACAGAAAGAGGGAGGAGAATGG - Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075642113 10:124072301-124072323 CACAGGAAGTGGAAGAAGAGAGG - Intronic
1075791052 10:125084664-125084686 CACAGAACGGGCAAGGAGAAGGG - Intronic
1075927936 10:126268147-126268169 CATAGAAACAGAAAGTAGAATGG - Intronic
1076038231 10:127219668-127219690 CATAGAGACAGGAAGTAGAATGG - Intronic
1076350417 10:129811444-129811466 GACAGACAGAGGCAGTAGAAAGG - Intergenic
1076369102 10:129940428-129940450 CACAGAAGGGGAAAGAATAAAGG + Intronic
1077080200 11:721652-721674 CGGAAAAAGGGGAAGAAGAAGGG + Exonic
1077370938 11:2181280-2181302 CACACAATGGGGAGGTGGAAGGG + Intergenic
1077449378 11:2627483-2627505 CAGAGAAACGGAGAGTAGAAGGG - Intronic
1077860741 11:6177121-6177143 CACTGAGATGGAAAGTAGAATGG + Intergenic
1078270001 11:9786549-9786571 TACAGAAAGGTCAAGAAGAATGG - Intronic
1078300038 11:10120118-10120140 CATAGAATCAGGAAGTAGAATGG - Intronic
1078340169 11:10492973-10492995 CACAGAATGGGGCAGTGGCAAGG + Intronic
1078494633 11:11803612-11803634 CACAGAAGCAGGGAGTAGAATGG + Intergenic
1078500085 11:11864563-11864585 CACCGAGATGGAAAGTAGAATGG - Intronic
1078674922 11:13401559-13401581 TAGAGAAAGAGGAAGTAGAGTGG + Intronic
1078785655 11:14489676-14489698 CACAGAGACAGCAAGTAGAATGG + Intronic
1078960850 11:16268000-16268022 CACAGAAGGAGAGAGTAGAATGG + Intronic
1078988313 11:16615934-16615956 CACAGAAAGGAAAAATATAAGGG + Intronic
1079058424 11:17227357-17227379 GACAAGAAGGGGAGGTAGAAAGG + Intronic
1079325683 11:19489298-19489320 GAGAGAGAGGGGAAGAAGAAGGG + Intronic
1079728086 11:23902067-23902089 TACAAAAATAGGAAGTAGAATGG + Intergenic
1080033850 11:27690287-27690309 CACAGAAATGGGCAGCAGGATGG + Intronic
1080530678 11:33172753-33172775 CACAGAAACAGAAAGTAGAAAGG + Intergenic
1080646074 11:34188620-34188642 CACAAAAAGGGGGAGAGGAAAGG + Intronic
1080950129 11:37022267-37022289 GAAAGAAAGGGGAAGAAGACAGG + Intergenic
1080951266 11:37035903-37035925 AATAGAAAGGAGAAGTAGAAAGG - Intergenic
1081207743 11:40294117-40294139 CAGAGAAAGGGAAAGGAAAAGGG - Intronic
1081582449 11:44361439-44361461 CACAGAGCTGGGAAGTGGAAGGG + Intergenic
1081889463 11:46528588-46528610 CACAGAAACAGAAAGTAGAGTGG + Intronic
1082824187 11:57566313-57566335 AACAGAAAATGAAAGTAGAAAGG + Intronic
1082893881 11:58169697-58169719 AACAAAAAGGAGAAGAAGAAGGG - Intronic
1083001638 11:59297687-59297709 CACAGAGAGGGGAAAGGGAAGGG + Intergenic
1083770908 11:64866904-64866926 CACAGAAAAGGAATATAGAATGG + Intronic
1083862635 11:65431070-65431092 CACAGAAACAGAAAGTAGAATGG - Intergenic
1083886982 11:65577685-65577707 CCCAGAAAGGGGAAGCGGACAGG - Intronic
1084213946 11:67637138-67637160 CATAGAAACAGAAAGTAGAATGG + Intronic
1084297659 11:68223464-68223486 CACAGAAACAGAAAGTAGAATGG + Intergenic
1084786776 11:71447132-71447154 TACAGGAAGGCTAAGTAGAATGG + Intronic
1084792029 11:71481068-71481090 CACAGCACGGGGAAGCAGCAGGG - Intronic
1084886788 11:72215648-72215670 CACAGAGACGGAAAATAGAATGG + Intergenic
1084920969 11:72469309-72469331 CACAGTCAGGGGAACTTGAATGG - Intergenic
1085161739 11:74354037-74354059 CACAGACAAGGCAAGGAGAAGGG - Intronic
1085261619 11:75208758-75208780 TAGCCAAAGGGGAAGTAGAAGGG - Intergenic
1085372546 11:76022902-76022924 CACAGAAAAGGAAATGAGAAAGG - Intronic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1085885073 11:80512193-80512215 CACAGAAGTGGAAAGTATAAAGG - Intergenic
1086229872 11:84555619-84555641 CACAGAAACAGAAAGTAAAATGG + Intronic
1086434130 11:86764626-86764648 CATATTAAGGGGAAGTAAAATGG + Intergenic
1086681422 11:89677982-89678004 CACACAAATGGGAAGTTGCAGGG - Intergenic
1087107112 11:94421860-94421882 CATAGAAAGAGAAAGTGGAATGG + Intronic
1087174238 11:95081579-95081601 CAAAGGAAGTGGAAGTACAAAGG + Intergenic
1087423435 11:97962474-97962496 TATAGAAAGGGGAAGGAGTAAGG - Intergenic
1087534062 11:99421372-99421394 CAGAGAACTGGGAAGAAGAATGG + Intronic
1087552763 11:99672844-99672866 AACAGAAAGGGCAGGTGGAAAGG + Intronic
1087952324 11:104238274-104238296 CATAGAAACAGAAAGTAGAATGG - Intergenic
1088010341 11:104993495-104993517 CACAGAGACAGAAAGTAGAATGG - Intergenic
1088291147 11:108238987-108239009 CATAGAGAGAGAAAGTAGAATGG - Intronic
1088435809 11:109812095-109812117 CAGAGAAATAGGAAGCAGAATGG + Intergenic
1088741510 11:112771211-112771233 CATAGAGAAAGGAAGTAGAATGG + Intergenic
1089173551 11:116532766-116532788 CACAGAAAGCAGAACCAGAAAGG + Intergenic
1089747147 11:120625380-120625402 CACAGAGAGAAGAAGCAGAAAGG + Intronic
1089798939 11:121007711-121007733 AAAAGAAGGGGGAAGTCGAACGG + Intergenic
1090379111 11:126312887-126312909 CACAGCAACAGGAAGAAGAAAGG - Intronic
1090495712 11:127210097-127210119 CATAGAAAGGGGAAAAAGAAGGG - Intergenic
1090833706 11:130438545-130438567 GAAAGAAAGGGGAAGGGGAAGGG - Intergenic
1090843229 11:130510659-130510681 CACAGAGATGTGAAGTAGGAAGG - Intergenic
1091843809 12:3639209-3639231 TACAGAAAGGGGAAGAGAAAGGG - Intronic
1092469102 12:8762468-8762490 AAAAGGAAAGGGAAGTAGAAGGG - Intronic
1092721101 12:11441464-11441486 CACAAAAATGGAAAGTAGAAAGG + Intronic
1092745300 12:11667346-11667368 TAAAGGGAGGGGAAGTAGAAGGG - Intronic
1092887755 12:12940194-12940216 CACAGAAACCAAAAGTAGAATGG + Intergenic
1092900226 12:13052624-13052646 CACAGAAACAGAAAGTAGAATGG - Intronic
1093147135 12:15580324-15580346 CAGTGAAAGGGAAAGTAGAAAGG + Intronic
1093388626 12:18589690-18589712 GACTTAAAGGGGAAGAAGAATGG + Intronic
1093602891 12:21051997-21052019 GAGACAAGGGGGAAGTAGAAGGG - Intronic
1093676874 12:21952041-21952063 CATAGAAAGTGGAAGTAGAATGG + Intergenic
1093801907 12:23383733-23383755 CATAGATATGGGGAGTAGAATGG + Intergenic
1093855479 12:24096486-24096508 CATAGAGACAGGAAGTAGAATGG - Intergenic
1094806805 12:34101922-34101944 CAAAGGAAAGGGAAATAGAAGGG + Intergenic
1095150877 12:38795673-38795695 TATAGAAAGAGAAAGTAGAATGG + Intronic
1095390784 12:41703953-41703975 CATAGAAATGGAAAGTAGAATGG - Intergenic
1095515322 12:42999354-42999376 CAAAGAAAGGAGAAAAAGAAAGG - Intergenic
1095552090 12:43455082-43455104 CATAGAAACAGAAAGTAGAATGG - Intronic
1095711058 12:45288426-45288448 CACAGAGACAGAAAGTAGAATGG - Intronic
1095843986 12:46726110-46726132 CATAGAAGCAGGAAGTAGAATGG - Intergenic
1096166826 12:49432613-49432635 CATAGAAACAGAAAGTAGAATGG - Intronic
1096324841 12:50650501-50650523 CACAGAAGCAGGAAGTAGAATGG - Intronic
1096338785 12:50778948-50778970 CACAGAAACAGGAAGTAGAATGG - Intronic
1096488361 12:51999323-51999345 CACAGGAAGAGGCACTAGAATGG - Intergenic
1096883978 12:54698739-54698761 CAGGGAAAGGGGACGTAGAGTGG + Intergenic
1097326281 12:58280766-58280788 CACAGAAATAGAGAGTAGAATGG - Intergenic
1097724245 12:63056507-63056529 CACAGATACAGGAAGTAGAATGG - Intergenic
1098288360 12:68932319-68932341 CACACAAAGGGGAACTGAAACGG + Intronic
1098546346 12:71716065-71716087 CATAGAAACGGAAAGTAGAATGG + Intergenic
1099070621 12:78041989-78042011 CAGAGAAAAAGGAAGTAGATGGG - Intronic
1099135775 12:78898502-78898524 CACAGAAAGTAGTAGTTGAATGG + Intronic
1099214179 12:79834151-79834173 AACAGAAAGGGTAATGAGAAGGG + Intronic
1099340795 12:81431305-81431327 CACAATAAAGGGAAGTACAAGGG - Intronic
1099544806 12:83965201-83965223 CAAAGAAAGGGGAAGCAAACAGG + Intergenic
1099776837 12:87144148-87144170 TACAGAGACAGGAAGTAGAATGG + Intergenic
1100051528 12:90454878-90454900 CATAGAAGGGGAAAATAGAATGG - Intergenic
1100272165 12:93036785-93036807 CACAGAAGCAGAAAGTAGAATGG - Intergenic
1100292014 12:93224688-93224710 CATAGAGACAGGAAGTAGAATGG + Intergenic
1100526579 12:95425175-95425197 CATAGAGACAGGAAGTAGAATGG - Intergenic
1100675681 12:96864241-96864263 AACTGAAAGGGGGAGAAGAAGGG + Intronic
1100732249 12:97484885-97484907 TGCAGAAAGGGGAAGTAGAGAGG - Intergenic
1101122434 12:101597135-101597157 CACAGTTAGGAGAAGAAGAAAGG - Intronic
1101210728 12:102533134-102533156 CATAGAGACAGGAAGTAGAATGG + Intergenic
1101414233 12:104495007-104495029 CATAGAAACAGAAAGTAGAACGG - Intronic
1101434464 12:104653179-104653201 CATAGAAACAGAAAGTAGAATGG - Intronic
1101760439 12:107653973-107653995 CATAGAGACAGGAAGTAGAATGG - Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1102214153 12:111148333-111148355 CACAGAGAGAGAAAGTAGAGTGG + Intronic
1102270448 12:111530471-111530493 ATAAGAAAGGGGAAGTAAAATGG + Intronic
1102439216 12:112948730-112948752 CTCAGAGAGGGGAAGTGGGAGGG - Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102566804 12:113802420-113802442 GACTGAAATGGGAGGTAGAAAGG - Intergenic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102685145 12:114718743-114718765 CACAGAAAGCACAGGTAGAAGGG - Intergenic
1102907988 12:116691992-116692014 CATAGAGACAGGAAGTAGAATGG + Intergenic
1103006409 12:117423853-117423875 CAGAGAAAGGGGAAGAACAAAGG + Intronic
1103282786 12:119774107-119774129 CATAGAAACAGAAAGTAGAAAGG + Intronic
1103358375 12:120338796-120338818 CACAGAAACAAGAAGTAGAATGG - Intergenic
1103472329 12:121191849-121191871 GACAGAACGGGGAAGGAGAAGGG - Intergenic
1103676258 12:122658203-122658225 CACAGAACTGGCAAGTAGCAAGG - Intergenic
1103962790 12:124619802-124619824 CACAGATACAGAAAGTAGAATGG + Intergenic
1104167779 12:126250699-126250721 CACAGGGAGTGGAAGTACAAAGG - Intergenic
1104494333 12:129222708-129222730 CACAGAAATGGTGAGTAGAAGGG + Intronic
1104569911 12:129916125-129916147 CTCAGAAAGGGGAAGTAACTTGG - Intergenic
1104578025 12:129986184-129986206 CAAAGAAGGGGGAAATAAAATGG + Intergenic
1105350277 13:19608691-19608713 CATTGAAATGGAAAGTAGAATGG - Intergenic
1105460714 13:20583251-20583273 CATAGAAATAGAAAGTAGAATGG - Intronic
1105551480 13:21400544-21400566 CACAGAAATAGAAAGTAGGATGG + Intronic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105693207 13:22862282-22862304 CAGAGAAACAGAAAGTAGAATGG - Intergenic
1105738430 13:23296613-23296635 CACAGAGACAGAAAGTAGAATGG - Intronic
1105762929 13:23530209-23530231 CATCAAAAGGGGAAGGAGAAGGG + Intergenic
