ID: 976715840

View in Genome Browser
Species Human (GRCh38)
Location 4:88121911-88121933
Sequence ACAGCAAATAAGTGGATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976715838_976715840 19 Left 976715838 4:88121869-88121891 CCTGTAAGAGACACTTTATCTCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG 0: 1
1: 0
2: 1
3: 17
4: 273
976715837_976715840 24 Left 976715837 4:88121864-88121886 CCAGTCCTGTAAGAGACACTTTA 0: 1
1: 0
2: 0
3: 22
4: 138
Right 976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG 0: 1
1: 0
2: 1
3: 17
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976715840 Original CRISPR ACAGCAAATAAGTGGATACC TGG Intronic
900059473 1:668331-668353 AGAGCAAACACGTGGATACATGG + Intergenic
902310671 1:15579145-15579167 ACAGCCAAAAAGGGGAGACCTGG + Intronic
902412821 1:16221362-16221384 ACAGCAAATGAGTGGACATGTGG + Intergenic
903734394 1:25521046-25521068 ACAGCCAATAAGTGGTCAGCTGG - Intergenic
905966528 1:42103187-42103209 AATGCACATCAGTGGATACCAGG - Intergenic
906215597 1:44036355-44036377 ATAGCCATTAAGTGGAGACCTGG - Intergenic
907270278 1:53287165-53287187 ACACCAATTAAATGGATAGCAGG + Intronic
907650169 1:56287352-56287374 ACAGCAATTAAATGGATTGCTGG - Intergenic
907943600 1:59112042-59112064 GTAGGAAATGAGTGGATACCTGG + Intergenic
908900798 1:68954311-68954333 GCAGCAAATAACAGGAAACCAGG + Intergenic
909596053 1:77407469-77407491 AAAGCAGATAAATGGTTACCTGG + Intronic
910404090 1:86867523-86867545 ACAACAAATCAGTGGTTGCCAGG + Intronic
910695677 1:90012414-90012436 AAAGCAGATTAGTGGTTACCAGG + Intronic
910775861 1:90873887-90873909 AAAGCAAATCAGTGGTTTCCTGG - Intergenic
911378235 1:97078204-97078226 ACAGCAAAAGAGTGGTAACCAGG + Exonic
911514684 1:98852887-98852909 ACAGCTACTAAGTGACTACCAGG - Intergenic
911528609 1:99016452-99016474 AGAGCAAATCAGTGGTTCCCAGG + Intergenic
912320716 1:108710158-108710180 AAAGCAAATCAGTGGCTGCCTGG - Intergenic
912478130 1:109955494-109955516 AAAGCAGATCAGTGGTTACCTGG + Intergenic
914232170 1:145773506-145773528 ACAGCTAATCAGTAGAGACCTGG - Intronic
914443203 1:147724824-147724846 ACAGTAGATGAGTGGTTACCAGG - Intergenic
916400528 1:164443114-164443136 ACAGCATATCAGTGGTTACTTGG - Intergenic
917356644 1:174132738-174132760 AAAGCAAATTAGTGGTTTCCTGG + Intergenic
919349717 1:196433429-196433451 CCAGCAAATTAGTGGTTGCCTGG + Intronic
919477372 1:198045452-198045474 AAAGCAAATCAGTGGTTGCCTGG - Intergenic
921928235 1:220731315-220731337 AAAGCAAATTAGTGGTTGCCAGG + Intergenic
922022982 1:221722775-221722797 ACAGAAGAGTAGTGGATACCAGG + Intronic
923135639 1:231116054-231116076 ACAGCCAGTGAGTGGCTACCAGG + Intergenic
923457098 1:234173975-234173997 ACAGCAGAAAAGGGGCTACCTGG + Intronic
1063239256 10:4151551-4151573 TCAGAAAATAAGTGGGTCCCCGG - Intergenic
