ID: 976708502

View in Genome Browser
Species Human (GRCh38)
Location 4:88043479-88043501
Sequence ACAACCACACAGAAATAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 403}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976708502_976708505 -5 Left 976708502 4:88043479-88043501 CCCTCCTATTTCTGTGTGGTTGT 0: 1
1: 0
2: 3
3: 44
4: 403
Right 976708505 4:88043497-88043519 GTTGTACATACATCCTATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 60
976708502_976708506 -4 Left 976708502 4:88043479-88043501 CCCTCCTATTTCTGTGTGGTTGT 0: 1
1: 0
2: 3
3: 44
4: 403
Right 976708506 4:88043498-88043520 TTGTACATACATCCTATTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 159
976708502_976708507 -3 Left 976708502 4:88043479-88043501 CCCTCCTATTTCTGTGTGGTTGT 0: 1
1: 0
2: 3
3: 44
4: 403
Right 976708507 4:88043499-88043521 TGTACATACATCCTATTCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976708502 Original CRISPR ACAACCACACAGAAATAGGA GGG (reversed) Intronic
902995035 1:20217832-20217854 ACAACATCAGAGAAATGGGAGGG + Intergenic
903046103 1:20565464-20565486 GCAGCCACACAAAAATATGAGGG - Intergenic
903297582 1:22354693-22354715 ACAACAACAAAAAAATAGGCAGG - Intergenic
903683726 1:25115449-25115471 TCAACCACACAGAAATATAGTGG - Intergenic
903778878 1:25809407-25809429 CCATCCACACAGAAGTGGGAAGG + Intronic
904224482 1:29004332-29004354 TCATCCACACAGAAAATGGATGG - Intronic
904936601 1:34134098-34134120 CCAAACAGGCAGAAATAGGAGGG + Intronic
905662457 1:39737955-39737977 ACACACACACAGAAAGAGGGCGG - Intronic
905777490 1:40678410-40678432 ACAAACAAACAAAAAAAGGAAGG + Intergenic
906190300 1:43894620-43894642 ACAAACAAACAAAAAAAGGAAGG - Intronic
907887105 1:58602931-58602953 ACAAGCAAACAGAAATACAAAGG - Intergenic
909652675 1:77993018-77993040 ATAAACACTCAGAAATAGGCCGG - Intronic
909800024 1:79795856-79795878 ACAATAACACAGAAATACAAGGG - Intergenic
910821574 1:91355750-91355772 ACAACAATACAATAATAGGAGGG + Intronic
911394095 1:97284956-97284978 ACAAGCAGACAGAAAAAGCAGGG - Intronic
911510999 1:98807471-98807493 ACAGCCACACAGTAATAGTGGGG + Intergenic
912040235 1:105381144-105381166 ACAGCCACACAGTAATAGTGGGG - Intergenic
913030381 1:114896977-114896999 GTTACCACACAGGAATAGGAGGG + Intronic
913974423 1:143443241-143443263 ACCACTACATAGAAACAGGAAGG + Intergenic
914068813 1:144268855-144268877 ACCACTACATAGAAACAGGAAGG + Intergenic
914110342 1:144697499-144697521 ACCACTACATAGAAACAGGAAGG - Intergenic
914796524 1:150924724-150924746 ACAAACAAACAAAAAAAGGAAGG + Intergenic
915430963 1:155866411-155866433 ATAACTAAACAGAAATAGGCCGG - Intronic
916295333 1:163212909-163212931 ATAAAGACACAGATATAGGAGGG - Intronic
917701879 1:177590003-177590025 ACAACAACAAAAAAAAAGGAAGG + Intergenic
918670517 1:187209667-187209689 ACACACACACACATATAGGAAGG + Intergenic
919628525 1:199936429-199936451 ACAAACAAACAAAAATAGCAAGG - Intergenic
920862104 1:209718519-209718541 ACCACCTCACAGCACTAGGATGG + Intronic
921414739 1:214872476-214872498 AAAGCCACACTGAAATAGGAAGG + Intergenic
922634598 1:227154898-227154920 ACAATCACATAGAAAAATGAAGG + Intronic
922679200 1:227577345-227577367 ACTCCCACACAGTAATAGTAGGG - Intronic
923911398 1:238448341-238448363 ACACACACACAGAAAAAGAAAGG - Intergenic
924682984 1:246257265-246257287 ACAACCACACAATAATAGTGGGG - Intronic
1063593724 10:7413684-7413706 AAAGCAACACAAAAATAGGAGGG - Intergenic
1063652232 10:7949178-7949200 ACCATCACAGAGAAAGAGGAAGG + Intronic
1064399297 10:15007859-15007881 TCACCCACACAAAAAAAGGATGG + Intergenic
1064745795 10:18477045-18477067 TCTGCCACACAGAAAAAGGAGGG + Intronic
1064977774 10:21136321-21136343 ACAACAACAAAAAAGTAGGAAGG - Intronic
1066280783 10:33916358-33916380 ACAACCAAAGAGAAAGAGGAGGG - Intergenic
1067556308 10:47275676-47275698 ACAACAACAAAAGAATAGGAGGG + Intergenic
1068494553 10:57770412-57770434 ACAGCCACACAATAATAGAAGGG + Intergenic
1068555210 10:58450900-58450922 ACAACCACACACAAGTTTGAAGG + Intergenic
1069561994 10:69437155-69437177 AGAACCTCAAAGAAAAAGGAGGG - Intergenic
1069742607 10:70695062-70695084 CAAACCACAAAGAAATAGGATGG - Intronic