1105829017 13:24147786-24147808 CTCAGAAAAGGAAAGTAGAATGG - Intronic
1106191642 13:27458794-27458816 CACTGAAACTGGAATTAGAAAGG - Intergenic
1106331356 13:28742510-28742532 CACACATAGAGAAAGTAGAATGG - Intergenic
1106346477 13:28884360-28884382 CATAGAGACAGGAAGTAGAATGG + Intronic
1106351196 13:28932187-28932209 CACAGAGAGTGGAAATAGTAAGG + Intronic
1106351366 13:28933806-28933828 CACAGAGAGTGGAAATAGTAAGG - Intronic
1106360907 13:29029705-29029727 CACTCAAGGGGGAAGAAGAAGGG + Intronic
1106447979 13:29853390-29853412 CATAGAAACAGAAAGTAGAATGG - Intergenic
1106606794 13:31235851-31235873 CACAGAAACAGCAAGTAGAATGG - Intronic
1106849039 13:33768695-33768717 CTCAGAAAAGGAAAGGAGAACGG + Intergenic
1107050852 13:36047644-36047666 CATAGAAATGGAGAGTAGAAAGG + Intronic
1107134371 13:36927402-36927424 CACAGAGACAGAAAGTAGAAAGG - Intergenic
1107155136 13:37157369-37157391 CAAAGAAACAGAAAGTAGAAAGG - Intergenic
1107171854 13:37352067-37352089 GACAAATAGGGGCAGTAGAAAGG - Intergenic
1107482968 13:40800361-40800383 CACAGAAAGGGCAGGCAGGAAGG + Intronic
1107640460 13:42437936-42437958 CATAGAAACAGAAAGTAGAATGG - Intergenic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108129675 13:47284630-47284652 CACAGAATAGGGAGGCAGAATGG + Intergenic
1108206593 13:48095817-48095839 TACAGCAATGGAAAGTAGAATGG - Intergenic
1108393700 13:49972834-49972856 ACCAGAAAGTGAAAGTAGAAGGG - Intergenic
1108430132 13:50345015-50345037 CACAGAGACAGAAAGTAGAATGG - Intronic
1108510821 13:51154025-51154047 CATAGAGATAGGAAGTAGAATGG - Intergenic
1108522238 13:51256872-51256894 CACAGAAACAGATAGTAGAATGG - Intronic
1108609561 13:52070797-52070819 TACAGCAAGGGGAAGGAAAAGGG + Intronic
1108637981 13:52354861-52354883 TATAGAAAGAGGAAGTAGACAGG - Intergenic
1108825486 13:54407953-54407975 CACAGACAGGGGAAGAACTAAGG + Intergenic
1109218794 13:59619472-59619494 CACATAAAGGAGAAAGAGAAAGG + Intergenic
1109894311 13:68664148-68664170 AGGGGAAAGGGGAAGTAGAAAGG - Intergenic
1109913784 13:68953036-68953058 TACAGACAGAGGAAGTAGAATGG + Intergenic
1110007979 13:70296199-70296221 CACAGAAGTGGAAAGTAGAATGG + Intergenic
1110068076 13:71134209-71134231 CACAGAGATGGAAAGTAGAATGG + Intergenic
1111207574 13:85032506-85032528 CATAGAAATGGAAAGTGGAATGG - Intergenic
1111355918 13:87102721-87102743 CAGAGAAAGAGAAAATAGAAGGG + Intergenic
1111366704 13:87256551-87256573 CATAGAAACAGAAAGTAGAATGG + Intergenic
1111539522 13:89652446-89652468 CACAGTAATAGAAAGTAGAATGG + Intergenic
1111667717 13:91290878-91290900 TACAGAAAGTGGAAGGAAAAAGG - Intergenic
1111863843 13:93743209-93743231 CACTGAAAGGTCAAGTAGACAGG + Intronic
1112267656 13:97940160-97940182 CACAGAGACAGAAAGTAGAATGG + Intergenic
1112277079 13:98031173-98031195 CACAGAGACAGAAAGTAGAATGG - Intergenic
1112321475 13:98411725-98411747 GAAAGAAAGGGGAAGCAGTAAGG + Intronic
1112701614 13:102016642-102016664 TACAAAAAGAGGAAGAAGAAAGG - Intronic
1113486697 13:110658328-110658350 CATAGAAACAGAAAGTAGAAGGG + Intronic
1113498229 13:110750790-110750812 CAGAGAATGGAGAAATAGAAAGG - Intergenic
1113536436 13:111070201-111070223 CACAGAGACAGAAAGTAGAATGG - Intergenic
1113703383 13:112406281-112406303 CATAGAAACAGAAAGTAGAATGG - Intronic
1113746101 13:112745954-112745976 CACAGACAGAGAAAGCAGAACGG - Intronic
1113781690 13:112980990-112981012 CACAGGAAGGGGACGTATCAGGG - Intronic
1114292448 14:21299675-21299697 CACAGAAAGGTTAAGTGGCATGG + Intronic
1114636725 14:24191385-24191407 CACAGAATTGGGAACAAGAAGGG + Intronic
1114670170 14:24406745-24406767 CAAAGAAAGGGGATGTGGAGGGG + Intronic
1115033174 14:28823326-28823348 CACAGAAGCAGGAAGTAGAATGG + Intergenic
1115426851 14:33270309-33270331 AAAAGGAAGGGGTAGTAGAAAGG + Intronic
1115873467 14:37833743-37833765 CACACAAAGGAGAAGGTGAAAGG - Intronic
1116186188 14:41604310-41604332 CAAAGAGAGAGGAAGAAGAAAGG - Intergenic
1116279035 14:42877888-42877910 CTCAGAAATGGGAAGCAGAATGG + Intergenic
1116318996 14:43435635-43435657 GAGAGAAAGGGGAAGTGGTAGGG + Intergenic
1116423282 14:44759329-44759351 CATAGAAATGGAAAGTAGAACGG + Intergenic
1116513498 14:45777175-45777197 CACAGAAGCAGGGAGTAGAATGG - Intergenic
1116523803 14:45880452-45880474 AGCAGAAAGGGGAACTGGAAGGG - Intergenic
1116563556 14:46415551-46415573 CTCAGAAAGGAGGAGGAGAAGGG + Intergenic
1116965667 14:51012261-51012283 CATAGAGAAAGGAAGTAGAATGG - Intronic
1117931139 14:60841182-60841204 GACAGAAAGGGGAGATACAAAGG - Intronic
1118310821 14:64691611-64691633 CATAGAAACAGAAAGTAGAATGG - Intergenic
1118561243 14:67085895-67085917 CACAGAGATAGAAAGTAGAATGG - Intronic
1118697030 14:68395197-68395219 CAAAGAGAGGAGAGGTAGAAAGG - Intronic
1118728134 14:68645183-68645205 CACAGAGACAGAAAGTAGAATGG - Intronic
1119086482 14:71743950-71743972 CACAGAGAGGAGCAATAGAAGGG - Intergenic
1119584939 14:75824529-75824551 CATAGAAACAGAAAGTAGAAAGG + Intronic
1119801600 14:77450160-77450182 CATAGAGACAGGAAGTAGAATGG - Intronic
1120034133 14:79676371-79676393 CATAGAAAGAGAAAGTAAAATGG - Intronic
1120114502 14:80597914-80597936 CTCAGAAAAAGGAACTAGAAGGG + Intronic
1120525375 14:85570933-85570955 CAAAGAAAAGGCAAGTATAATGG - Intronic
1120920107 14:89746928-89746950 GACAGAAGGGGAAAGGAGAATGG + Intergenic
1121062763 14:90931340-90931362 CACAGAAATAGAAAGTAGAATGG + Intronic
1121178624 14:91910330-91910352 CATAGAAACAGAAAGTAGAATGG + Intronic
1121212330 14:92217144-92217166 CATAGAAACAGAAAGTAGAATGG + Intergenic
1121300693 14:92868345-92868367 CATAGAAACAGAAAGTAGAATGG + Intergenic
1121537456 14:94700535-94700557 CACAGAAACGGCAAATAGAATGG - Intergenic
1121593286 14:95137241-95137263 AAGAGAAAGGGGAAATAAAAAGG + Intronic
1121659877 14:95626739-95626761 CACAGAGACAGAAAGTAGAATGG - Intergenic
1122017020 14:98804945-98804967 CATAGAGATGGGAAGTACAATGG + Intergenic
1122185509 14:99990529-99990551 CATAGAAACGGAAAGAAGAAAGG - Intronic
1122639231 14:103147689-103147711 CATAGAGATGGAAAGTAGAATGG + Intergenic
1123685486 15:22794309-22794331 CATAGAGACAGGAAGTAGAATGG + Intronic
1123894937 15:24819183-24819205 CACAGAATTAGAAAGTAGAATGG + Intergenic
1124047833 15:26166671-26166693 CATAGAGACAGGAAGTAGAAAGG - Intergenic
1124365246 15:29066509-29066531 CATAGAAACAGGAAGTAGAGTGG + Intronic
1124366384 15:29074454-29074476 CACAGAAACAGAAAGTAGAATGG + Intronic
1124385499 15:29205009-29205031 CACAGAGAGAGAAAGTAGAATGG - Intronic
1124424046 15:29548031-29548053 CATAGAAACAGAAAGTAGAAGGG + Intronic
1124798273 15:32804074-32804096 CACAGAGACAGAAAGTAGAACGG + Intronic
1124810230 15:32929616-32929638 CAAAGGAATGGAAAGTAGAATGG - Intronic
1125173590 15:36794479-36794501 CATAAAAAGAGGAAGTAGAAAGG - Intronic
1125331793 15:38589774-38589796 AACAGAAAAGGGATGAAGAAAGG - Intergenic
1125742648 15:41977431-41977453 CACAGAAGCAGAAAGTAGAATGG + Intergenic
1125974227 15:43936868-43936890 CACAGTAAAGGCAAGTAAAATGG + Intronic
1126249970 15:46555876-46555898 CCCAGGAAGGGAAAGGAGAAGGG + Intergenic
1127113926 15:55705456-55705478 CACAAAAAGAATAAGTAGAAAGG - Intronic
1127369201 15:58321369-58321391 CATAGAGAGAGAAAGTAGAATGG + Intronic
1127712872 15:61618832-61618854 CACAGCAACAGAAAGTAGAATGG + Intergenic
1127920574 15:63491246-63491268 CAAATAATGGGGATGTAGAAAGG - Intergenic
1128266896 15:66274661-66274683 CATAGAAAAAGAAAGTAGAATGG + Intergenic
1128379193 15:67099033-67099055 CACAGAAAGGAGAATTATCATGG - Intronic
1128534743 15:68481949-68481971 CACAAAAGGGGGAAATAGAATGG + Intergenic
1128681484 15:69655534-69655556 CACAGAGACAGAAAGTAGAATGG - Intergenic
1129111040 15:73337291-73337313 CACAGAAGTGAGAAGTAGAGAGG - Intronic
1129129662 15:73482124-73482146 CATAGAAACTGAAAGTAGAATGG - Intronic
1129198910 15:73986983-73987005 CTCAGAGAGGGGAGGCAGAAGGG + Intronic
1129234432 15:74215334-74215356 CACAGAGACGGAAAGTAGAATGG + Intergenic
1129409868 15:75344167-75344189 CACAGAAGCAGCAAGTAGAATGG - Intergenic
1129449255 15:75640786-75640808 CACAGAAAAGGGATCTATAAGGG + Intronic
1129606256 15:77026500-77026522 CACAGAGATGGGAAGTGGTATGG - Intronic
1129950309 15:79581659-79581681 CATAGAAATAGAAAGTAGAATGG - Intergenic
1130203858 15:81857728-81857750 CACAGAAACAGCAAGCAGAATGG + Intergenic
1130350488 15:83087082-83087104 CACAGAAAGGTTAAGTAAATTGG - Intergenic
1130421787 15:83755449-83755471 CACAGAGACAGAAAGTAGAATGG - Intronic
1130789032 15:87132489-87132511 CACTGAAAGGGAGAGTAGAATGG + Intergenic
1130972751 15:88746916-88746938 TACAGAAAAGGAAAGTGGAATGG + Intergenic
1131219800 15:90573086-90573108 CATAGAAACAGAAAGTAGAATGG - Intronic
1131416291 15:92261770-92261792 CACAGAGACAGAAAGTAGAATGG + Intergenic
1131575855 15:93590300-93590322 CACAGAAAGGGAAAACAGAAAGG + Intergenic
1131642129 15:94303938-94303960 AACAGGAAGAGGAGGTAGAAAGG + Intronic
1131819583 15:96258647-96258669 TACATAAAGGAGAAGAAGAAAGG + Intergenic
1132007555 15:98243069-98243091 CATAGAAACAGAAAGTAGAATGG + Intergenic
1132024064 15:98390116-98390138 CATAGAAACAGAAAGTAGAATGG + Intergenic
1132057963 15:98666693-98666715 CATAGAGACGGAAAGTAGAATGG + Intronic
1132210465 15:100018101-100018123 CACAGAAACAGAAAGTAGCATGG - Intronic
1132407022 15:101549169-101549191 AACAGAGACGGAAAGTAGAATGG + Intergenic
1133538113 16:6721621-6721643 CACAAAGAGGGAAAGTGGAATGG - Intronic
1133692567 16:8230695-8230717 CACAGCAGGGGAAAGGAGAAGGG + Intergenic
1134205449 16:12233789-12233811 CACAGAGACAGGAAGGAGAATGG - Intronic
1134305279 16:13026258-13026280 CAAAGAAACAGAAAGTAGAAGGG - Intronic
1134323611 16:13186752-13186774 CATAGAGATGGAAAGTAGAATGG - Intronic
1134584603 16:15398936-15398958 CAATGAAAGGGGAAGTGGAAGGG + Intronic
1134599903 16:15525179-15525201 AACAGAAAGGGTGAGTAGGAGGG + Intronic
1134664353 16:16007918-16007940 GAGAGATAGAGGAAGTAGAAGGG - Exonic
1135228510 16:20682849-20682871 GACAGAAAGGGGAAAAGGAAGGG - Intronic
1135535791 16:23293472-23293494 CATAGAGACAGGAAGTAGAATGG + Intronic