1067859770 10:49833672-49833694 ACAGCAAAGAGGTGGAAATCAGG - Intronic
1068477308 10:57545081-57545103 AAAGCAAATCAGTGGTTACCTGG + Intergenic
1068739175 10:60449577-60449599 ACAGCTAATAGGTGGACCCCAGG - Intronic
1069015385 10:63423342-63423364 ACAGTAAATTAGTGATTACCAGG - Intronic
1070046214 10:72839393-72839415 AGAGCAAATTAGTGGTTACCTGG - Intronic
1070173137 10:73947756-73947778 ACAGGAGATAAGTGGAAAACTGG + Intergenic
1070911520 10:80123036-80123058 AAACCGAGTAAGTGGATACCAGG + Intergenic
1071818806 10:89259847-89259869 ACAGAAAATTAGTGGTTTCCTGG + Intronic
1072848961 10:98865590-98865612 ACAGCAAATAAAGGGATGCATGG + Intronic
1074551556 10:114447885-114447907 ACAGCAAATGAGGGGGGACCAGG + Exonic
1074994479 10:118744450-118744472 AAAGCAAATTGGTGGATGCCAGG + Intronic
1076185566 10:128445665-128445687 AAAGCAGATTAATGGATACCTGG + Intergenic
1076776201 10:132699547-132699569 CCAGTGAATAAGTGGACACCTGG - Intronic
1078299151 11:10107920-10107942 AAAGCAAATCAGTGGTTATCTGG + Intronic
1079509385 11:21193348-21193370 ACAGCAAATGTGTGGAAACTGGG + Intronic
1080742006 11:35074714-35074736 ACAGCAGATCAGTGGTTACATGG + Intergenic
1080759452 11:35234157-35234179 AAAGCAAATAAATGGAAACAGGG + Intergenic
1080891459 11:36412130-36412152 ACAGCTACTAAGTGGCTGCCAGG + Intronic
1082126622 11:48439354-48439376 AAAGCAGATTAGTGGTTACCAGG - Intergenic
1083066972 11:59934187-59934209 AGAGTAAATTAGTGGTTACCAGG - Intergenic
1083128596 11:60599263-60599285 AAAGCAGATAAGTAGATGCCTGG - Intergenic
1083942494 11:65904131-65904153 GAAGCAAATTAGTGGATACCAGG - Intergenic
1084116862 11:67047645-67047667 ACAGCAAGGAAGTGGAGGCCAGG + Intronic
1086204923 11:84246352-84246374 ACAGCTAATAAGTGAATAAAGGG - Intronic
1086600906 11:88632161-88632183 AAAGCAAATCAGTGGTTGCCTGG - Intronic
1087442674 11:98206912-98206934 ACAGAAGATAGGTGGTTACCAGG - Intergenic
1087630225 11:100641498-100641520 ACAGTAGATTAGTGGTTACCAGG - Intergenic
1089239780 11:117067486-117067508 ACAGCAAATCAGTGGTTTTCTGG + Intronic
1090832727 11:130430276-130430298 ACAGCAAATAAGGGGCTTCAAGG - Intergenic
1091381364 12:63725-63747 ACAGCAAGTCAGTGGTTAACTGG + Intergenic
1092916676 12:13195821-13195843 ACAGCAAATTTGTGGAGAGCTGG + Intergenic
1094180370 12:27586194-27586216 ACAGCAAATAAGTGGTGGACTGG + Intronic
1094240582 12:28218619-28218641 AAAGCAAATCAGTGGTTGCCAGG - Intronic
1094317947 12:29152735-29152757 ATAGCAAATAAGTAGTTACAAGG + Intronic
1094468606 12:30781296-30781318 AAAGCAGATAAGTGGTTAACTGG + Intergenic
1096773071 12:53948918-53948940 AAGGCAAATATGAGGATACCGGG + Intergenic
1096979571 12:55720511-55720533 ACAGGAGGTAAGTGGATACTGGG + Exonic
1096989249 12:55785937-55785959 AGAGTAAATAATTGGATACAGGG - Intronic
1098731695 12:74043629-74043651 ACAGCAAATAAGTGAGTCACTGG - Intergenic