1071555727 10:86599960-86599982 AGTTCCACACAGAAAGAGGAGGG - Intergenic
1071823791 10:89304136-89304158 ACAAACAAACAAAAATAGGATGG + Intronic
1071986663 10:91058474-91058496 AAAGCCAGACAGAAAAAGGAAGG - Intergenic
1072831851 10:98666315-98666337 ACAGCCACACAGTAATAGCAGGG + Intronic
1072899806 10:99397078-99397100 ACAACCATGCAGAAAGAGCAGGG + Exonic
1074143921 10:110700204-110700226 ACAAAGACACAGAAATGGGAGGG - Intronic
1074681843 10:115914816-115914838 CCAAGGACACAGAACTAGGAAGG - Intronic
1078049173 11:7946648-7946670 ACAGCCACACAGAGAATGGAAGG - Intergenic
1078744580 11:14099357-14099379 ACAACCCAAAAGAAATAGAAGGG - Intronic
1079525705 11:21385119-21385141 ACAATAACACAGCAATGGGAAGG - Intronic
1080179740 11:29411278-29411300 ACACACACACAAAACTAGGATGG - Intergenic
1081491061 11:43569314-43569336 ATAACAACACAGAAATAACAAGG + Intronic
1082013366 11:47466063-47466085 AAAAACACACAAAAAAAGGAAGG + Intronic
1082717783 11:56636021-56636043 ACAAACACACATATATATGAGGG + Intergenic
1085092441 11:73729402-73729424 CCAACCATACAGAAATAAAAAGG - Intronic
1085167995 11:74421373-74421395 ACCACCACTCAGAAATAAAAAGG - Intergenic
1085557321 11:77436110-77436132 ACATCACCACTGAAATAGGAAGG + Intronic
1086204634 11:84242948-84242970 ACCAACACACAAAAATTGGAAGG + Intronic
1086227992 11:84535645-84535667 AAAAAGACACAGAAATAGGATGG - Intronic
1086339539 11:85834384-85834406 AAAACCATAAAGAAAAAGGATGG - Intergenic
1088425691 11:109699036-109699058 ACAGCCACACAATAATAGTAGGG + Intergenic
1088807523 11:113365848-113365870 ACAACCAGACAGAACTTGAAAGG - Intronic
1089123715 11:116161436-116161458 ACCACCACTAAGAAAAAGGAAGG + Intergenic
1089810894 11:121130448-121130470 AAAACCACATGCAAATAGGATGG - Intronic
1090502409 11:127274418-127274440 ACAACATCAAAGAGATAGGAAGG - Intergenic
1090656699 11:128851613-128851635 CAAACCACACAGAACTAGAAGGG - Intronic
1091024499 11:132129979-132130001 ACATCCAGAGAGAAAGAGGAAGG - Intronic
1091248452 11:134120656-134120678 ACTACCACAAGGAAAGAGGACGG + Intronic
1091499774 12:1004795-1004817 ACACACACACAGAAAAAGGCAGG - Intronic
1092444336 12:8539874-8539896 ACAGGCACTGAGAAATAGGATGG + Exonic
1094798764 12:34005339-34005361 ACAACCACACAATAATAGTAGGG + Intergenic
1095111514 12:38299406-38299428 ACAACCACACAATAATAGTGGGG + Intergenic
1095577142 12:43753486-43753508 ACAGTGACACAGAAATAGGATGG - Intronic
1097027234 12:56066095-56066117 CCAACCATACAGAAATAGAAGGG + Intergenic
1100402853 12:94247206-94247228 ACAACAACACATAAATAGGCTGG - Intronic
1100572580 12:95857323-95857345 ACTGCCACGCAGAAAAAGGAGGG - Intergenic
1100687068 12:96997919-96997941 AGACCCACACAGAATCAGGATGG + Intergenic
1101178336 12:102181072-102181094 AGAAAAACATAGAAATAGGAGGG - Intronic
1101348983 12:103910527-103910549 ACAAACAAACAGAAATAATATGG + Intergenic
1102198371 12:111040509-111040531 CCAACCACAGAGAGATGGGAGGG - Intronic
1102592861 12:113970137-113970159 ACACACACACAAAAAAAGGAGGG + Intergenic
1102604038 12:114055070-114055092 ACAACCACACAGCATTGGAATGG + Intergenic
1103830363 12:123774442-123774464 ACACACACACAGAAATATAAAGG + Intronic
1104450236 12:128863176-128863198 ACAGCCACATGGGAATAGGATGG + Intronic
1105698868 13:22919042-22919064 ACCATCACACAGAAGGAGGAGGG - Intergenic
1105742722 13:23345312-23345334 ACAACCAAACTAAAAAAGGAAGG + Intronic
1106427727 13:29648234-29648256 ACAACCAACCAGGAATAGAAGGG - Intergenic
1107056767 13:36113672-36113694 ACTACCACCCAGAAATCTGAGGG - Intronic
1107679611 13:42834732-42834754 GCAACCACAAACAACTAGGAAGG + Intergenic
1108448597 13:50536223-50536245 ACACACACACAGAAAAAGTAAGG - Intronic
1109078597 13:57868708-57868730 ACAACAACACAGTAATAGCAAGG + Intergenic
1109782565 13:67130893-67130915 ACACACACACAGAAAGAGGGGGG - Intronic
1110542470 13:76721354-76721376 ATAAACACAGAGCAATAGGAGGG + Intergenic
1110868949 13:80428305-80428327 ACAAAAACACAGAAGCAGGAAGG + Intergenic
1110897146 13:80768450-80768472 ACAACCACACATACAAAGGATGG - Intergenic
1111327450 13:86717939-86717961 ACAAGCACACAAAAATAGCCTGG + Intergenic
1112527735 13:100168391-100168413 ACAATTAGACAGAAATAGGAAGG + Intronic
1114053474 14:18943726-18943748 ACTACCAGACAGAAAAAGAAGGG - Intergenic