1135612634 16:23881858-23881880 CATAGAAACAGGAAGCAGAATGG - Intronic
1135624376 16:23981997-23982019 AAGGGAAAGGGGAAGTGGAAGGG - Intronic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1135873562 16:26175711-26175733 CACAGAAAGGGGAAGGGAAGAGG - Intergenic
1136094100 16:27941904-27941926 CATAGAGATAGGAAGTAGAATGG + Intronic
1136244370 16:28965184-28965206 CACAGGAAGGGAAACCAGAAAGG - Exonic
1137259768 16:46816189-46816211 CACAGACAGAGAAAGCAGAATGG + Intronic
1137439756 16:48488251-48488273 CAAAGAAATGAGAGGTAGAAAGG - Intergenic
1137636264 16:49989294-49989316 CACAGAAACAGAAAGTAGAATGG + Intergenic
1137689709 16:50414414-50414436 GAGAGAAAGGGGAAGGGGAAGGG - Intergenic
1137963147 16:52905784-52905806 CACTGAAACAGAAAGTAGAATGG + Intergenic
1138222071 16:55260404-55260426 CAGAGAAAAGGAAAGAAGAATGG - Intergenic
1138485048 16:57335492-57335514 CACAGAGACAGGAAGTACAATGG - Intergenic
1138721996 16:59092908-59092930 GAGTGAAAGGGGAAGTAGAAGGG - Intergenic
1138909260 16:61376677-61376699 AACAGACAGGGAAAATAGAAAGG - Intergenic
1138993088 16:62415970-62415992 CACAGAAATGAGAAAGAGAAAGG - Intergenic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139609109 16:68042050-68042072 CATAGAAATAGAAAGTAGAATGG - Intronic
1139724894 16:68889443-68889465 CACAGAAAGGGAGAGTGAAAGGG - Intronic
1140005986 16:71075674-71075696 AACAGGAAGAGGAAGTGGAAAGG + Intronic
1140100558 16:71912790-71912812 CAGAGAAACAGAAAGTAGAATGG - Intronic
1140701503 16:77585822-77585844 CATCGAAAGGGGAAGCTGAAAGG + Intergenic
1140834381 16:78779825-78779847 GAAGGAAAGGGGAAGGAGAAGGG + Intronic
1141956367 16:87374447-87374469 CACTGAAAGTGGAAACAGAATGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144193946 17:12872799-12872821 AAAAGAAAGGGAAAATAGAATGG - Intronic
1144348984 17:14376065-14376087 CATAGAAACAGAAAGTAGAACGG - Intergenic
1144353556 17:14422851-14422873 CTCAGAAGCAGGAAGTAGAATGG + Intergenic
1144941732 17:18946891-18946913 CACAAAGAGGGAAAGTAGATTGG + Intergenic
1145286590 17:21510899-21510921 CATAGAAACGGAGAGTAGAACGG - Intergenic
1145725921 17:27124188-27124210 CAAAGAAAGGAGAAGATGAAGGG - Intergenic
1146055442 17:29578497-29578519 CTCAGAATGGGAAAGTGGAAAGG + Intronic
1146233366 17:31133174-31133196 CATAGAAACAGAAAGTAGAATGG - Intronic
1146449141 17:32958242-32958264 CACAGAGACAGAAAGTAGAATGG - Intergenic
1146464707 17:33077121-33077143 CACAGAAGGGACAAGCAGAAGGG - Intronic
1146500078 17:33356575-33356597 AGCAGGAAGGGGAACTAGAAAGG + Intronic
1146606399 17:34261820-34261842 CATAGAAGAGGAAAGTAGAATGG - Intergenic
1146694822 17:34900634-34900656 CACAGAAAGGGAAATGAAAATGG + Intergenic
1146962655 17:36997261-36997283 CAAAGAAAGGGGAAGTTTATAGG + Intronic
1147227157 17:38988134-38988156 CACAGAGACAGAAAGTAGAATGG - Intergenic
1147475204 17:40704806-40704828 CACAGAGACAGAAAGTAGAATGG + Intergenic
1147707150 17:42433888-42433910 CACAGAAATGGGAATTACAGGGG - Intergenic
1147759377 17:42787734-42787756 CAAAAAAAGGGGAAATAAAAGGG - Intronic
1147976891 17:44253042-44253064 AACAGAAAGGGGAAGGGGAAGGG + Intronic
1148193809 17:45698955-45698977 GAAGGAAAGGGGAAGAAGAAGGG + Intergenic
1148220222 17:45856023-45856045 CATAGAGACAGGAAGTAGAATGG - Intergenic
1148221335 17:45864659-45864681 CATAGAGAGGGGAGGGAGAAAGG - Intergenic
1148503026 17:48106451-48106473 CAGAGAAAGGGGAAGCACATAGG + Intronic
1148696952 17:49566319-49566341 CAGAGGAAGGGAAAGTGGAAAGG + Intergenic
1148767157 17:50046124-50046146 AAGAGAAAGGGGAAGGGGAACGG + Intergenic
1148792963 17:50183900-50183922 AAATGAAAGAGGAAGTAGAAAGG + Exonic
1149273732 17:55012431-55012453 GAAAGAAAAGGGAAATAGAAGGG - Intronic
1149672966 17:58431889-58431911 CACAGACACAGAAAGTAGAATGG + Intronic
1149674278 17:58445681-58445703 CATAGAAACAGAAAGTAGAATGG + Intronic
1149796000 17:59520510-59520532 CATAGAGACAGGAAGTAGAATGG - Intergenic
1150447231 17:65236020-65236042 CACAGAGACAGAAAGTAGAATGG + Intergenic
1150544963 17:66146701-66146723 CATAGAAACGGAAAGTAGAATGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150603394 17:66670380-66670402 AACAAAAAGAGGAAGTAGGATGG + Intronic
1150870820 17:68909382-68909404 TACAGAAAGAGGAAGTAGGCTGG + Intronic
1151760596 17:76100157-76100179 CACAGAAACAGAAAGTGGAATGG + Intronic
1152012526 17:77727166-77727188 AACAGAAAGGGCAAGGAGAAGGG - Intergenic
1152208794 17:78991798-78991820 AACAGAGAGGGGAAGAAAAAAGG + Exonic
1152393334 17:80016220-80016242 CACAGAGACAGGAAGTGGAATGG + Intronic
1152916856 17:83042549-83042571 CACAGAAAAGGAAACGAGAAGGG + Intronic
1153374674 18:4362532-4362554 CACAGAGACAGAAAGTAGAATGG + Intronic
1153491800 18:5656775-5656797 CATAGAAACAGAAAGTAGAACGG - Intergenic
1153580829 18:6571664-6571686 CAGAGAGAGTGGAAGAAGAAAGG - Intronic
1153706218 18:7748401-7748423 CAGAGGAAGGGGAGGAAGAAGGG - Intronic
1154319605 18:13336583-13336605 CAAAGAAAGGGGTAGAGGAATGG - Intronic
1154938348 18:21085052-21085074 TACAGAAACAGAAAGTAGAATGG + Intronic
1155486387 18:26347424-26347446 TACAGAAAAGAGAAATAGAAAGG + Intronic
1155720480 18:29005173-29005195 ACCATAAAGGGGAAGTTGAAAGG - Intergenic
1156285818 18:35694974-35694996 CATAGAAACAGAAAGTAGAATGG + Intronic
1156314417 18:35953878-35953900 CATAGAAACAGAAAGTAGAAAGG + Intergenic
1156534510 18:37849693-37849715 CATAGAAAGGCCAAGTAAAAGGG - Intergenic
1157170345 18:45398781-45398803 CACAGAGACAGAAAGTAGAATGG + Intronic
1157351398 18:46890142-46890164 CATAGACAGTGGAAGTAGAATGG + Intronic
1157410590 18:47459727-47459749 CAGAGAAGGGGGAAGTAAACTGG + Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157436395 18:47673321-47673343 CACAGAGTGGGGAAGGTGAAAGG + Intergenic
1157535253 18:48452941-48452963 CAAAGAAAGGGGAAGAAGAGAGG + Intergenic
1158332761 18:56380844-56380866 CACTGAAGCAGGAAGTAGAATGG + Intergenic
1158392434 18:57054201-57054223 CATAGAAATAGAAAGTAGAATGG - Intergenic
1158421886 18:57302103-57302125 CACAGAAAGGGGGAGAAAGAAGG + Intergenic
1158438955 18:57456548-57456570 CATAGAAACGGAAAGTACAATGG + Intronic
1158786027 18:60712681-60712703 GAAAGGAAAGGGAAGTAGAAAGG + Intergenic
1158793654 18:60814052-60814074 TACAGAGATGGAAAGTAGAATGG - Intergenic
1158917530 18:62150631-62150653 CATAGAAATAGAAAGTAGAATGG + Intronic
1159156465 18:64589546-64589568 CAGAGAAAGAGGAAGTAAATGGG + Intergenic
1159190016 18:65029186-65029208 CACAGAAACGCAAAGTAGAATGG + Intergenic
1159509823 18:69381796-69381818 GACAGAAAGGGGGAGTAGGAGGG - Intergenic
1159648642 18:70951127-70951149 CATAGAAATAGAAAGTAGAATGG + Intergenic
1159683453 18:71385428-71385450 CTCAGAAATGGAATGTAGAATGG + Intergenic
1159878615 18:73836473-73836495 CCCAGAAACAGGGAGTAGAAGGG - Intergenic
1161146962 19:2684683-2684705 CACAGAGACGGAAAGTAGGATGG + Intronic
1161694822 19:5760549-5760571 CACAGAGACAGGAAGTAGGATGG + Intronic
1161787878 19:6339421-6339443 CACAGAGACAGGAAGTAGAACGG + Intergenic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1161942126 19:7411791-7411813 CATAGAGACAGGAAGTAGAATGG - Intronic
1161999994 19:7738166-7738188 CATAGAAACAGAAAGTAGAATGG + Intergenic
1162072566 19:8163105-8163127 CACAGAGACAGAAAGTAGAATGG + Intronic
1162082653 19:8227782-8227804 CACACAGAGAGAAAGTAGAATGG + Intronic
1162181534 19:8872366-8872388 CACAGAGACAGAAAGTAGAATGG + Intronic
1162681510 19:12346895-12346917 CACAGACAGAGAAAGTAGAATGG + Intergenic
1162690508 19:12426029-12426051 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1162992099 19:14310105-14310127 CACAGAAAGGGAAAGTTGGTGGG - Intergenic
1163132947 19:15287631-15287653 CACAGAGACAGAAAGTAGAATGG - Intronic
1163285134 19:16342087-16342109 CATAGAGACAGGAAGTAGAATGG + Intergenic
1163367736 19:16885297-16885319 CATAGAGACAGGAAGTAGAATGG - Intergenic
1163370894 19:16900707-16900729 CCCAGAAAGGGGAGGAAAAAAGG + Intronic
1164926879 19:32137623-32137645 CCCAGAAAGTGGAAGGAGAAAGG + Intergenic
1164968209 19:32505986-32506008 CATAGAGATGGGAAGTAGAGTGG + Intergenic
1164992650 19:32695645-32695667 ATCAAAAAGGGGAAGGAGAAGGG - Intronic
1165123049 19:33574903-33574925 CACAGAACTGGGAATTAGAATGG + Intergenic
1165638157 19:37361481-37361503 CACAGAAAAGAGAAAGAGAAAGG - Intronic
1165671838 19:37686517-37686539 CACAGACTGGAGAAGGAGAATGG + Exonic
1166201595 19:41240998-41241020 CACAGAAAGGGGGTGTAAAAAGG - Intronic
1166302708 19:41921444-41921466 CACAGAAACAGGAAGCAGACTGG + Intronic
1166590406 19:43992745-43992767 CACAGCAAGGGGGATTAAAACGG - Intronic
1167458070 19:49608931-49608953 GACAGACGGGGGAAGGAGAATGG - Intronic
1167812383 19:51845656-51845678 CATAGAAATGGAGAGTAGAATGG - Intergenic
1168408677 19:56124706-56124728 CATAGAGACAGGAAGTAGAATGG + Intergenic
925655191 2:6139335-6139357 CACAGGAAGTAGAAGAAGAATGG - Intergenic
926426322 2:12741557-12741579 GAAAGAAAAGGGAAGAAGAAAGG + Exonic
927368116 2:22322794-22322816 CAAAGAAATGGAGAGTAGAATGG + Intergenic
927441741 2:23123563-23123585 CTCAGGAAGGGGGAGAAGAAAGG - Intergenic
927493386 2:23535710-23535732 CATAGAGACGGAAAGTAGAACGG + Intronic
927838987 2:26425113-26425135 CACAGAAACAGAAAGTAGAAAGG - Intronic
928104335 2:28458114-28458136 CATAGAGACAGGAAGTAGAAGGG + Intronic
928112299 2:28520634-28520656 AACAGAGAGGGAAAGTAGAATGG - Intronic
928168516 2:28988363-28988385 GAGAGAAAGGGCACGTAGAACGG - Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928468557 2:31549031-31549053 CATAGAAACAGAAAGTAGAATGG + Intronic
928764701 2:34630415-34630437 CACAGAAGTGGAGAGTAGAATGG + Intergenic
928875125 2:36029133-36029155 CACAGAAAGAGATAGTACAATGG - Intergenic
928877510 2:36057275-36057297 CACAGCAAGGTTAAGTAAAATGG - Intergenic
929189798 2:39129084-39129106 CATAGAAACAGAAAGTAGAATGG - Intergenic
929303786 2:40336162-40336184 CACATAAAGTGGAATTAGGATGG - Intronic
929330675 2:40676596-40676618 TTCAAAAAGGGGAAGGAGAAGGG + Intergenic
929964841 2:46526571-46526593 CACAGAGACAGGAAGTAGAATGG - Intronic
930159270 2:48137713-48137735 CCCAAAAAGGGAAATTAGAAAGG + Intergenic