1100316031 12:93445291-93445313 ACAACAAAACAGTGGTTACCTGG + Intergenic
1100528455 12:95442116-95442138 AAAGTAAATAAGTGGTTTCCAGG + Intergenic
1101928448 12:108992705-108992727 AAAGCAGATTAGTGGCTACCAGG + Intronic
1102358102 12:112257535-112257557 ACAGCAAATAAGTGATCACCTGG - Intronic
1102450016 12:113034823-113034845 ACAGACAAAAAGTGGTTACCAGG + Intergenic
1103686803 12:122738584-122738606 ACAGCTACTAAGTGACTACCAGG + Intergenic
1106352055 13:28940426-28940448 ACAGCAAATTGGTGTTTACCAGG + Intronic
1107450202 13:40501349-40501371 ACTGAAAAAAAGTGGATGCCTGG - Intergenic
1108093009 13:46869867-46869889 ACAGCAGATTAGAGGTTACCAGG + Intronic
1109675178 13:65665764-65665786 AGAACAAATCAGTGGTTACCAGG - Intergenic
1110597302 13:77333610-77333632 AGAGCAAATAAGCAGATTCCTGG - Intergenic
1111642612 13:90988840-90988862 AAAGCAAATGAGTGGTTAACAGG + Intergenic
1113399527 13:109978174-109978196 ACAGCAAAGCAGTTTATACCAGG - Intergenic
1115177751 14:30584039-30584061 AAAGCAGATTAGTGGTTACCAGG - Intronic
1119211400 14:72835015-72835037 AAAGCAGATTAGTGGTTACCAGG + Intronic
1119678905 14:76577149-76577171 ACAGCAGATTAGTGGTTGCCAGG - Intergenic
1121036974 14:90714330-90714352 AGAGCAAATAAGTGGTTGCCTGG + Intronic
1121800809 14:96772632-96772654 ACTTCAACTAAGTGGATAACGGG + Intergenic
1123783928 15:23649968-23649990 ACAGCTACTAAGTGAATAACAGG - Intergenic
1125085733 15:35726987-35727009 ACAGCACACAAGTGGCGACCAGG - Intergenic
1125282994 15:38063001-38063023 AGAGGAAATAAGTGGAAACTCGG + Intergenic
1125316136 15:38433646-38433668 AAAGCAAATCAGTGGTTGCCTGG - Intergenic
1125548218 15:40524575-40524597 ACAGCAGATCAGTGGTTGCCTGG + Intergenic
1126809493 15:52386841-52386863 TCAGAAAATAAGTCGAGACCAGG - Intronic
1126916725 15:53474184-53474206 ACAGATAATAAATGGGTACCTGG - Intergenic
1128438061 15:67675410-67675432 AGAGCACATTAGTGGTTACCAGG + Intronic
1129645616 15:77428666-77428688 ACACCAAATAAGTGGACTCTAGG + Intronic
1129890632 15:79069469-79069491 ACCCCAAATAAGTGGAGCCCTGG + Intronic
1130513983 15:84611770-84611792 ACAACAAAAAAGTGGATGTCTGG + Intronic
1133423837 16:5670144-5670166 ACAGCAGATTAGTGGTTACTGGG + Intergenic
1134050275 16:11132263-11132285 AAAGCAGATTAGTGGATGCCAGG - Intronic
1135074757 16:19383593-19383615 ACAGGAAATAATCGGAAACCAGG - Intergenic
1135411223 16:22236095-22236117 GCAGCAAAAAACTGGAAACCAGG - Intronic
1135426662 16:22343051-22343073 ACAGTAAAATAGTGGTTACCAGG + Intergenic
1137423908 16:48360377-48360399 ACAGCAAATAACTGGGTATATGG - Intronic
1140554497 16:75905986-75906008 ACATCAAAAAAGTGGTTGCCTGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141144203 16:81517611-81517633 ACAGCTAATATGTGAATACAGGG - Intronic
1141270243 16:82533009-82533031 AAAGCAGATTAGTGGTTACCTGG - Intergenic
1141579597 16:84988208-84988230 ACAGCAGATGAGTGGTTGCCAGG + Intronic