1114055039 14:18960651-18960673 ACTACCAGACAGAAAAAGGAGGG - Intergenic
1114107502 14:19441127-19441149 ACTACCAGACAGAAAAAGGAGGG + Intergenic
1114109085 14:19458199-19458221 ACTACCAGACAGAAAAAGAAGGG + Intergenic
1114132367 14:19806400-19806422 ACAAACAAACAAAAATAGTAGGG + Intronic
1114206851 14:20579943-20579965 ATAACCACACAGAAAGATAAAGG - Intergenic
1114315801 14:21508947-21508969 ACAACACCACAGATAGAGGATGG + Intronic
1114337155 14:21702009-21702031 ACAACAACACAGTAACAGCAGGG + Intergenic
1115028703 14:28768847-28768869 ACAAACGTACAGAAATGGGAGGG - Exonic
1117222024 14:53616067-53616089 ACAAAAACACAGAAAAAGGAAGG - Intergenic
1118566872 14:67151098-67151120 AATACCTTACAGAAATAGGAAGG + Intronic
1118646748 14:67847889-67847911 ACAACCACACAAAAATGGGGGGG - Intronic
1120030663 14:79637147-79637169 ACAATGAAACAGAAGTAGGAAGG - Intronic
1120250577 14:82058168-82058190 ATAAAGTCACAGAAATAGGAAGG + Intergenic
1121551419 14:94805245-94805267 AAAACCACAGAGAAAAAGAAAGG - Intergenic
1121814711 14:96920439-96920461 ACAGCCACACACCAATAGGAAGG + Intronic
1121959141 14:98242293-98242315 ACAACAACACAGAGAATGGACGG + Intergenic
1123507433 15:20958261-20958283 AAAAACACACAAAAAAAGGAAGG - Intergenic
1123564659 15:21532003-21532025 AAAAACACACAAAAAAAGGAAGG - Intergenic
1123600913 15:21969293-21969315 AAAAACACACAAAAAAAGGAAGG - Intergenic
1124247939 15:28086382-28086404 ACAACCACCCAGCAATAAGGTGG + Intronic
1124439004 15:29673946-29673968 ACACACACACAGCAACAGGACGG - Intergenic
1126039878 15:44579371-44579393 ACAAACACACAAAAATAGCTGGG + Intronic
1126624364 15:50672034-50672056 CCAACCAAACAAAAATAGGTAGG - Intronic
1126732002 15:51693186-51693208 ACACACACACAAAAGTAGGAAGG + Intronic
1128045121 15:64611187-64611209 GTAACCATACAGGAATAGGAGGG + Intronic
1128716101 15:69909253-69909275 ACTGCCACACAGAAAAAGGAGGG + Intergenic
1130622640 15:85479577-85479599 AAATCCACAAAAAAATAGGAGGG - Intronic
1130954606 15:88618706-88618728 AAAACCATAGAGAAATGGGAAGG + Intergenic
1131738731 15:95363145-95363167 AAAACCAAACAAAAATAGGTGGG - Intergenic
1131759672 15:95608010-95608032 CTAACCACACAGAAATATGTAGG + Intergenic
1131891331 15:96974697-96974719 AGAACTACCTAGAAATAGGATGG + Intergenic
1202973021 15_KI270727v1_random:259113-259135 AAAAACACACAAAAAAAGGAAGG - Intergenic
1133088394 16:3383722-3383744 AAAACCCCACAGAAATACAATGG + Intronic
1133573944 16:7069389-7069411 ACGAACACACAGAAACATGAAGG - Intronic
1134896000 16:17887198-17887220 ACAGCCATGTAGAAATAGGATGG - Intergenic
1134991143 16:18700587-18700609 ACAAACAAACAAAAAAAGGAAGG + Intergenic
1135739320 16:24960117-24960139 ACAACCATACAGAAAGAATAAGG + Intronic
1135835254 16:25819474-25819496 ACAATCCCACCGAATTAGGAAGG - Intronic
1135921411 16:26652228-26652250 ACAACTACACAGCAATAAAAAGG - Intergenic
1136597083 16:31258707-31258729 ACACACACACAAAAATAGGCTGG + Intergenic
1136987711 16:35126249-35126271 ACACACACACAGAGATTGGAAGG + Intergenic
1137272825 16:46913774-46913796 ACACACACACAGTAATAGGCTGG + Intronic
1137575827 16:49599658-49599680 ACAAACACACAGCAATACAAAGG + Intronic
1138937918 16:61753015-61753037 ACAACCACAAAAACATATGATGG + Intronic
1139094481 16:63688505-63688527 ACCATCACACAGAAATATAAAGG + Intergenic
1139173191 16:64656199-64656221 ACACCCTCACAGAAAATGGAAGG - Intergenic
1140341195 16:74164863-74164885 AGAAACACACAAAAATAGGATGG + Intergenic
1140494698 16:75374658-75374680 AAAAACACACAGAAATAAAATGG + Intronic
1140928756 16:79607854-79607876 ACAAGCACACAAATCTAGGATGG - Intergenic
1143190077 17:5034325-5034347 ACAACCACAGAGAGGTATGAGGG + Exonic
1143931251 17:10428833-10428855 AGAAGCACACTGAAATAGGAAGG + Intergenic
1144685165 17:17221375-17221397 ACAATCACACCGAGATCGGAGGG + Intronic
1144797586 17:17902780-17902802 ACATCCACATAGATATAGTATGG + Intronic
1145834963 17:27947872-27947894 ACAAATTCACAGAAATAGAATGG + Intergenic
1146149134 17:30452119-30452141 ACATACACACATACATAGGAGGG - Intronic
1147609444 17:41793045-41793067 ACAAGAAAACAGAGATAGGACGG + Intergenic
1150430787 17:65115245-65115267 ACAACAACACAAAATGAGGAAGG - Intergenic