930399983 2:50872098-50872120 CACATAAAGGGGAAAAAGAATGG - Intronic
930461688 2:51687475-51687497 CACAGAAAGGGCAAATATGAGGG + Intergenic
930477815 2:51906235-51906257 CACAGATAGAGAAAGTAGAATGG + Intergenic
930710540 2:54547153-54547175 CATGGAAAGAGAAAGTAGAATGG - Intronic
931502200 2:62881455-62881477 GAAAGGAAGGGGAAGGAGAAGGG + Intronic
931828061 2:66022021-66022043 AACTGAAAGGGGAAGTAGCCTGG - Intergenic
931841425 2:66153828-66153850 CACACAAATGGGAAATAAAAAGG - Intergenic
932090082 2:68798753-68798775 CAGAAAAGGGGGAAGCAGAATGG + Intronic
932227718 2:70056146-70056168 CATAGAAACAGAAAGTAGAATGG + Intergenic
932294075 2:70609795-70609817 CACAGGAAGGGGCAGTACCATGG - Intronic
932386904 2:71343348-71343370 AACAAAAAGGGGAAAAAGAAGGG + Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
932661236 2:73654455-73654477 CACAGAGACAGAAAGTAGAATGG - Intergenic
932867284 2:75357170-75357192 CACAGAGAGGGTAAGTAAAATGG + Intergenic
932872092 2:75411894-75411916 CACAGAAACAGAGAGTAGAATGG + Intergenic
932947521 2:76253747-76253769 TACAGAAATAGAAAGTAGAAGGG + Intergenic
932952231 2:76307169-76307191 CACAGAAACAGAAAGCAGAATGG - Intergenic
933225627 2:79745616-79745638 CATAGAAAAAGAAAGTAGAATGG - Intronic
933939024 2:87230206-87230228 CATAGAGACAGGAAGTAGAATGG - Intergenic
933988400 2:87613253-87613275 CCCAGAAAGGGGCACCAGAAAGG + Intergenic
934020530 2:87947088-87947110 CCCAGAAAGTGAAAGTAGAATGG + Intergenic
934651849 2:96097022-96097044 CATAGAGACGGGGAGTAGAATGG + Intergenic
934867545 2:97826477-97826499 CATCAAAAGGGGAAGGAGAAGGG + Intronic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935212610 2:100951634-100951656 CATAGAAACAGAAAGTAGAATGG + Intronic
935637088 2:105257446-105257468 CATACAGATGGGAAGTAGAATGG - Intergenic
935672966 2:105571261-105571283 CACAGAGACAGAAAGTAGAATGG - Intergenic
935682240 2:105647935-105647957 CACAGAAAGGGGTAGGGGAAAGG + Intergenic
935716725 2:105945838-105945860 CATAGAGATGGAAAGTAGAATGG + Intergenic
935768394 2:106392552-106392574 CACAGTCAGGAGAAATAGAAAGG - Intronic
936099076 2:109559478-109559500 CAAAGAAGGGGAAATTAGAAAGG - Intronic
936305441 2:111337555-111337577 CCCAGAAAGGGGCACCAGAAAGG - Intergenic
936895107 2:117418739-117418761 GACAGAAAGGACAAGTAGCAGGG + Intergenic
938253892 2:129838278-129838300 CACAGAAATAGAGAGTAGAATGG + Intergenic
938344268 2:130556258-130556280 CCTAGAAACAGGAAGTAGAATGG + Intergenic
938345565 2:130564464-130564486 CCTAGAAACAGGAAGTAGAATGG - Intergenic
938929158 2:136071086-136071108 CTCAGAAACAGAAAGTAGAAAGG + Intergenic
938968480 2:136409003-136409025 CTCAGAAACAGAAAGTAGAATGG - Intergenic
939054012 2:137340610-137340632 CATAGAAACAGAAAGTAGAATGG - Intronic
939095596 2:137830203-137830225 CGCAGAAAGGAGAAGCAGGAAGG - Intergenic
939272219 2:139954625-139954647 CACAGAAACAGTGAGTAGAATGG + Intergenic
939983129 2:148804792-148804814 CTCAGAAAAGAGGAGTAGAAAGG - Intergenic
940259546 2:151765802-151765824 CACAGAGTGGGGAAGGAGATGGG + Intergenic
941140638 2:161776391-161776413 CACAGAAACAGAAGGTAGAATGG - Intronic
941215838 2:162707992-162708014 AAGAGAAATGGGAAGTAGATGGG - Intronic
941419771 2:165268946-165268968 CACAGAAACAGAAAGTAGAATGG + Intronic
941716119 2:168765154-168765176 CACAGAGACAGGAAGGAGAATGG + Intronic
941903303 2:170697806-170697828 CATAGGAACAGGAAGTAGAATGG + Intergenic
941957347 2:171218322-171218344 CATAGAGACGGAAAGTAGAATGG + Intronic
942203558 2:173596098-173596120 CATAGAAATAGGGAGTAGAATGG + Intergenic
942254691 2:174085148-174085170 CACAGCAAGGGGACAAAGAAAGG + Intronic
942609733 2:177730973-177730995 CATAGAAACAGAAAGTAGAATGG - Intronic
942650326 2:178160172-178160194 CATAGAAACAGAAAGTAGAAGGG - Intergenic
942653513 2:178193184-178193206 CTCAGAAGGAGTAAGTAGAAAGG + Intergenic
942877367 2:180817091-180817113 CACAGAAATAGGAAGTAGAGTGG + Intergenic
943055839 2:182977664-182977686 CACAGAAACAGAAAGTTGAATGG + Intronic
943121034 2:183735967-183735989 TACAGAATGGGGAAGGAGATGGG - Intergenic
943649609 2:190442707-190442729 TTCAGAAAGGAGATGTAGAATGG + Intronic
943762917 2:191629354-191629376 CTCAGAAACGGAAAGTAGAATGG - Intergenic
944032247 2:195249407-195249429 CACAGAAGCAGAAAGTAGAAGGG + Intergenic
944116150 2:196188481-196188503 ACCAGAAAGGAGAATTAGAATGG + Intergenic
944291279 2:198008393-198008415 CATAGAAACAGAAAGTAGAATGG - Intronic
944420397 2:199524118-199524140 AACAGAAAGAGAAAGTATAAAGG - Intergenic
944952195 2:204764426-204764448 CACAGAAAAGGGAATTTGCACGG - Intronic
945039657 2:205733360-205733382 CACACAGAGGGGATGTGGAAGGG + Intronic
945064980 2:205940743-205940765 CACAGAAATTGGAAGGAAAAGGG + Intergenic
945360368 2:208888930-208888952 TACAGAAAGGGAAAGTTGTACGG + Intergenic
945693463 2:213071655-213071677 CACAGAATTGGGAAGAAGAAAGG + Intronic
946012886 2:216580643-216580665 GAAAGAAAAGGGAAGGAGAAGGG - Intergenic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
946952979 2:224897574-224897596 CACAGAGAAAGGGAGTAGAAGGG - Intronic
947073518 2:226317488-226317510 CACATAAAAGGGAAATAGAGGGG - Intergenic
947672939 2:231951805-231951827 CACAGAAACAGAAAGTAGATTGG + Intergenic
948114070 2:235480734-235480756 CACAGAAACAGAAAGTAGAATGG + Intergenic
949045171 2:241869602-241869624 CCGAGAAATGGGAAGCAGAAAGG - Intronic
1168741041 20:191708-191730 AAAAGGAAAGGGAAGTAGAAGGG - Intergenic
1169225623 20:3854842-3854864 CACAGCAAGAGGAAGAAGGAAGG - Intronic
1169237321 20:3941362-3941384 CACAAAGAGGGGAAGGAAAAGGG + Intronic
1169295351 20:4392367-4392389 CACAGAAAGATGAAGAAAAAGGG - Intergenic
1169404633 20:5313627-5313649 AACACAAAGGGAAAGCAGAAAGG - Intronic
1169655248 20:7915371-7915393 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1169682153 20:8227535-8227557 CACTGAGAGGGGAAGTGGCAAGG - Intronic
1169717360 20:8635277-8635299 GAAGGAAAGGGGAAGGAGAAGGG + Intronic
1170631346 20:18068927-18068949 CATAGAAGGAGAAAGTAGAAGGG - Intergenic
1170777958 20:19395144-19395166 CACAGAAACAGGAAGTTGGATGG + Intronic
1170839615 20:19913615-19913637 CATAGAAACAGGAAGCAGAAGGG - Intronic
1172164449 20:32890414-32890436 CACTGAAAGGGGACCTTGAAGGG - Intronic
1172190054 20:33056516-33056538 CAGAGAGAGTGGAAGTAGGAAGG - Intronic
1172336573 20:34121590-34121612 CATAGAAAGAGAAAGTAGAATGG + Intergenic
1172811257 20:37649939-37649961 CTCAGAAAGGAAAAGAAGAAGGG + Intergenic
1173198985 20:40939920-40939942 CATAGAAGGAGGGAGTAGAATGG - Intergenic
1173285217 20:41664705-41664727 TAGAGAAAGAGGAAGGAGAAAGG + Intergenic
1173388074 20:42607146-42607168 CATAGAGACAGGAAGTAGAATGG + Intronic
1173612346 20:44378987-44379009 CACAGAGACAGAAAGTAGAAGGG - Intronic
1174313732 20:49680560-49680582 CACAGACACGGAAAGTAGAATGG + Intronic
1174507238 20:51024287-51024309 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174507241 20:51024319-51024341 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174705055 20:52646959-52646981 TGCTGAAATGGGAAGTAGAAGGG - Intergenic
1175303956 20:57963315-57963337 CACAGAGACGGGAAGTAGAATGG + Intergenic
1175679932 20:60978587-60978609 CACAGAGACAGGAAGTAGATTGG - Intergenic
1176128395 20:63486105-63486127 CACACAAAAGGGAGGTAGAATGG - Intergenic
1177007069 21:15686692-15686714 AAAAGAAAGGGGAAGAAGAGAGG - Intergenic
1177076855 21:16586891-16586913 CACAGAAATGGGAAGAGGGAAGG - Intergenic
1177235008 21:18377395-18377417 CTCAGAAGGGGGAAGGAGTAGGG + Intronic
1177953360 21:27566650-27566672 AAGAGAAAGGGGGAGAAGAATGG + Intergenic
1178106827 21:29328732-29328754 CACAGAAACAGAGAGTAGAATGG - Intronic
1178370079 21:32020270-32020292 CACAGAGACAGAAAGTAGAACGG - Intronic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1178982554 21:37277152-37277174 CACAGAAAAGAGAAATACAATGG + Intergenic
1178988966 21:37335677-37335699 CATAGAAACAGAAAGTAGAATGG - Intergenic
1179030126 21:37712775-37712797 GATAGAAGGGAGAAGTAGAAGGG - Intronic
1179245098 21:39626113-39626135 CATAGAAACAGGAAATAGAATGG - Intronic
1179311560 21:40200335-40200357 CATAGAGACGGAAAGTAGAATGG - Intronic
1179484831 21:41703601-41703623 CATAGAGACAGGAAGTAGAAGGG + Intergenic
1179505516 21:41837494-41837516 CACAGAGACAGAAAGTAGAATGG + Intronic
1180060601 21:45383097-45383119 CACAGAATGGGAAAGGAGACGGG + Intergenic
1180112571 21:45669610-45669632 CATAGAAACAGAAAGTAGAATGG - Intronic
1180126544 21:45794516-45794538 CACCAAAAGGTGGAGTAGAATGG + Intronic
1181532418 22:23524285-23524307 CCCAGAAAGGGGAAAGAGATGGG + Intergenic
1181891482 22:26067368-26067390 CACAGAAATGGTAAGTGCAAGGG - Intergenic
1181923515 22:26339316-26339338 CAGAGAGAGGGAAAGAAGAAAGG + Intronic
1182002287 22:26929617-26929639 CACAGAGACAGAAAGTAGAATGG - Intergenic
1182057624 22:27372365-27372387 AACAGCAAGGGGAAGTAGCCAGG + Intergenic
1183225147 22:36544730-36544752 CAGAGACAGGGGAGGTAGAGTGG - Intergenic
1183270411 22:36858759-36858781 CACAGATTGGTGAAGAAGAAAGG + Intergenic
1183316258 22:37138680-37138702 CCCAGAAAGAGGAGGTACAAAGG + Intronic
1184051337 22:42007588-42007610 CATAGAAACAGAAAGTAGAATGG - Intronic
1184366415 22:44054524-44054546 CATAGAGAGAGGAAGTGGAATGG + Intronic
1184756820 22:46520914-46520936 CATAGAGACAGGAAGTAGAATGG - Intronic
1184877589 22:47285293-47285315 AACAGAAATGGGAAGAAGACAGG - Intergenic
1184934043 22:47706008-47706030 CACAGAAAGGGAAACTTGAATGG - Intergenic
949418218 3:3836377-3836399 CATAGAAACAGAAAGTAGAAAGG - Intronic
949610375 3:5698129-5698151 TACAGCAAGGGGAAGATGAAGGG - Intergenic
949657895 3:6242398-6242420 CACAGGAAGGGGATGTAGTGTGG + Intergenic
949914174 3:8944587-8944609 AATAGAGAGGGGAAGGAGAAAGG + Intronic
950783904 3:15416617-15416639 CTCATCAAGGGGAATTAGAAGGG - Intronic
950823140 3:15784576-15784598 CACAGAAGGCAGAAGAAGAATGG + Intronic
950921966 3:16703910-16703932 CACAGAAGGGGAAAGTGGAAAGG + Intergenic
951297886 3:20961542-20961564 CACAAAAAGAGGAAGAAAAAAGG + Intergenic