1145048088 17:19635007-19635029 ACAGCAGATTAGTGGTTGCCAGG - Intergenic
1146051952 17:29561413-29561435 TCAGCAAATAAGTGGGTATTTGG - Exonic
1146238575 17:31191582-31191604 AAAGCAGATCAGTGGATGCCAGG + Intronic
1146641488 17:34545166-34545188 AAAGTAAAAAGGTGGATACCAGG + Intergenic
1147708058 17:42441741-42441763 ACTGCACAGAGGTGGATACCTGG + Intergenic
1149804286 17:59600179-59600201 AAAGCAGATTAGTGGTTACCTGG - Intronic
1150033795 17:61771229-61771251 ATAGCAGATTAGTGGATACTAGG + Intronic
1150530256 17:65973693-65973715 ACAGGAAATCAGTGGTTGCCTGG + Intronic
1151270606 17:72992761-72992783 AAAGCAGATCAGTGGTTACCTGG + Intronic
1152780011 17:82222967-82222989 ACAGCAGATGGGTGGATACCGGG + Intergenic
1154414432 18:14168274-14168296 AAAGCAGATCAGTGGATGCCAGG - Intergenic
1157102099 18:44740343-44740365 ACAGCAAGAAAGTGGTTATCAGG + Intronic
1157733728 18:50027990-50028012 AAAGCAAATTAGAGGTTACCTGG + Intronic
1157744522 18:50123251-50123273 AAAGCAGATTAGTGGCTACCAGG + Intronic
1162451760 19:10759278-10759300 AAGGCAGATCAGTGGATACCTGG - Intronic
1162712688 19:12607793-12607815 GCAGCAAATCAGTGGAGGCCAGG + Intronic
1164484975 19:28647747-28647769 AAAGCAGATTAGTGGTTACCAGG + Intergenic
1165657395 19:37545687-37545709 ACAGCAGATTAGTGGATGCCAGG - Intronic
1167004044 19:46763953-46763975 AAAGCAGATCAGTGGTTACCGGG + Intronic
1168229893 19:55023901-55023923 AGAACAAATTAATGGATACCAGG + Intronic
1168448317 19:56443078-56443100 ACAGAAGATAAGTGGTTGCCTGG + Intronic
926213927 2:10891956-10891978 ACAGCAAATGAGAGGAAAACTGG + Intergenic
928430187 2:31211872-31211894 AAAGCAAGTCAGTGGTTACCTGG + Intronic
928769553 2:34690493-34690515 AAAGCATATTAGTGGATAACTGG + Intergenic
930959892 2:57248954-57248976 ATAGCAAATATTTTGATACCTGG - Intergenic
931705043 2:64940222-64940244 ACAGCAGATTAGTGGTTGCCTGG + Intergenic
931920120 2:67006035-67006057 AGAGGAACTAAGTGGATACTCGG - Intergenic
933407820 2:81884079-81884101 GAAGGAAATAAGTGGATATCTGG + Intergenic
937329264 2:121015541-121015563 AAAGCAAATTAGTGGCTGCCTGG + Intergenic
937431332 2:121841239-121841261 AAAGTAAATCAGTGGTTACCTGG - Intergenic
937926233 2:127169668-127169690 AAATCAAATAAGTGGATAAGGGG + Intergenic
938422997 2:131158754-131158776 ACAGCTAATAAGGGAATATCTGG - Intronic
938465221 2:131520610-131520632 CCAGCAAAGGAGTGGCTACCAGG + Intergenic
939439913 2:142233791-142233813 ATAGCAAAAGAGTGAATACCAGG + Intergenic
939555706 2:143670304-143670326 ACAGAAAATACGTTGACACCAGG - Intronic
939715427 2:145578104-145578126 AAAGCATATTAGTGGTTACCAGG - Intergenic
940635022 2:156288829-156288851 AAAGCAAATTAGTGGTTATCTGG - Intergenic
942164983 2:173232967-173232989 ACAGCAAAAAGGTGCATACATGG + Intronic
942999979 2:182314650-182314672 AAAGCAGATAAGTGGCTGCCTGG + Intronic