1150513435 17:65781272-65781294 ACATACTCACAAAAATAGGAGGG + Intronic
1150641073 17:66949896-66949918 ATAAAAACACAGAAAGAGGAGGG - Intergenic
1151271707 17:73001622-73001644 ACAGAAACAGAGAAATAGGAAGG + Intronic
1152064229 17:78101537-78101559 ACACACACACAGAAATAGAGCGG + Intronic
1152220979 17:79066250-79066272 ACACACACACACATATAGGATGG + Intergenic
1153815407 18:8786129-8786151 CCAGCCACACAGAAAAAGGAGGG - Intronic
1155292270 18:24354225-24354247 GCAAGGACACAGAACTAGGATGG + Intronic
1155842102 18:30658896-30658918 ACTACCACACAGCAAAAGGAGGG + Intergenic
1155894529 18:31307888-31307910 ACAAATATAAAGAAATAGGATGG - Intergenic
1157900263 18:51508357-51508379 ACACACACACAGAAATATAAAGG + Intergenic
1157960950 18:52152709-52152731 ATAAAGACACTGAAATAGGAAGG + Intergenic
1158934279 18:62350204-62350226 TAAACCACACAAAAATAGGTGGG - Intronic
1158969766 18:62655699-62655721 ACACACACACAGGAATGGGATGG + Intergenic
1159193857 18:65085692-65085714 GCAACCAGACAGAAATGTGAGGG - Intergenic
1161830799 19:6602746-6602768 ACACACACACAGAATTAGGGTGG + Intronic
1161958857 19:7511907-7511929 ACACACACACAGAAACAAGAAGG + Intronic
1162300939 19:9844596-9844618 AGAACCACACAGACACAGGGTGG - Intronic
1162529135 19:11225529-11225551 ACACACACACAAAAATAGGTGGG + Intronic
1163379413 19:16955132-16955154 ACAAACACACAAAAATAGCTGGG + Intronic
1164187754 19:22886202-22886224 ACAAACACACACAAATAGCCAGG - Intergenic
1167012651 19:46819073-46819095 ACAGCCATGCAGAAAAAGGAGGG + Intergenic
1167359501 19:49022817-49022839 GCAACCACACACACACAGGATGG - Intergenic
1167364440 19:49047586-49047608 GCAACCACACACACACAGGATGG - Intergenic
1168188401 19:54717426-54717448 ACAGCCACACAATAATAGTAAGG + Intergenic
925838649 2:7969971-7969993 AAGACCACACAGAACTGGGACGG + Intergenic
926546786 2:14251348-14251370 ACAAAAACACACAAATAGGCTGG - Intergenic
926929251 2:18020702-18020724 ACAACCACACAATAATGGTAGGG - Intronic
927353897 2:22151617-22151639 ACAACCACACAGCTGGAGGAAGG - Intergenic
927368099 2:22322417-22322439 ACAAACAAACAAAAATAGAATGG + Intergenic
928090352 2:28370071-28370093 ACAAACAAACAAAAATAGGCCGG + Intergenic
928963791 2:36956961-36956983 AAAGCAACACAAAAATAGGAAGG + Intronic
929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG + Intergenic
931209625 2:60180078-60180100 CAAATCACACAGAACTAGGAAGG + Intergenic
932748593 2:74356264-74356286 ATAACCACAGAGAAGCAGGAGGG + Intronic
932828205 2:74960353-74960375 CTAACCATAAAGAAATAGGAGGG + Intronic
933005660 2:76990681-76990703 ACAACCACACAATAATAGTGAGG + Intronic
933835040 2:86239261-86239283 ACAGCAACACAGAACTAAGAAGG + Intronic
934179129 2:89604216-89604238 ACCACTACATAGAAACAGGAAGG + Intergenic
934289413 2:91678484-91678506 ACCACTACATAGAAACAGGAAGG + Intergenic
935728457 2:106044662-106044684 ATAATCACAAATAAATAGGAAGG + Intergenic
938473050 2:131583438-131583460 ACTACCAGACAGAAAAAGGAGGG - Intergenic
941050870 2:160732141-160732163 ACAAGGTCAGAGAAATAGGAAGG + Intergenic
941548757 2:166888442-166888464 ACACCCACATAGAAACAGGTCGG - Intergenic
942681200 2:178479998-178480020 CGAAGCAAACAGAAATAGGAAGG + Intergenic
942741704 2:179187967-179187989 ACAGCCACACAATAATAGCAGGG + Intronic
943616806 2:190101728-190101750 ACAGCCACACAGTAATAGTGGGG + Intronic
943798238 2:192025733-192025755 AGTACCACACCTAAATAGGAAGG - Intronic
944251312 2:197582113-197582135 ACCACCACACAGAAACATGATGG - Intronic
944290726 2:198001617-198001639 ACAACTACACAGAAAAAAAATGG - Intronic
944347007 2:198680685-198680707 ACAATGCCACAGAAATAGAAAGG + Intergenic
944355308 2:198780157-198780179 ACAAACACACACAAAAAGGCGGG - Intergenic
944998551 2:205322649-205322671 ACAAACAAACAAAAATATGAAGG + Intronic
945095210 2:206212732-206212754 ACAACAACAAACAAATGGGAAGG + Intronic
946024012 2:216661016-216661038 AAAACCATACAGAAATGTGAAGG - Intronic
946243702 2:218373032-218373054 ACAACAACACAGACACAGGTAGG - Intergenic
946699906 2:222401986-222402008 ACACACACACACAGATAGGAAGG - Intergenic
948455644 2:238103483-238103505 ACACGCACACACAAATGGGAAGG + Intronic
948511829 2:238472466-238472488 CCTACCACACAAAAATAGTAGGG - Intergenic
1169590006 20:7130326-7130348 AAAACCACACAGAAAGAGAGAGG - Intergenic