951433432 3:22634608-22634630 CATAGAGACGGAAAGTAGAATGG - Intergenic
951484225 3:23194020-23194042 CACAGAAAAGGGAAGAAGCCAGG - Intergenic
951716666 3:25655836-25655858 CATAGAAACAGAAAGTAGAAAGG + Intronic
952210011 3:31221107-31221129 CATAGAAACAGAAAGTAGAAAGG + Intergenic
952603640 3:35115898-35115920 TACAGAAAGAGAAAGTAAAATGG - Intergenic
952787611 3:37171238-37171260 CACAGAAGGGGGAGTTATAAAGG - Intronic
953554649 3:43934246-43934268 CACAGAGAGAGAAAGTAGAATGG - Intergenic
953917355 3:46928837-46928859 CTCAGAAAGGGTAAATACAATGG + Intronic
954288115 3:49633874-49633896 CACAGAGACAGAAAGTAGAATGG + Intronic
954376617 3:50197410-50197432 CATAGAGATGGAAAGTAGAATGG - Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
955207983 3:56914801-56914823 CACAGAGACAGAAAGTAGAATGG + Intronic
955491384 3:59486660-59486682 AACACAAAGGGAAAGAAGAAAGG - Intergenic
955595726 3:60588443-60588465 GAAAGAGAGGGGAAGGAGAAAGG + Intronic
955680282 3:61492961-61492983 CATAGAAACAGAAAGTAGAATGG - Intergenic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
955900116 3:63744555-63744577 CACAGAGACAGAAAGTAGAATGG + Intergenic
955928099 3:64027736-64027758 CACATAAAGGAAAAGTACAAAGG - Intergenic
956169362 3:66420743-66420765 CACTGAAACAGAAAGTAGAATGG + Intronic
956405472 3:68924435-68924457 CAGAGAGACAGGAAGTAGAAAGG + Intronic
956715924 3:72079963-72079985 GAGAGAAAGGGGAAGAAAAAGGG - Intergenic
956765691 3:72482561-72482583 CACAGAGATGGGAAGCAGGAAGG - Intergenic
956826747 3:73004201-73004223 AACAAAAAGGGGAAATAAAAAGG - Intronic
956849759 3:73217968-73217990 CAGAGAAGGGGGAAGAGGAAAGG - Intergenic
956864589 3:73356688-73356710 GAAAGAAAGGGAAAGAAGAAGGG - Intergenic
957640746 3:82850210-82850232 AAGGGAAAGGGGAAGGAGAAGGG - Intergenic
957744921 3:84328024-84328046 CATAGAATGGGGAAGTGGACTGG - Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
958259423 3:91362778-91362800 CATAGAAACAGAAAGTAGAATGG - Intergenic
958482598 3:94662510-94662532 CATAGAGAGAGAAAGTAGAATGG - Intergenic
958729558 3:97947139-97947161 CACATAAAGGGGATGAAGGAAGG + Intronic
959037106 3:101380127-101380149 CATAGAAACTGAAAGTAGAATGG + Intronic
959054904 3:101557818-101557840 TACAGAAACAGAAAGTAGAATGG - Intergenic
959107798 3:102084963-102084985 CACAGAAGCAGAAAGTAGAATGG - Intergenic
959236205 3:103725808-103725830 CATAGAAACAGAAAGTAGAATGG + Intergenic
959275109 3:104268908-104268930 CAAAGAAAGGCGAAGAACAATGG - Intergenic
959313880 3:104777509-104777531 GACAGAAAAGTGAAGTAGGAAGG + Intergenic
959653347 3:108773022-108773044 CAGAGAAAGGGGGAGAGGAAAGG - Intergenic
959654223 3:108782767-108782789 CATAGAAACAGAAAGTAGAAGGG - Intergenic
959659323 3:108848298-108848320 CAGAGAAAGGGTATGTAGAGTGG - Intronic
960109572 3:113832626-113832648 CATAGAGAAAGGAAGTAGAATGG - Intronic
960956572 3:123036038-123036060 CACAGAAACAGAAGGTAGAATGG + Intergenic
960967844 3:123117348-123117370 CATAGAAACAGAAAGTAGAAAGG - Intronic
961044967 3:123701824-123701846 CAATAAAAGGGGAAGGAGAAAGG + Intronic
961192210 3:124971422-124971444 GAAAGAAAGGGAAAGGAGAAAGG - Intronic
961350027 3:126294006-126294028 CACAGAAAGGAGACAGAGAAAGG - Intergenic
961988609 3:131163547-131163569 CACAAAAGGGGAGAGTAGAATGG + Intronic
962030153 3:131591163-131591185 CATAGAAAGAGGAAGAAGAGTGG + Intronic
962268465 3:133960507-133960529 CACAGAAACAGAAAGTAGAATGG + Intronic
962478441 3:135778120-135778142 CACAGGAAGGGGTAGGAGATGGG + Intergenic
962707249 3:138056340-138056362 CATAGAAATAGAAAGTAGAATGG + Intergenic
962769710 3:138600971-138600993 GAAGGAAAGGGGAAGAAGAAAGG + Intergenic
962972450 3:140416163-140416185 CACAGAAATAGAGAGTAGAATGG + Intronic
963158945 3:142130395-142130417 CACAGAGACAGAAAGTAGAATGG + Intronic
963333048 3:143937825-143937847 CACTGAAAAGGGAAGAAAAAGGG - Intergenic
963439947 3:145326883-145326905 CTCAGAAACAGAAAGTAGAATGG - Intergenic
963804379 3:149708506-149708528 CATAGAAAGAGAAAGTAGAATGG - Intronic
963810633 3:149773148-149773170 AAAAGAGAGGGGAAGCAGAAAGG - Intronic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963893512 3:150661238-150661260 AACAGAAATGGGAAGCAGGATGG + Intronic
963930329 3:150997969-150997991 CATAGAAACAGAAAGTAGAATGG + Intergenic
964046938 3:152340007-152340029 CACAGAAAGAGGAGATAAAAAGG + Intronic
965027616 3:163323656-163323678 CACACAAAGGAGAAATAGAAAGG - Intergenic
965403661 3:168244886-168244908 CACAGAAACAGAAAATAGAAAGG + Intergenic
965627561 3:170696806-170696828 CAGAGAAAGGGGAATCTGAATGG + Intronic
966413771 3:179668746-179668768 CACAGAAGGGGGAAATATAATGG - Intronic
966521905 3:180882372-180882394 AGAAGAAAGGGGAAGAAGAAGGG - Intronic
966676545 3:182596202-182596224 CTCAGAGAGGAGAAGTACAAAGG + Intergenic
966742310 3:183245255-183245277 AACAGAAAGGAGAAGGGGAATGG + Intronic
966811937 3:183854540-183854562 CATAGAAAAAGGAAGTAGAATGG + Intronic
966997713 3:185300032-185300054 CTTAGAAATGGGAAGTAGAATGG - Intronic
967389463 3:188941271-188941293 CCCAGAAAGGGGAAATGAAAGGG + Intergenic
967549119 3:190768591-190768613 CACAGAAAGAGAAAGAAGAATGG - Intergenic
968036888 3:195555168-195555190 ACTAGAAAGTGGAAGTAGAAAGG - Intergenic
968056247 3:195694139-195694161 CAGAGAAAAGGGAATGAGAACGG + Intergenic
968169733 3:196500460-196500482 CACAGAAATGGAAAGGAGAACGG + Intronic
968385847 4:136631-136653 CACAGAAAACACAAGTAGAAAGG - Intronic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968677898 4:1894970-1894992 CATAGAGACAGGAAGTAGAATGG - Intronic
969082642 4:4631374-4631396 CACAGAAACAGAAAGTAGAATGG - Intergenic
969083702 4:4640008-4640030 CACAGCAACAGGAAGGAGAATGG + Intergenic
969241782 4:5903597-5903619 CATAGAGATAGGAAGTAGAAGGG + Intronic
969377753 4:6774262-6774284 CATAGAAACAGAAAGTAGAATGG + Intergenic
969421174 4:7097072-7097094 CACAGAGACAGAAAGTAGAATGG + Intergenic
969593685 4:8136247-8136269 CATAGAGATGGAAAGTAGAAGGG + Intronic
970058706 4:12004853-12004875 CATAGAAACAGAAAGTAGAATGG + Intergenic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
970137628 4:12943220-12943242 CACAGAATGATGAAGCAGAATGG - Intergenic
970156409 4:13145855-13145877 CACAGAAAAAGAAAGCAGAATGG + Intergenic
970635307 4:18004049-18004071 CACAGAACTTGTAAGTAGAAGGG + Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971088950 4:23316935-23316957 TAAAGGAAGGAGAAGTAGAATGG - Intergenic
971237143 4:24852894-24852916 CACACAAAGGGAATGTAAAAAGG + Intronic
971302379 4:25452404-25452426 CACAGAGACAGAAAGTAGAATGG + Intergenic
971950440 4:33338560-33338582 CACACAGAAGAGAAGTAGAAGGG - Intergenic
972108682 4:35526689-35526711 CATAGAATCGGGGAGTAGAATGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972332030 4:38072800-38072822 CAGAGAAACAGAAAGTAGAATGG - Intronic
973529312 4:51819132-51819154 AACAGAAATGGGAACCAGAAGGG + Intergenic
974187753 4:58463473-58463495 ATCAAAAAGGGGAAGGAGAAGGG + Intergenic
974410931 4:61539867-61539889 CACAGAAAAGGGAAGCAGAAAGG - Intronic
974544750 4:63286977-63286999 CACAGAAAGCAAGAGTAGAATGG - Intergenic
974578204 4:63757018-63757040 TACAAAAAAAGGAAGTAGAAAGG + Intergenic
974695115 4:65357628-65357650 CACAGAAGCAGAAAGTAGAAAGG + Intronic
974728014 4:65821652-65821674 CATAGTAAGGGAGAGTAGAAAGG + Intergenic
974838438 4:67276920-67276942 ATCAGAAAGGGGAAGGAGAGGGG - Intergenic
974858626 4:67492084-67492106 GAGAGAAAGGGAAAGTAGACAGG + Intronic
974961058 4:68700959-68700981 CAAAGAAACGGAGAGTAGAATGG - Intergenic
975127816 4:70801813-70801835 CAAAGAGAAGGGAACTAGAAGGG + Intronic
975234676 4:71978478-71978500 CATAGAAACAGAAAGTAGAATGG - Intergenic
975381886 4:73710125-73710147 CTGAGAAAGGAGATGTAGAAAGG + Intergenic
975488521 4:74962716-74962738 CATAGAAACAGAAAGTAGAATGG + Intronic
975634132 4:76429317-76429339 GACAGAAAGCGAAAGTAGTATGG - Intergenic
975647258 4:76557420-76557442 CACAGAAACAGAGAGTAGAATGG + Intronic
975658680 4:76667030-76667052 CATAGAAACAGAAAGTAGAATGG + Intronic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
975842303 4:78487862-78487884 CACACAACTGGTAAGTAGAAGGG + Intronic
975927133 4:79470642-79470664 CATAGAAATGGGAAGTTGAATGG - Intergenic
976637152 4:87297535-87297557 CACAGAGACAGAAAGTAGAATGG - Intergenic
976703577 4:87997892-87997914 GACAGAAAGAGAAATTAGAAAGG + Intergenic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
977644133 4:99392550-99392572 CATAGAAATGAAAAGTAGAATGG + Intergenic
977693644 4:99945017-99945039 CACAGAAACACAAAGTAGAATGG + Intronic
978396301 4:108284068-108284090 CATAGAAACAGGGAGTAGAAAGG + Intergenic
978400111 4:108322100-108322122 CACTGAATGGGGAACTGGAATGG + Intergenic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
979207205 4:118052987-118053009 CTCAAAAAGCGGAAATAGAATGG + Intronic
979415363 4:120431363-120431385 CACAGAAACAGAAAGTAGAATGG - Intergenic
980019991 4:127697494-127697516 CACAGAAGGAGAGAGTAGAATGG - Intronic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
981147500 4:141342585-141342607 CACAGAAGCAGAAAGTAGAAAGG + Intergenic
981161296 4:141502244-141502266 CACAGAAATGTGAAGCTGAATGG + Intergenic
981356182 4:143791848-143791870 CACAGAAACAGAAAGTAAAAGGG - Intergenic
981356632 4:143796927-143796949 CATAGAAATAGAAAGTAGAATGG - Intergenic
981367704 4:143922487-143922509 CACAGAAACGGAAAGTAAAACGG - Intergenic
981368166 4:143927527-143927549 CATAGAAATAGAAAGTAGAATGG - Intergenic
981377503 4:144032732-144032754 CACAGAAACAGAAAGTAAAACGG - Intergenic
981726674 4:147855004-147855026 CACAGAAAGGGGCCGAGGAAGGG - Intronic
981765320 4:148242000-148242022 CACAGAGACAGAAAGTAGAATGG + Intronic
981918375 4:150059656-150059678 TATAGAAATGGAAAGTAGAAAGG + Intergenic
983162111 4:164429355-164429377 CACAGAAGTAGGGAGTAGAATGG - Intergenic
983187916 4:164721796-164721818 CATAGAAACAGAAAGTAGAATGG - Intergenic
983666016 4:170184316-170184338 CACAGAAATGGAGAGTATAATGG - Intergenic
983717366 4:170799923-170799945 CACAGTAAAGGGAATTATAAAGG + Intergenic