1170008034 20:11690101-11690123 ACAACAACTCAGAAGAAGGATGG - Intergenic
1170847958 20:19977828-19977850 ACAAACCCACAGAAAAAGCATGG - Intronic
1175001638 20:55635513-55635535 ACAAACAAACAGAAACTGGAGGG - Intergenic
1175348147 20:58297757-58297779 ACAAGCACAGACAAACAGGAGGG + Intergenic
1175435012 20:58940036-58940058 TCTACCACACAGAAATTTGAAGG - Intergenic
1175486190 20:59348353-59348375 ACAACCCCACAGAAAAGGAAAGG - Intergenic
1177180696 21:17741862-17741884 ACAGCCATACAGAAACAGGATGG + Intergenic
1177301458 21:19250581-19250603 ACAGCAACACAGTAATAGCAGGG + Intergenic
1177458813 21:21381941-21381963 ACAATCCTTCAGAAATAGGAAGG - Intronic
1178584014 21:33858064-33858086 TCAACCACACAGAGCTTGGAGGG + Intronic
1180471943 22:15666107-15666129 ACTACCAGACAGAAAAAGAAGGG - Intergenic
1180473520 22:15683201-15683223 ACTACCAGACAGAAAAAGGAGGG - Intergenic
1182193758 22:28492519-28492541 ACAAACAAACAAAAACAGGAAGG + Intronic
1182586803 22:31348077-31348099 ACATCCACAGAGAAAGAGAAAGG + Intergenic
1183699015 22:39439287-39439309 ACAAACATACAGAAACAGTACGG + Intergenic
1184240827 22:43210510-43210532 CCAGCCACAGAGAAATAGGGTGG - Intronic
949254562 3:2030425-2030447 AAATTCACACAGAAATTGGAAGG + Intergenic
949360007 3:3221644-3221666 AGCAGCACACAGAAATAGCAAGG + Intergenic
950083154 3:10238114-10238136 ACACACACACAGACATAGGGAGG + Intronic
951454748 3:22878055-22878077 ACAAACACCCAGAAAAAGAAGGG - Intergenic
951926172 3:27910876-27910898 ACAAACATACAGAGATAGGGAGG - Intergenic
952043759 3:29292283-29292305 ACAACCACAGAGAAATATGGAGG + Intronic
952576768 3:34783489-34783511 AAAACCACAGAGCAACAGGAAGG + Intergenic
953394910 3:42560959-42560981 ACAGCCACCAAGAAACAGGATGG + Intronic
953910010 3:46887589-46887611 GGAAACACACAGAAAGAGGAAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955216956 3:56992013-56992035 ACACACACACAGAGAGAGGAGGG - Intronic
955871398 3:63442224-63442246 ACAAAGAGACAGAGATAGGAAGG + Intronic
955973245 3:64456841-64456863 ACAACATGACAGAAATAGAAGGG - Intergenic
956950727 3:74279423-74279445 ACAAACACACACACATATGATGG + Intronic
958024393 3:88033576-88033598 CCACCCACCCAGAAATAGAAAGG + Intergenic
958063674 3:88514907-88514929 ACAACCATTTAGAAATAGAATGG + Intergenic
958159117 3:89793833-89793855 ACAACCACACTTCAATAAGATGG - Intergenic
958164513 3:89862467-89862489 ACAAACACACACATAGAGGAAGG + Intergenic
959039741 3:101407318-101407340 ACAGCAACACAGTAATAGTAGGG + Intronic
959215053 3:103440673-103440695 ATAACAACACAGAAATTAGAAGG - Intergenic
959945279 3:112119390-112119412 ACAAACAAACAGAAACAGTAGGG + Intronic
960446104 3:117750792-117750814 ACACACACACAGGATTAGGAAGG + Intergenic
960809216 3:121612385-121612407 ACAACCCCAAATAACTAGGAGGG + Intronic
961172077 3:124804384-124804406 ACAACCACAAAGAAATTAGCTGG + Intronic
961853947 3:129850660-129850682 ACACACACACAGAAATAGAGAGG + Intronic
963148702 3:142021253-142021275 AGAACCAAATAGAAAGAGGAAGG - Intronic
963369387 3:144379111-144379133 ACAAAAACACAGAAATAGCTTGG + Intergenic
965415459 3:168387396-168387418 ACCAACACACAGAAAGAGGGCGG + Intergenic
966704450 3:182895627-182895649 ACACACACACAGAAAGAGGGCGG + Intronic
966932100 3:184682308-184682330 ACAAACAAACAGAAAAAGAATGG - Intronic
969385097 4:6839601-6839623 ACAAAGACACAGAAATAGGAGGG + Intronic
969830153 4:9789400-9789422 ACCACTACATAGAAACAGGAAGG - Intronic
970459899 4:16263179-16263201 ACTACCACTCAGAAATAAAAAGG - Intergenic
970806374 4:20039572-20039594 ACAACCACAAAGAAGAAAGATGG - Intergenic
970922662 4:21413134-21413156 ACAACCAAATAAAAATATGATGG - Intronic
971121787 4:23712679-23712701 ACAACCATACAGATATTGGCAGG - Intergenic
972926648 4:44016695-44016717 ACTGCCACACAGAAAAAGGAGGG + Intergenic
972926657 4:44016767-44016789 ACTGCCACACAGAAAAAGGAGGG + Intergenic
972926663 4:44016810-44016832 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972926674 4:44016896-44016918 ACTGCCACACAGAAGAAGGAGGG + Intergenic
972926679 4:44016939-44016961 ACTGCCACACAGAAAAAGGAGGG + Intergenic