983718773 4:170818981-170819003 CACAGAAACAGGAAGTAGAATGG - Intergenic
984740555 4:183157457-183157479 TACAGAAATGGGAAGGGGAAAGG + Intronic
984873709 4:184349459-184349481 CGCAGGAAGGGGAACTAGGAAGG - Intergenic
984914174 4:184705912-184705934 CATAGAAACAGAAAGTAGAAGGG + Intronic
985381297 4:189397917-189397939 CACAGAAAATGGAAAAAGAAGGG + Intergenic
985710653 5:1426743-1426765 CACAGAGACAGAAAGTAGAATGG + Intronic
986003068 5:3645095-3645117 AACGGGAAGGGGAAGAAGAAAGG + Intergenic
986438884 5:7760933-7760955 CACAGAAACAGAGAGTAGAATGG - Intronic
986595025 5:9412258-9412280 AGCAGAAGGGGGAGGTAGAAAGG - Intronic
986748974 5:10768448-10768470 CAGAGAAATGGGAAGTGGTAAGG + Intergenic
986761080 5:10880298-10880320 CTCAGAAACAGGGAGTAGAATGG + Intergenic
988042457 5:25907604-25907626 AACAGAAAGGGAAAGTCAAAAGG - Intergenic
988227980 5:28438219-28438241 CACAGAAAGGGGAAGTTGAGGGG + Intergenic
988378232 5:30467282-30467304 CACAGAAGCGGAGAGTAGAATGG + Intergenic
988519486 5:31932795-31932817 CACAGAGACAGAAAGTAGAATGG - Intronic
990053665 5:51542133-51542155 CACAGAAAGAGAAACTAGATTGG + Intergenic
990126194 5:52520326-52520348 CATAGAAACAGAAAGTAGAATGG + Intergenic
990221203 5:53590966-53590988 CACAGAAACAGAAAGTAAAATGG - Intronic
990242091 5:53826071-53826093 CATAGAAACAGAAAGTAGAATGG + Intergenic
990245704 5:53861392-53861414 CATAGAAATAGAAAGTAGAATGG - Intergenic
990335742 5:54770767-54770789 CATAGAAACAGAAAGTAGAAAGG + Intergenic
990558204 5:56957076-56957098 CTCAGAAAAGGGAAGGAAAATGG + Intronic
990606226 5:57412989-57413011 CATAGAGAGAGAAAGTAGAATGG - Intergenic
990691087 5:58364732-58364754 TTCAGAAATGGGTAGTAGAAAGG + Intergenic
990826222 5:59901628-59901650 CACAGAAAAGGAAAACAGAATGG + Intronic
990903397 5:60777850-60777872 GGCAGAAAGGGGAAATAAAATGG + Intronic
991115990 5:62955405-62955427 CATAGAAACAGAAAGTAGAAAGG - Intergenic
991502047 5:67286782-67286804 AACAGAAATGGGAAGCAGGAGGG + Intergenic
991541635 5:67736469-67736491 CACGGAAAAAGAAAGTAGAATGG + Intergenic
992024289 5:72655296-72655318 CATAGAAACAGAAAGTAGAATGG + Intergenic
992065780 5:73106462-73106484 CACAGAGACAGAAAGTAGAATGG - Intergenic
992325961 5:75660280-75660302 CATAGAAACAGAAAGTAGAATGG - Intronic
992402093 5:76420763-76420785 CATAGAAATGGAAAGTAGAATGG - Intronic
992455606 5:76912749-76912771 ATCAAAAAGGGGAAGGAGAAGGG + Intronic
992739061 5:79754861-79754883 CACAGAAACAGAAAGTAAAATGG - Intronic
992913670 5:81424699-81424721 CACAGAATGGGCAAGCAAAAAGG + Intronic
992921320 5:81524792-81524814 CACAGGGAGGGGAAGAAGAATGG + Intronic
992925824 5:81585840-81585862 CATAGAAATGGAGAGTAGAATGG - Intronic
993072853 5:83187565-83187587 CACAGCAAAGGGAGGGAGAATGG + Intronic
993167001 5:84369542-84369564 CACAGAAACAGAAAGTAGGATGG + Intronic
993272761 5:85816217-85816239 CATAGAAAGGGGCAGGGGAATGG + Intergenic
993419837 5:87687186-87687208 CACAGAAACAGAAAGTAGAATGG - Intergenic
993430194 5:87823362-87823384 GAGAGAAAGAGGAAGGAGAAAGG + Intergenic
993634687 5:90329749-90329771 CACACAAAGGAGAAAGAGAAAGG - Intergenic
993900818 5:93583438-93583460 GAGAGAAAGGAGAAGAAGAAGGG - Exonic
994085705 5:95756192-95756214 CACAGAGACAGAAAGTAGAATGG - Intronic
994584458 5:101688372-101688394 CATAGAAATAGGGAGTAGAAAGG - Intergenic
994599137 5:101879865-101879887 CATACAAATGGAAAGTAGAAGGG - Intergenic
994625337 5:102211292-102211314 CACAGAAATAGAAAGTAGAATGG + Intergenic
994770599 5:103976193-103976215 CACACAAAGGAGAAAAAGAAAGG + Intergenic
994833572 5:104818349-104818371 CACAGAAAGGGACTTTAGAATGG + Intergenic
995229540 5:109743582-109743604 CACAGGAAAGGGAGGTGGAAAGG - Intronic
995637402 5:114209302-114209324 CAGAGGAAGGGGAACTAGTAAGG - Intergenic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
996263705 5:121507791-121507813 CATAGAAACAGGAAGTGGAATGG - Intergenic
997009943 5:129864357-129864379 CAAAGAAAGGAAAAATAGAAAGG - Intergenic
997184091 5:131864299-131864321 CACACAAAGGAGGAGGAGAAAGG - Intronic
997796520 5:136816446-136816468 CAAAGAAAGGGAGGGTAGAAAGG + Intergenic
997862691 5:137432569-137432591 CACAGAGACAGCAAGTAGAATGG + Intronic
998154290 5:139775669-139775691 CACAAAAAAAGGAAGAAGAAAGG - Intergenic
998213715 5:140221404-140221426 CATAGACATGGAAAGTAGAATGG - Intronic
998250890 5:140551553-140551575 AAAAGAAAGGGAAAGTAGCATGG - Intronic
998767630 5:145505950-145505972 CATAGAAATGGAAAATAGAATGG + Intronic
998909354 5:146941610-146941632 CATAGAAAAAGGAAGTGGAAAGG - Intronic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1000200235 5:159002297-159002319 AATAGAAAGGAGAATTAGAAAGG - Intronic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1000316938 5:160101474-160101496 CACAGAAGCAGAAAGTAGAATGG + Intronic
1000920846 5:167135426-167135448 CACAAAAAATGGAAGAAGAAAGG - Intergenic
1000956945 5:167554660-167554682 CACAGAAAGGTGAAGTAAGTTGG + Intronic
1001351512 5:170971738-170971760 AAAAGAAAGGGGCAGAAGAAAGG - Intronic
1001608312 5:172980045-172980067 CACAGAGACAGAAAGTAGAATGG + Intergenic
1001865942 5:175105484-175105506 CACAGAGAGGGGAAGTGGCCTGG - Intergenic
1002514587 5:179747951-179747973 CATAGAAACAGAAAGTAGAATGG + Intronic
1003091760 6:3109819-3109841 CACAGAAACAGAGAGTAGAATGG - Intronic
1003126451 6:3360066-3360088 CATAGAAACAGAAAGTAGAAGGG + Intronic
1003161826 6:3642606-3642628 CATAGAGATGGAAAGTAGAAGGG + Intergenic
1003163081 6:3652647-3652669 CACAGAGACAGAAAGTAGAATGG - Intergenic
1003531823 6:6943565-6943587 CACAGAGACAGGAAGTAGAATGG + Intergenic
1003595590 6:7471402-7471424 CACAGAAACAGAAAGTAAAATGG - Intergenic
1003724314 6:8742710-8742732 AACAGAAAGGGGAGGAAGAGAGG + Intergenic
1003820464 6:9890696-9890718 CACAGAAAGGCCAAGTAGCTTGG - Intronic
1003841251 6:10122430-10122452 CACAGAAAAAGGAACTAAAAAGG + Intronic
1003883675 6:10501550-10501572 CACTAAAAGGGAAATTAGAAAGG - Intronic
1004018985 6:11759216-11759238 GGCAGAGAGGGGAAGTGGAAGGG + Intronic
1004285261 6:14315568-14315590 AAAAGAAAGGGAAAGAAGAAAGG + Intergenic
1004291988 6:14375703-14375725 CACAGCTAGGAGAAGTATAAAGG + Intergenic
1004713688 6:18196017-18196039 CACAGAAGCAGAAAGTAGAATGG - Intronic
1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG + Exonic
1006189478 6:32198810-32198832 CAAAGATAGGGGAAGGAGAGAGG - Intronic
1006264812 6:32911754-32911776 CACTGAAAGAGGAAATACAAGGG - Intergenic
1006508568 6:34507736-34507758 CACAGAAACAGGAAGGAGAATGG - Intronic
1006567806 6:34974309-34974331 AAGAGAAAGGGGAAGGGGAAGGG - Intronic
1006590796 6:35155246-35155268 CATAGAAACAGAAAGTAGAATGG - Intergenic
1007028426 6:38602753-38602775 GACAGAAATGGCAAGCAGAAGGG + Intronic
1007097521 6:39222839-39222861 CACAGAAACAGAAAGGAGAATGG + Intronic
1007616698 6:43184071-43184093 GACAGAGAGGGGATGAAGAAGGG - Intronic
1008124263 6:47650909-47650931 CACAGAAACAGAAAGTAGAAAGG + Intergenic
1008473750 6:51913541-51913563 TACAGAAAGAGGAAGGAGTAGGG - Intronic
1008522873 6:52379251-52379273 CATAGAGACGGAAAGTAGAATGG + Intronic
1008550296 6:52622898-52622920 CATAGAAACAGAAAGTAGAATGG + Intergenic
1008774671 6:55023378-55023400 CATAGAAACAGGAAGTAGAATGG + Intergenic
1008911027 6:56733348-56733370 CACAGATAAGGGAAGCAGATGGG + Intronic
1008934126 6:56971162-56971184 CATAGAGACGGAAAGTAGAATGG - Intronic
1008995814 6:57657550-57657572 CATAGAAACAGAAAGTAGAATGG + Intergenic
1009057768 6:58358695-58358717 GACAGGAAGGGCAAGTGGAAAGG - Intergenic
1009233058 6:61088394-61088416 GACAGGAAGGGCAAGTGGAAAGG + Intergenic
1009473033 6:64051855-64051877 CACAGAGAGGGGAAAGATAAAGG + Intronic
1009777447 6:68222824-68222846 CAAAAGAAGGGGAAGAAGAAGGG + Intergenic
1010075227 6:71790003-71790025 AACAGAAAGGGGAAGGAGAGGGG + Intergenic
1010340096 6:74740250-74740272 TTCAGGAGGGGGAAGTAGAAGGG + Intergenic
1010627054 6:78151065-78151087 GACAGGAAGAGGAAGAAGAAGGG - Intergenic
1010711303 6:79177786-79177808 CACAGAAACAGAAAGTAGAATGG + Intergenic
1011247240 6:85332228-85332250 CACAAAAAGGGGAGGGAGAGAGG + Intergenic
1011561038 6:88616030-88616052 CATAGAAACAGAAAGTAGAAAGG - Intronic
1011788725 6:90875085-90875107 CTCAGAAAGAGGAAGTAGTCAGG + Intergenic
1011916935 6:92518126-92518148 CATAGAAATGGAGAGTAGAATGG - Intergenic
1011946853 6:92915595-92915617 CACAGAAGCAGAAAGTAGAATGG + Intergenic
1012078429 6:94725429-94725451 CACAGAAAGAGGAAGGGGAGAGG + Intergenic
1012099485 6:95012612-95012634 CACAGAAACAGGAAGTAGAAAGG - Intergenic
1012150122 6:95739490-95739512 CACAGAGACAGAAAGTAGAATGG + Intergenic
1012432953 6:99185492-99185514 CAGAGAAAGGGAAATTAAAAAGG - Intergenic
1012556744 6:100522590-100522612 CAGAGACAGGGGAAGCAGAGTGG + Intronic
1012614960 6:101266196-101266218 CATAAAAACAGGAAGTAGAATGG + Intergenic
1012642837 6:101642425-101642447 CATAGAAACAGAAAGTAGAATGG - Intronic
1012796134 6:103764243-103764265 CATAGAAGTGGGAAGTAGAATGG + Intergenic
1013185409 6:107753424-107753446 CATAGAGACAGGAAGTAGAATGG + Intronic
1013613431 6:111818191-111818213 CACAGAAATGGCAAGGTGAAAGG + Intronic
1013753578 6:113435422-113435444 CACAGAAAGAGGATTTTGAAAGG - Intergenic
1013867332 6:114714393-114714415 CACAGAAAGAGGCAGAACAAAGG + Intergenic
1014224620 6:118833738-118833760 CATAGAAACGGAAAGTAGAATGG + Intronic
1014250523 6:119111317-119111339 CCCAGAAACAGCAAGTAGAATGG + Intronic
1014335676 6:120133040-120133062 CACAGAGAGGAGAGGAAGAAAGG + Intergenic
1014940423 6:127431760-127431782 GACACAAAGAGGTAGTAGAAGGG + Intergenic
1014965465 6:127742725-127742747 CATAGAGATGGAAAGTAGAATGG + Intronic
1015752117 6:136570831-136570853 CATAGAAACAGAAAGTAGAACGG - Intronic
1016063598 6:139655749-139655771 AACAGAGAGGGAAAGGAGAAGGG + Intergenic
1016706906 6:147119442-147119464 CATAGAGACGGAAAGTAGAATGG + Intergenic
1016954788 6:149616022-149616044 CACAGAGAGAGGAGGTAGAATGG + Intronic
1017001521 6:150000514-150000536 CACAGACAGGGGGAGAGGAAAGG + Intergenic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1017512499 6:155126856-155126878 CACAGACACGGGAAGCAGAGGGG - Intronic