972926684 4:44016968-44016990 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972926690 4:44017011-44017033 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972941399 4:44199181-44199203 ACAACCACACAATAATAGTAAGG + Intronic
973101010 4:46271087-46271109 CCAACCACAAATACATAGGAAGG - Intronic
973106459 4:46344694-46344716 ACTACTACACAGAAGGAGGAGGG + Intronic
973752559 4:54036784-54036806 ACAACCACAAAAAAAAAGAAAGG + Intronic
974262159 4:59539820-59539842 AAAACCATACTGAAATATGATGG - Intergenic
974530851 4:63106331-63106353 ACACACACACAGAAAGAGGGTGG - Intergenic
974963732 4:68735322-68735344 GCTTCCACACAGAAAGAGGAGGG + Intergenic
976045230 4:80938623-80938645 ACACACACACAGAAATATAAAGG - Intronic
976299398 4:83503820-83503842 ACACACACACATAAATAGGCCGG - Intronic
976708502 4:88043479-88043501 ACAACCACACAGAAATAGGAGGG - Intronic
977483841 4:97616180-97616202 AAAACCATAGAGAAATATGAAGG + Intronic
977633331 4:99267950-99267972 GCAAGCACACAGAACTAGTAAGG - Intergenic
977787478 4:101054644-101054666 ACAGCTAGACAGAAATAGGTAGG + Intronic
980450212 4:132959752-132959774 ACACACACACAGAAATAGAGAGG - Intergenic
981750559 4:148089692-148089714 AAAACAAAACAGAAATGGGATGG - Intronic
982747242 4:159117243-159117265 ACAGCTACACAAAAACAGGATGG - Intronic
983090081 4:163493128-163493150 ACTGCCACACAGAAAAAGAAGGG - Intergenic
983650151 4:170028998-170029020 ACACACACACACAAATAGTATGG + Intronic
984110701 4:175610005-175610027 ACACACACACAGAAATATAAAGG + Intergenic
986067390 5:4248237-4248259 ACAACCACCCAGAGAAAAGAAGG - Intergenic
986623280 5:9698862-9698884 ACACACACACAGAAACAGCATGG - Intronic
987597704 5:20022210-20022232 ACAACAACAGAGAAATGGCAAGG - Intronic
987866529 5:23547118-23547140 ACAACCACACAGTAATAGTAGGG - Intergenic
988616336 5:32778619-32778641 ACAGCCAAACAGAAATAGGGTGG + Intronic
989002460 5:36775367-36775389 ACTGCCACACAGCAAAAGGAGGG - Intergenic
989051217 5:37322148-37322170 ACAAAAACACATAAATAGGCCGG - Intronic
989214980 5:38894743-38894765 ACAACCACAAAAAAATAGTTGGG + Intronic
989401140 5:41008889-41008911 AAAAACACACAGAAAAGGGAGGG + Intronic
989541308 5:42622133-42622155 CCAACCACAGAGCAAAAGGAGGG + Intronic
989759089 5:44990253-44990275 ACACACACACAGAAATATAAAGG - Intergenic
990005597 5:50940485-50940507 ACAGCAACACAGTAATAGCAGGG + Intergenic
991274094 5:64823132-64823154 AAAACACCACTGAAATAGGAAGG - Intronic
991430934 5:66544802-66544824 ACAGCCAGATAGAAATAGAAAGG - Intergenic
991676147 5:69091636-69091658 ACACACACACAGAAAGAGGGCGG - Intergenic
991679891 5:69128410-69128432 ACAAACAAACAAAAATAGGCGGG - Intronic
992247894 5:74846372-74846394 ACAACCACATAAAAATAATATGG + Intronic
992608524 5:78487005-78487027 AACACCACACAGAAAGAGGCTGG - Exonic
993925701 5:93863202-93863224 AAAACTCCTCAGAAATAGGATGG + Intronic
993971697 5:94427759-94427781 ACAGCCACACAAAAATAGTGGGG - Intronic
994285350 5:97957980-97958002 AAAACAACACAGAAAGAAGAAGG - Intergenic
994543072 5:101124926-101124948 ACAGCCACACAGTAAGAGGCTGG + Intergenic
994858713 5:105160195-105160217 ACAACTACACAGATATTGCAGGG - Intergenic
995256266 5:110050246-110050268 ACAAGCACACAGCAAAATGAAGG - Intergenic
995492371 5:112706782-112706804 CAAACCACACAGAAAGATGATGG - Intergenic
995506145 5:112862359-112862381 ACTGCCACGCAGAAAAAGGAGGG + Intronic
995636340 5:114196668-114196690 ACAACCTTATAGAAACAGGAAGG - Intergenic
999210973 5:149887957-149887979 ACACACACACAGAAAGAGGGCGG - Intronic
999853148 5:155564689-155564711 ACTGCCACACAGCAAAAGGAGGG - Intergenic
1000991979 5:167920545-167920567 ACACACACACACAAATAGCATGG + Intronic
1002177919 5:177412608-177412630 ACAGAAACACAGAAAGAGGAGGG + Intronic
1002920319 6:1564627-1564649 ACAACAACAAAGAGACAGGAAGG + Intergenic
1004599595 6:17135085-17135107 ACAGCCACACAATAATAGCAGGG + Intergenic
1005155250 6:22797699-22797721 ACAGCCACACAATAATAGTAGGG - Intergenic
1005221933 6:23597016-23597038 ACAACAACAAAAAAAGAGGATGG - Intergenic
1005300723 6:24467860-24467882 GAAACCACACAGAAATAGATTGG - Intronic
1005362670 6:25045893-25045915 ACAACCACACAATAATAGTCGGG + Intergenic
1006254948 6:32823963-32823985 ACACACACACAGAAAGAGGAAGG - Intronic
1006262503 6:32887048-32887070 AAAAGCACACAGTAATAGGTTGG - Intergenic