1017538196 6:155371259-155371281 CACAGGAAGGGTAAGGAGGAAGG - Intergenic
1017850925 6:158305130-158305152 CATAGAAACAGTAAGTAGAAGGG - Intronic
1018549146 6:164974716-164974738 CTGAGAAATGGAAAGTAGAATGG - Intergenic
1019084775 6:169465827-169465849 CAGAGATACAGGAAGTAGAATGG + Intronic
1019228561 6:170536886-170536908 CACAGAAAGGGGGGGTAAGAGGG + Intronic
1019256177 7:53492-53514 CATAGAAAGGGTACATAGAAAGG + Intergenic
1019489350 7:1304389-1304411 CACAGAGACAGGAAGTAGGATGG - Intergenic
1019695218 7:2442081-2442103 CTCAGAGACAGGAAGTAGAATGG - Intergenic
1020229474 7:6306704-6306726 CATAGACAGGGAAAGTAGAATGG + Intergenic
1020229729 7:6308799-6308821 CATAGAAACAGAAAGTAGAATGG + Intergenic
1020386985 7:7617344-7617366 CATAGAAAGAGAAAATAGAAAGG + Intergenic
1020487868 7:8741080-8741102 CTCAGAAACAGGAAGTAGACTGG - Intronic
1021401784 7:20218056-20218078 CACAGAAATGGAAAGTAAAATGG - Intergenic
1021504550 7:21367432-21367454 CACAGAGATGGAAAGTAGAATGG + Intergenic
1022046208 7:26624526-26624548 CAGAGAATGGGGAAGCAGAGTGG + Intergenic
1022067356 7:26872865-26872887 CACAGAGCGGGGAATCAGAAAGG + Intronic
1022085138 7:27059870-27059892 CACAAAAAGTATAAGTAGAAGGG - Intergenic
1022281368 7:28913705-28913727 CATAGAGATAGGAAGTAGAATGG + Intergenic
1022324096 7:29314340-29314362 CACAAATAGAGGAAGTGGAATGG + Intronic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022387988 7:29919372-29919394 CACAGAGACGGAAATTAGAAGGG - Intergenic
1022394694 7:29976385-29976407 CATAGAAATAGAAAGTAGAATGG + Intronic
1022420254 7:30213573-30213595 CATAGAAATGAAAAGTAGAATGG - Intergenic
1022421287 7:30226116-30226138 GGCAGAAAAGGGAAGTGGAAAGG - Intergenic
1022567119 7:31414717-31414739 CACAGAAAAGGGAGGCAGAGAGG - Intergenic
1022668880 7:32436750-32436772 CATAGAAACAGAAAGTAGAATGG + Intergenic
1022955996 7:35380977-35380999 CATAGAAATAGGAAGTAGAAAGG + Intergenic
1023288123 7:38640597-38640619 CACAGAGATAGAAAGTAGAATGG + Intergenic
1023439165 7:40168928-40168950 GAAAGAAAAGGGAAATAGAAGGG - Intronic
1024026826 7:45416967-45416989 TACAGAAACAGAAAGTAGAATGG + Intergenic
1024035762 7:45506300-45506322 GACAGGAAGGGGAACTAGACAGG - Intergenic
1024250748 7:47504053-47504075 CATAGCAAGGGGGACTAGAAAGG + Intronic
1024577063 7:50773327-50773349 GAAAGAAAGGGGAAGGGGAAGGG + Intronic
1024725925 7:52194987-52195009 CATAGAGAGAGAAAGTAGAATGG - Intergenic
1025171524 7:56761840-56761862 CATAGAAACAGAAAGTAGAATGG + Intergenic
1025700341 7:63813641-63813663 CATAGAAACAGAAAGTAGAATGG - Intergenic
1025725592 7:64055559-64055581 CAGAGAGAAGGAAAGTAGAATGG - Intronic
1025831900 7:65059428-65059450 CATAGAAACAGAAAGTAGAATGG - Intergenic
1025919587 7:65898850-65898872 CATAGAAACAGAAAGTAGAATGG - Intronic
1026234528 7:68514642-68514664 CATAGAAACAGGGAGTAGAATGG - Intergenic
1026277761 7:68895075-68895097 TGGAGAAAGGGGAAGAAGAAAGG - Intergenic
1026282210 7:68932099-68932121 CACAGAGACAGAAAGTAGAATGG + Intergenic
1026424590 7:70277521-70277543 CACAGAAAGGGAGAGTGCAAGGG - Intronic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026924113 7:74177535-74177557 CTCAGAGACAGGAAGTAGAATGG - Intronic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027135986 7:75624382-75624404 CAAAGACAGAAGAAGTAGAAGGG - Intronic
1027421014 7:78018635-78018657 CACAGAAAGGGCAATAAAAATGG + Exonic
1027764177 7:82318842-82318864 AATAGAAAGAGGAAGAAGAAGGG + Intronic
1027951495 7:84822652-84822674 CATAGAAAGGGGAGGAGGAATGG - Intergenic
1028400109 7:90416352-90416374 CTCAGAAAAAGGAACTAGAAAGG + Intronic
1028611522 7:92717362-92717384 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1029498101 7:100908909-100908931 CACTTACAGGGGAAGTTGAAGGG - Intergenic
1029804863 7:102985498-102985520 CCCAGAAAGGGGGAGTAGATGGG + Intronic
1029848403 7:103437733-103437755 CACAGAAATAGAGAGTAGAATGG + Intronic
1030215267 7:107038465-107038487 TATAGAAAGAGAAAGTAGAATGG - Intergenic
1030250203 7:107435111-107435133 CATAGAAACAGAAAGTAGAATGG + Intronic
1030349302 7:108465642-108465664 CACAGGAAATGGAAGTATAAGGG + Intergenic
1030651639 7:112122355-112122377 CAAAGAAACAGAAAGTAGAATGG - Intronic
1030817013 7:114050876-114050898 CACAGAAAAGGCCAGCAGAATGG - Intronic
1031056102 7:116994191-116994213 CATAGAGAGAGAAAGTAGAACGG - Intronic
1031495200 7:122438466-122438488 TACAGAGAGAGGAAGTGGAAGGG + Intronic
1031734342 7:125338347-125338369 CACAGAAATAGAAAGTATAATGG - Intergenic
1031802746 7:126269739-126269761 CACAGAAACAGAGAGTAGAATGG + Intergenic
1032425960 7:131822297-131822319 GAAAGAAAAGGGAAATAGAAGGG - Intergenic
1032460897 7:132110012-132110034 CATAGAAACAGAAAGTAGAATGG + Intergenic
1032537453 7:132676826-132676848 CACAGAGACAGAAAGTAGAATGG - Intronic
1032658000 7:133952678-133952700 CATAGAGATAGGAAGTAGAATGG - Intronic
1032825082 7:135560782-135560804 CATAGAAACAGAAAGTAGAATGG + Intronic
1032952714 7:136933865-136933887 TACAGAGATGGAAAGTAGAATGG + Intronic
1033034317 7:137859048-137859070 CTTAGAAATGGAAAGTAGAATGG + Intergenic
1033395781 7:140972574-140972596 CACAGAAGCAGAAAGTAGAATGG - Intergenic
1033400600 7:141020278-141020300 CTTAGAAATGGAAAGTAGAATGG + Intergenic
1033623807 7:143088515-143088537 CAAAGAAAGGGGTGATAGAACGG + Intergenic
1033729795 7:144166597-144166619 CATAGAAACAGGGAGTAGAATGG + Intergenic
1034147940 7:148888712-148888734 CACAGGAAGGGGAAGAAAAGTGG + Intergenic
1034352379 7:150425330-150425352 CATAGAAATAGAAAGTAGAATGG - Intergenic
1034355817 7:150450124-150450146 CATAGAAACGGAAAGTAGAACGG + Intergenic
1034380161 7:150685246-150685268 CACAGAAAGGGGAACCTGAGAGG - Intergenic
1034411194 7:150943037-150943059 CACAGAGAGGAGAGGAAGAAAGG - Intergenic
1034535871 7:151725342-151725364 CATAGAGACAGGAAGTAGAAGGG + Intronic
1034644448 7:152632779-152632801 CAAAGAAATGGAAAGCAGAATGG + Intergenic
1034853118 7:154514571-154514593 CACAGAGACAGGAAGTAGAATGG - Intronic
1034956957 7:155340761-155340783 CACAGAAACAGAAGGTAGAATGG - Intergenic
1035060385 7:156064935-156064957 CACAGAAAGGGGAGGGCGAGGGG - Intergenic
1035136249 7:156705785-156705807 CACACAAAGGAGAAAGAGAAGGG + Intronic
1036134395 8:6146529-6146551 CACAAAAAAGAGAAGTAAAAGGG + Intergenic
1036137692 8:6176792-6176814 CACAGAGACAGGAAGTAGAATGG + Intergenic
1036657351 8:10685597-10685619 CATAGAGACAGGAAGTAGAATGG + Intronic
1036734319 8:11296567-11296589 CAGAGAAACAGAAAGTAGAATGG - Intronic
1036775717 8:11611814-11611836 CATAGAGATGCGAAGTAGAATGG + Intergenic
1037306765 8:17512820-17512842 CACAGAGACAGAAAGTAGAATGG - Intronic
1037603974 8:20422132-20422154 CATAGAAACTGGAAGTAGAGTGG - Intergenic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037838088 8:22226348-22226370 CATAGAAACAGAAAGTAGAATGG + Intronic
1037885526 8:22594196-22594218 CACAGAAGTGGGAAGGAGAGGGG + Exonic
1037953886 8:23038100-23038122 AACACAAAGGGGAAATTGAAGGG + Intronic
1038001672 8:23397158-23397180 CACAGAGACAGAAAGTAGAATGG + Intronic
1038154485 8:24975805-24975827 CACAGAAATACGAAGTAGAATGG - Intergenic
1038224142 8:25639633-25639655 CACAGAAATAGAAAGTAGAATGG - Intergenic
1038297205 8:26305105-26305127 TACAGAAACAGAAAGTAGAATGG - Intronic
1038449420 8:27630073-27630095 CCAAGAAAGGGGAAAGAGAAGGG - Intergenic
1038526433 8:28278023-28278045 CACAGAAACAGAAAGTTGAATGG + Intergenic
1038789631 8:30657381-30657403 GAAAGAGAGGGGAAGTAGTAAGG - Intronic
1038973624 8:32666815-32666837 CACAGAAACACAAAGTAGAATGG - Intronic
1039075106 8:33683237-33683259 CATAGAAACAGAAAGTAGAATGG + Intergenic
1039235221 8:35495641-35495663 CACAGACAGGGGCACCAGAATGG - Intronic
1039576737 8:38629692-38629714 TATAGAAATAGGAAGTAGAATGG + Intergenic
1039758315 8:40546713-40546735 CACAGAAAGGGAAGGGAGAAAGG + Intronic
1040728318 8:50410696-50410718 CACAGAAACAGAAAGTAGAATGG - Intronic
1040852400 8:51914577-51914599 AACAGGAAGGGGAAGGGGAAGGG - Intergenic
1041127908 8:54664078-54664100 CACAGAAATAGAAAGTAGAATGG - Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041465716 8:58155787-58155809 CAGAGACAGGGGAGGCAGAAGGG - Intronic
1041694965 8:60726327-60726349 TCCAGAATGGGGAAGTGGAAAGG - Intronic
1042519503 8:69696288-69696310 CACAAAAATGGCAAGTAGATAGG + Intronic
1042650350 8:71033746-71033768 GGCAGAAAGTGGAAGGAGAATGG - Intergenic
1042666287 8:71210128-71210150 CACAGGAAGGGTAAGTGGCAGGG + Intronic
1042740757 8:72042865-72042887 CACAGAAACAAAAAGTAGAAGGG + Intronic
1043143127 8:76616289-76616311 CAGATCAACGGGAAGTAGAAAGG + Intergenic
1043222815 8:77687894-77687916 AACAGAAAGTGGTGGTAGAAAGG - Intergenic
1043321653 8:78994271-78994293 CATAGAAACAGAAAGTAGAATGG + Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1043529325 8:81132623-81132645 GACAGAAGGGGGAAGGACAAGGG - Intergenic
1043667188 8:82829545-82829567 CATAGAAAAGGAAAGTAAAATGG - Intergenic
1044083683 8:87916761-87916783 CATAGAAAGTGGAAGTAGGGTGG - Intergenic
1044091471 8:88007735-88007757 GTCAGAATGGGGAAGTAGGAAGG - Intergenic
1044236304 8:89834719-89834741 CACGGAAACAGAAAGTAGAATGG + Intergenic
1044293308 8:90498293-90498315 CACAGAAGCAGAAAGTAGAATGG - Intergenic
1044584639 8:93858328-93858350 CACAGAGACAGAAAGTAGAATGG + Intronic
1044797079 8:95913004-95913026 CATAGAAACGGAGAGTAGAATGG + Intergenic
1045251110 8:100484207-100484229 GAGAGAAAGAGGCAGTAGAAGGG + Intergenic
1045322109 8:101089907-101089929 CACAGAAATGGAAAGCAGATTGG - Intergenic
1045352808 8:101357941-101357963 CATAGAAACAGAAAGTAGAATGG - Intergenic
1045563324 8:103287269-103287291 CACAGAAGCAGCAAGTAGAAAGG - Intergenic
1045572593 8:103384732-103384754 TCTAGAAATGGGAAGTAGAAGGG + Intergenic
1046263562 8:111802227-111802249 CATAGAAACGGAAAGTAGAATGG + Intergenic
1046359687 8:113133854-113133876 AACAGAAACAGAAAGTAGAATGG + Intronic
1046518384 8:115292687-115292709 CACAGTAATGGGGAGTAAAAAGG - Intergenic
1046687261 8:117241570-117241592 CAAAGAAAGGGGAAGTTATAGGG - Intergenic
1046803518 8:118454824-118454846 CACAGAAGCAGAAAGTAGAATGG - Intronic
1046942054 8:119940905-119940927 CATAGAGATGGAAAGTAGAATGG + Intronic
1047070807 8:121341253-121341275 CACAGAAGTGGGAAGTAGAATGG - Intergenic
1047123349 8:121931164-121931186 AAAAGTAAGGGGAAGTTGAAGGG + Intergenic
1047306534 8:123657479-123657501 CACAGGAAGGTGATCTAGAAGGG - Intergenic
1047334258 8:123920868-123920890 CAGAGAAACAGAAAGTAGAACGG - Intronic
1047409863 8:124615524-124615546 CACAGAAACAGAAAGGAGAATGG + Intronic
1047532119 8:125686252-125686274 CACCGAAAGGGGATGGAAAAGGG - Intergenic
1047636481 8:126768679-126768701 AACAGAATGGGGATGAAGAACGG + Intergenic
1047803719 8:128336659-128336681 CGCAGAGACAGGAAGTAGAACGG - Intergenic
1047999125 8:130362539-130362561 CACAGAAAAGGGGAGTTCAAAGG - Intronic
1048389764 8:133951415-133951437 CACAGAAACTGAAAGTAAAATGG + Intergenic
1048712832 8:137231442-137231464 TTCAGAAAGGGGAAGTAGCAGGG - Intergenic
1048807212 8:138251928-138251950 CACAGAAAGGGCGAGATGAAGGG + Intronic
1048886703 8:138914821-138914843 CTCAGAAAGAAAAAGTAGAAGGG - Intergenic
1048894040 8:138972825-138972847 CACAGAGACGGACAGTAGAATGG - Intergenic
1049821733 8:144638449-144638471 CCCAGAAGGGGAAAATAGAATGG - Intergenic
1049952313 9:657068-657090 CATAGAAACAGAAAGTAGAAAGG - Intronic
1049960955 9:737640-737662 CACGGAAAGGGAAAATAAAAGGG - Intronic
1049999492 9:1061344-1061366 CACAGAAGCGGAAAGTAGAAAGG - Intergenic
1050045142 9:1535281-1535303 CACAGAAACAGAAAGTAGATTGG - Intergenic
1050089599 9:2004219-2004241 CACAGAGATGGAAAGTGGAAAGG + Intergenic
1050801223 9:9617204-9617226 CAGAGAAAGAGGAACCAGAATGG + Intronic
1050862463 9:10451492-10451514 CAGACAAGCGGGAAGTAGAAAGG - Intronic
1051010909 9:12412998-12413020 CATAGAAACGGGGAGTAGGAAGG + Intergenic
1051197518 9:14578867-14578889 CACACAAATGAGAAATAGAAGGG + Intergenic
1051344833 9:16142478-16142500 CACAGAAGGAGAGAGTAGAATGG + Intergenic
1051767983 9:20545362-20545384 CACAGAAACACAAAGTAGAATGG + Intronic
1052212260 9:25919479-25919501 AACAGAAATGTGAAATAGAAAGG + Intergenic
1052212806 9:25927205-25927227 CTTAGAAAGAGAAAGTAGAATGG + Intergenic
1052282604 9:26750299-26750321 CATAGAAAGAGAAAATAGAATGG - Intergenic
1052450861 9:28629384-28629406 TAAAGAAAAGGGAAGAAGAAAGG - Intronic
1052856402 9:33409380-33409402 CATAGAGATGGAAAGTAGAATGG - Intergenic
1053176953 9:35932967-35932989 CATAGAAACAGAAAGTAGAATGG - Intergenic
1053474702 9:38373876-38373898 CACAGAAACAGAAACTAGAAGGG - Intergenic
1053590636 9:39510998-39511020 CTGAGAACGGGGAGGTAGAAGGG - Intergenic
1054575668 9:66854291-66854313 CTGAGAACGGGGAGGTAGAAGGG + Intergenic
1054983172 9:71230935-71230957 CACAGGAAAGGAAAGCAGAAAGG + Intronic
1055302635 9:74898286-74898308 CTCAGCAAGGGGAAAAAGAAGGG - Intergenic
1055477861 9:76681245-76681267 CATAGAAACAGAAAGTAGAATGG + Intronic
1055570906 9:77616157-77616179 CACAGAATGGTAAAGCAGAATGG + Intronic
1055637488 9:78293357-78293379 CATAGAGACAGGAAGTAGAATGG + Intergenic
1055715197 9:79109946-79109968 CATAGAAACAGAAAGTAGAATGG + Intergenic
1055983007 9:82024540-82024562 GATAGTAAGGGGAAGTAGAAGGG + Intergenic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056072802 9:83006583-83006605 AAAAGAAAGGGGAAGGAGAGGGG + Intronic
1056171805 9:83993183-83993205 CACAGAAATGGAAAGTAGAATGG - Intronic
1056486730 9:87066239-87066261 AACAGAAAGGGGAAGAAGTCTGG + Intergenic
1056736800 9:89216662-89216684 CACAGAGACAGAAAGTAGAATGG + Intergenic
1056739766 9:89244421-89244443 CATAGAGATGGAAAGTAGAATGG + Intergenic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057426856 9:94958076-94958098 CACAGAGACAGAAAGTAGAATGG - Intronic
1057456249 9:95214808-95214830 CACAGAGAGAGAATGTAGAATGG + Intronic
1057477884 9:95419856-95419878 AACAGAAATTGGAGGTAGAAAGG + Intergenic
1057864903 9:98672241-98672263 CACAGAGACGGGAAGTGGAATGG - Intronic
1057912049 9:99026771-99026793 CATAGAAAGGGGAGGAAGGAGGG - Intronic
1057932774 9:99210683-99210705 GAAAGAAAGGGGAAGGGGAAGGG - Intergenic
1058322831 9:103656302-103656324 CACAGAAACAGAGAGTAGAATGG + Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058625821 9:106931884-106931906 CACAGAAAGGAGAGGAAGAAAGG - Intronic
1058736712 9:107900481-107900503 GAAAGAAAGGGGAAGAAGGAGGG - Intergenic
1058925111 9:109655620-109655642 CACAGAAACCAAAAGTAGAATGG - Intronic
1059344383 9:113618211-113618233 CACAGAGACAGAAAGTAGAATGG - Intergenic
1059549743 9:115217015-115217037 CACAGAAAGGAGAAGTTGAGAGG + Intronic
1059657402 9:116368971-116368993 AAGAGAAAGAGGAAGCAGAAAGG - Intronic
1059708535 9:116846160-116846182 CACAGAGATGGAAAGCAGAATGG + Intronic
1059741694 9:117157248-117157270 CACAGAGGAGGGAAGCAGAAAGG + Intronic
1059799823 9:117738972-117738994 TGCAGAAAGGGGAAATGGAAGGG - Intergenic
1059816069 9:117917064-117917086 CACAGAGACAGAAAGTAGAATGG + Intergenic
1060036354 9:120259407-120259429 TACAGAGAGAGGAGGTAGAATGG + Intergenic
1060136619 9:121162094-121162116 AGCAGAAAGGGGAAATAGAGTGG + Exonic
1060730270 9:126032753-126032775 CACAGAGAGGCGAGGAAGAATGG + Intergenic
1061056165 9:128224125-128224147 CCCAGAGAGGGGTAGTGGAAGGG + Intronic
1062338908 9:136084886-136084908 TACAGAGACAGGAAGTAGAAAGG + Intronic
1062381227 9:136287766-136287788 CATAGAGACAGGAAGTAGAATGG + Intronic
1062445947 9:136594827-136594849 CATAGAGACAGGAAGTAGAAAGG + Intergenic
1186064862 X:5752293-5752315 CACAGAGAGAGAAAGTAGAATGG + Intergenic
1186251728 X:7674985-7675007 CATAGAAACAGAAAGTAGAATGG + Intergenic
1186403378 X:9280189-9280211 CACAGCCAGGGGAAGTACAGTGG + Intergenic
1186757054 X:12682732-12682754 CTCAGAAATTGGAAGTACAATGG - Intronic
1186764511 X:12757109-12757131 CACAGAAACAGAAAGTAGAATGG + Intergenic
1187217098 X:17287835-17287857 CACAGGAAGGGGAAATATATGGG - Intergenic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187522553 X:20026439-20026461 CACAGAGACAGGAAGTAGAAGGG - Intronic
1187548860 X:20281256-20281278 CACAGAGACGGAAAGTAGTATGG - Intergenic
1187751918 X:22475731-22475753 GAAAGAAAGGGGAGGAAGAATGG + Intergenic
1188694334 X:33171264-33171286 TTGAGAAAGGGGAAGTAGTAGGG + Intronic
1188964254 X:36531493-36531515 CATAGAAAGTGAAAGTAAAATGG + Intergenic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189725168 X:43961024-43961046 CACAGAAAAAGGAAATATAAAGG + Intronic
1189827183 X:44931663-44931685 CATAGAAACAGGAAGTAGAAAGG + Intronic
1189902724 X:45723631-45723653 CACAGAAGAGGAGAGTAGAATGG - Intergenic
1190254358 X:48751488-48751510 CATAGAAACAGAAAGTAGAAGGG + Intergenic
1190390852 X:49930149-49930171 CAAATAAAGGGGAATTAGAATGG + Intronic
1191166692 X:57399601-57399623 GAAAGAAAAGGGAAATAGAAGGG - Intronic
1191617143 X:63181558-63181580 CACAGAGAGGGGAAAGACAAGGG - Intergenic
1191619155 X:63197365-63197387 CACAGAGAGGGGAAAGACAAGGG + Intergenic
1191624880 X:63259888-63259910 AACAGAAAAAGGAAATAGAAAGG + Intergenic
1191767270 X:64711853-64711875 CACAGTAAGGGGAAATAAAAGGG + Intergenic
1191909989 X:66140007-66140029 CACTGAAAAGAGAAGTGGAATGG - Intergenic
1192115305 X:68404876-68404898 CATAGAAAAAGGAAGTAGAAAGG + Intronic
1192484820 X:71515985-71516007 CATAGAAACGGAAAGTAGAAGGG + Intronic
1192507320 X:71696577-71696599 CTCAGAAACGGCAGGTAGAATGG + Intergenic
1192519376 X:71784975-71784997 CTCAGAAACGGCAGGTAGAATGG - Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1192672384 X:73159220-73159242 AGCAGAAAGGGAAAGAAGAAAGG + Intergenic
1193438291 X:81507758-81507780 CATAGAAACAGAAAGTAGAATGG + Intergenic
1193653833 X:84172919-84172941 CATAGAGATGGAAAGTAGAAAGG + Intronic
1194511432 X:94800835-94800857 TACAGAAAGGAGAAAGAGAAAGG - Intergenic
1194529052 X:95021532-95021554 CATAGAAACGGAGAGTAGAAGGG + Intergenic
1194784640 X:98067159-98067181 CATAGAAACAGAAAGTAGAATGG + Intergenic
1194984774 X:100478489-100478511 CAGAGAAAGGGAAAGTGAAATGG - Intergenic
1195439966 X:104888139-104888161 ATCAAAAAGGGGAAGCAGAAGGG + Intronic
1195477060 X:105299354-105299376 CACTGAATGGGGAAATGGAAAGG + Intronic
1195528922 X:105929647-105929669 TATAGAAAGGTGAAATAGAAAGG - Intronic
1195653035 X:107306129-107306151 TACACAAAAGAGAAGTAGAAAGG + Intergenic
1195666012 X:107431844-107431866 GACAGAAAATGAAAGTAGAAGGG + Intergenic
1195745062 X:108108794-108108816 CATAGAAAGAGAAATTAGAAGGG - Intronic
1195887981 X:109660887-109660909 CATAGAAACAGAAAGTAGAATGG + Intronic
1195935409 X:110120775-110120797 CATAGAAAGGGAAAGTAGAATGG - Intronic
1195957565 X:110348839-110348861 CTAAGAAAGGGGAAGTAAAATGG + Intronic
1196402752 X:115333186-115333208 CAGAGAAATGAAAAGTAGAATGG - Intergenic
1196470952 X:116026355-116026377 CACAGAAATGGAACGTAGAAAGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196657692 X:118236324-118236346 CATAGAAACAGAAAGTAGAATGG - Intergenic
1196710816 X:118760228-118760250 CATAGAAACAGAAAGTAGAAAGG - Intronic
1196921074 X:120585677-120585699 AACAGAAAGAGAAAGTGGAAAGG + Intergenic
1196943436 X:120800295-120800317 CATAGAAACAGAAAGTAGAATGG + Intergenic
1197231604 X:124010313-124010335 CATAGAAACAGAAAGTAGAATGG - Intronic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1198315225 X:135459281-135459303 CATAGAAACAGAAAGTAGAATGG - Intergenic
1198750553 X:139933006-139933028 CAGAGAAAGTGGAAGTAAGAAGG - Intronic
1199123991 X:144092041-144092063 CCCAGAAAGTGAAAGTAGAATGG - Intergenic
1199249536 X:145644282-145644304 CATAGAAATAGAAAGTAGAATGG + Intergenic
1199853038 X:151738896-151738918 CACAGGAAGGGGAAGCAGCAGGG - Intronic
1199946476 X:152672689-152672711 CATAGAAAGAGAGAGTAGAAAGG + Intergenic
1201334397 Y:12864579-12864601 CACAGAAAAGGAAAGGAAAAGGG - Intergenic
1201568233 Y:15388457-15388479 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
1201609376 Y:15823680-15823702 CACAGAATGGGGAGGTGGGATGG + Intergenic
1202600453 Y:26588735-26588757 CACAAAAAGGGCAGGCAGAAAGG - Intergenic