1006524053 6:34588909-34588931 ACACCCAGACAGAAACAGGCAGG + Exonic
1007843989 6:44739025-44739047 ACATCCACACAGAGAGAGAAAGG + Intergenic
1008135684 6:47774071-47774093 ACAGCCACAAAGAAAAAGAAAGG - Intergenic
1008699888 6:54086373-54086395 ACATACACACATAAATAGGTGGG - Intronic
1009808280 6:68630009-68630031 ACACACACACAGAAATAGAATGG + Intergenic
1010119867 6:72363000-72363022 ACAAGAAAACAGAAACAGGATGG + Intronic
1010295210 6:74187950-74187972 AAAACCACACAGAACTACAAAGG - Intergenic
1010988884 6:82457335-82457357 ATAGCCACACAGTAATAGCAGGG - Intergenic
1011005465 6:82639641-82639663 ACAACAACACAATAATAGTAGGG + Intergenic
1011168854 6:84481523-84481545 ACAACAACACAGTAATAGTGGGG + Intergenic
1011181411 6:84625743-84625765 ACAATTACAGAGAAATGGGATGG - Intergenic
1013335688 6:109158130-109158152 AATACCACACAGAAATAAAAAGG - Intronic
1013946227 6:115726180-115726202 ACAGCAACACAGTAATAGGGGGG - Intergenic
1014198671 6:118585535-118585557 ACTCCCCCACAGAAATAGGATGG + Intronic
1014955126 6:127606156-127606178 ACAAGCCCACTGAAATAGTAAGG - Intergenic
1015112105 6:129604512-129604534 TCAACTACTCAGAAATAGGGAGG - Intronic
1016748779 6:147610206-147610228 ATAAACACACAGCAAAAGGAAGG + Intronic
1017502158 6:155035567-155035589 ACATACACACAGGAATAAGATGG - Intronic
1017545142 6:155442593-155442615 TCAACCACAAAGAAAGAGGTAGG + Intronic
1018412006 6:163559062-163559084 AAAACCACAGAGAAAAAAGATGG - Intronic
1018737692 6:166700863-166700885 ACAAACACACAAAAAAAGGGTGG - Intronic
1018867703 6:167758796-167758818 ACAACCACGCAGCCATAGGAGGG + Intergenic
1020676665 7:11192058-11192080 AATTCCACACAGAAAGAGGAGGG - Intergenic
1020861011 7:13491635-13491657 ACAGCAACACAGTAATAGTAGGG + Intergenic
1020992146 7:15212276-15212298 ACACACACACACAAATAGCATGG + Intronic
1021036173 7:15801812-15801834 ACAACCACAGAAGAATGGGAAGG - Intergenic
1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG + Intergenic
1022148340 7:27570887-27570909 ATAAACCCACAGAAACAGGAAGG - Intronic
1022999707 7:35795972-35795994 ACAACAACAAAGAAATAGTTTGG + Intergenic
1023080963 7:36525929-36525951 AAAAGCACAAAGAAAGAGGAGGG + Intronic
1023403751 7:39810603-39810625 ACACACACACAGAAATATGGAGG + Intergenic
1024327481 7:48121002-48121024 ACACACACACAGAAATATGGAGG - Intergenic
1027221539 7:76217240-76217262 ACACACACACAGAAAGAGCACGG + Intronic
1027495360 7:78881103-78881125 ACAACCACACAGTAATAGTGGGG + Intronic
1027602550 7:80257136-80257158 AGAGCCACACTGAAATGGGATGG - Intergenic
1028030082 7:85900512-85900534 ACAAACACACAGACACATGAAGG + Intergenic
1028818518 7:95177916-95177938 ACAACAACACAGTAATAGTGGGG + Intronic
1030380533 7:108805749-108805771 AACAACACACAGGAATAGGAAGG + Intergenic
1031079976 7:117248936-117248958 ACATGCACACATAAACAGGATGG - Intergenic
1031506849 7:122595745-122595767 CCAACTACACAGAAGTAGAATGG + Intronic
1031935218 7:127729039-127729061 ACCACCACACAGAGAGAGGCAGG - Intronic
1032955684 7:136969541-136969563 AAAACAACACAGAACTTGGAAGG - Intronic
1034079593 7:148263809-148263831 TCAACCACGCAGACATAGGAAGG + Intronic
1035057492 7:156045819-156045841 AGCACCACACAGCTATAGGAAGG - Intergenic
1035661079 8:1349315-1349337 ACATCCACACACAGGTAGGAAGG + Intergenic
1035661095 8:1349403-1349425 ACATCCACACACAGGTAGGAAGG + Intergenic
1035661128 8:1349548-1349570 ACATCCACACACAGATAGGAAGG + Intergenic
1035661146 8:1349636-1349658 ACATCCACACACAGGTAGGAAGG + Intergenic
1036828764 8:12003069-12003091 AAAACCCCAAAGGAATAGGATGG + Intergenic
1042211276 8:66383025-66383047 CCAACCAGACAGAAAGAGAATGG + Intergenic
1042716148 8:71774944-71774966 ACAATGAGACCGAAATAGGAAGG + Intergenic
1043121406 8:76329898-76329920 ACAACAACACAAAAATACAAAGG - Intergenic
1043672069 8:82898942-82898964 ACAGCAACACAGTAATAGTAAGG + Intergenic
1043740675 8:83807812-83807834 GTTACCACACAGAAACAGGAGGG + Intergenic
1043761709 8:84076348-84076370 ACAGCCACACTGAAATAAGAGGG + Intergenic
1044002281 8:86897881-86897903 GCACCCACACATAAATAGGAAGG + Intronic
1044482721 8:92711589-92711611 ACAACAACAAAGAAACAGAAGGG - Intergenic
1045410867 8:101916889-101916911 ACAGCCACACAATAATAGAAGGG + Intronic
1045612049 8:103855964-103855986 ACAACCACACAATAATAGTGAGG - Intronic
1046571761 8:115975009-115975031 ACAACCACACCAATATAAGATGG - Intergenic
1047372909 8:124270934-124270956 AGAACCAGATAGAAACAGGAAGG + Intergenic
1047539441 8:125750242-125750264 ACTGCCACACAGAAAATGGAGGG - Intergenic
1047563580 8:126015438-126015460 TGAACTACACATAAATAGGATGG + Intergenic
1047704564 8:127484613-127484635 GCTACCACCCAGGAATAGGAAGG + Intergenic
1048577233 8:135702268-135702290 ACAGCCACACAGAGAATGGAAGG - Intergenic
1050574063 9:6974342-6974364 AAAAGCAGACAGAAATAGCATGG - Intronic
1050592271 9:7173171-7173193 ACATCCACTCAGTAAGAGGAGGG - Intergenic
1051428079 9:16954478-16954500 AGACACACACAGAAATGGGATGG - Intergenic
1051551821 9:18338345-18338367 AAAACCAGACACTAATAGGAAGG - Intergenic
1052072619 9:24100839-24100861 AGAACCAAACAGAAATACTAGGG + Intergenic
1052240073 9:26261290-26261312 ACCAATACACAGAGATAGGAGGG + Intergenic
1052565587 9:30145751-30145773 AAAAACACACAGAAAAAGCAAGG + Intergenic
1052703239 9:31962691-31962713 ACTACCACACAAAAATAGTGGGG + Intergenic
1053207653 9:36200528-36200550 ACTGACACCCAGAAATAGGAAGG + Intronic
1053320636 9:37095446-37095468 ACAAAAACACAAAAATAGCAGGG + Intergenic
1053358783 9:37468342-37468364 ACTGCCAGACAGAAAAAGGAGGG - Intergenic
1053453240 9:38210949-38210971 CCCACCACACAGAGAAAGGAAGG + Intergenic
1055644547 9:78350442-78350464 ACAACAACAAAAAAATAGCAGGG - Intergenic
1056566727 9:87779363-87779385 ACACACACACAGAAATAGAGAGG + Intergenic
1057084441 9:92196042-92196064 ACACACACACAGAAATTGGCTGG + Intergenic
1057890159 9:98863888-98863910 ACAAACAAACAAAAATACGAAGG + Intergenic
1058215504 9:102228189-102228211 ACAACGAAACAGAACAAGGAAGG - Intergenic
1058999119 9:110329947-110329969 AGAACAAAACAGAAGTAGGAGGG - Intronic
1060352235 9:122868830-122868852 ACACACACACACATATAGGAGGG - Intronic
1060976193 9:127766550-127766572 ACAAACAAACAAAAACAGGAAGG - Intronic
1061470852 9:130824344-130824366 ACAAAAAAACAGAAAAAGGAAGG - Intronic
1186130910 X:6464426-6464448 GCAACCACAGAGAAAATGGAAGG - Intergenic
1186271367 X:7891909-7891931 ACACACACACAGAAAGAGGGTGG + Intergenic
1186538288 X:10372614-10372636 ACAAGCACACAGTATTTGGAAGG + Intergenic
1186885285 X:13906983-13907005 TCAACTACACATAAATATGATGG + Intronic
1187214069 X:17257885-17257907 ACAACAATACAGTAATAGTAGGG + Intergenic
1187262737 X:17702256-17702278 ACAACCACCCTGAAAGAGGTGGG + Intronic
1188246763 X:27844741-27844763 ACAATCACACAGAAATACTTAGG - Intergenic
1191150296 X:57213927-57213949 ACAACAATACAGCAATAGCAGGG - Intergenic
1191848362 X:65567407-65567429 ACACACACACAGAAATATAAAGG + Intergenic
1194141474 X:90215660-90215682 ACACACACACAGAAAGAGGGTGG + Intergenic
1194149070 X:90300917-90300939 ACAAACACACAGACAGAGGCAGG + Intergenic
1194439986 X:93920486-93920508 GCAACCTCACAGATGTAGGATGG + Intergenic
1194549923 X:95284882-95284904 ACACATACACAGAAATAGGTTGG - Intergenic
1194731444 X:97460177-97460199 ACTTCCACACAGGAAAAGGAGGG + Intronic
1194789086 X:98123614-98123636 ACAACCTTACAGAAATAAAAAGG + Intergenic
1194898213 X:99471316-99471338 ACAGCCACACAGTAATAGTAGGG + Intergenic
1195464050 X:105159997-105160019 ACAACCACAAAAAAATGGGGTGG - Intronic
1195933042 X:110098246-110098268 AAAACCACTCAGAAATAAAAAGG - Intronic
1195999467 X:110765729-110765751 ACAGCAACACAGTAATAGTAGGG + Intronic
1196553407 X:117057757-117057779 ACAAACACACAGAAGGAAGATGG - Intergenic
1197197171 X:123714516-123714538 ACACCAACACAGTAATAGTAGGG + Intronic
1197714388 X:129695912-129695934 GCAACCATACAGAAACGGGATGG - Intergenic
1199320516 X:146432611-146432633 ACAACCACATAAAAAAAGGTGGG + Intergenic
1200687435 Y:6268880-6268902 AAAAGCACACAGAAATCTGATGG - Intergenic
1200774743 Y:7160187-7160209 ACAACAACACAGAAACCTGATGG + Intergenic
1201011386 Y:9550398-9550420 AAAAGCACACAGAAATCTGATGG - Intergenic
1201047838 Y:9905830-9905852 AAAAGCACACAGAAATCTGATGG + Intergenic
1201307809 Y:12565663-12565685 ACAACAACACAGTAATAGTGAGG - Intergenic
1202039845 Y:20669929-20669951 ACACATACACAGAAAGAGGATGG - Intergenic
1202116162 Y:21470423-21470445 AAAAGCACACAGAAATCTGATGG - Intergenic