943512778 2:188846857-188846879 AGAGCAAAACAGTGGTTACCAGG + Intergenic
944303597 2:198154525-198154547 AAAGTAGATAAGTGGTTACCTGG + Intronic
944612053 2:201420927-201420949 ACAGCAGATCAGTGGCTGCCTGG + Intronic
946493557 2:220172990-220173012 ACAGCAGAACAGTGGTTACCAGG + Intergenic
946895156 2:224316912-224316934 AAAGCAAATGAGTGGATGCCTGG + Intergenic
947678480 2:232007384-232007406 ATAGAAAATAATTGGAAACCTGG + Intronic
948917524 2:241042937-241042959 ACTCCAAATACGTGGATCCCAGG - Intronic
948917538 2:241043049-241043071 ACTCCAAATACGTGGATCCCAGG - Intronic
1172800777 20:37574635-37574657 CCAGCAAATCAGTGGCTACTTGG + Intergenic
1172961273 20:38801833-38801855 ACAGCTAAAAAGTGGAAACAAGG - Intergenic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1176283844 20:64331108-64331130 ACAGCAAGTCAGTGGTTAACTGG - Intergenic
1176858604 21:13989971-13989993 AAAGCAGATCAGTGGATGCCAGG + Intergenic
1176931207 21:14812458-14812480 ACAGCAACTAAGTGACTAACAGG + Intergenic
1178105424 21:29313775-29313797 AAAGCAAATTATTGGTTACCTGG + Intronic
1178929671 21:36806526-36806548 ACAGCAAAAAAGTGGTTGCCGGG + Intronic
1179546689 21:42117123-42117145 AAAGCAGATAAGTGATTACCAGG - Intronic
1182170694 22:28225807-28225829 AAAGCAAATCAGTGGTTGCCTGG - Intronic
1182229127 22:28823376-28823398 ACAGCAGATTAGTGGTTGCCAGG + Intergenic
1183035366 22:35137003-35137025 ACAGCAAGAAAGTCGAGACCAGG + Intergenic
1184053190 22:42024012-42024034 AAAGCAGATTAGAGGATACCAGG - Intronic
950091012 3:10294430-10294452 ACAGCAAAGAAGAGGACACAAGG - Intronic
952147221 3:30546654-30546676 ACAGCAAATAAGTAGCAACAAGG - Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
953942236 3:47110234-47110256 ACAGCAAATTAGTGGCTGCCAGG + Intronic
955144009 3:56298199-56298221 AAAGTAAATCAGTGGTTACCAGG - Intronic
955524676 3:59808105-59808127 AAAGCAGATAAGTGGTTGCCAGG - Intronic
955944318 3:64177592-64177614 ACAGTAAATTAGAGGTTACCAGG - Intronic
956008393 3:64804837-64804859 ACAGCAACCCAGTGGATACAGGG + Intergenic
958616418 3:96498781-96498803 ACAGCCAATATTTGGTTACCTGG - Intergenic
958871737 3:99567361-99567383 ACAACAAAAAAATGGATTCCTGG - Intergenic
958958784 3:100489470-100489492 AGAGCAGATAAGTGGTTGCCAGG - Intergenic
959326494 3:104944339-104944361 AGAGGAAATAAGTTGATAACAGG - Intergenic
961703823 3:128768102-128768124 AAAGCAGATCAGTGGTTACCTGG - Intronic
962294061 3:134164438-134164460 AAAGCAAATTAGTGGGTACTTGG - Intronic
962577269 3:136766367-136766389 AAAGCAGATCAGTGGTTACCTGG - Intergenic
964907360 3:161733773-161733795 AAAGCAAATCAGTGGTTGCCTGG - Intergenic
966703600 3:182885048-182885070 AAAGCAAATCAGTGGTTGCCTGG + Intronic
969340876 4:6540237-6540259 AAAGCAGATTAGTGGTTACCAGG - Intronic
975789637 4:77935101-77935123 CTAGTAAATAAGTGGTTACCAGG + Intronic
976628824 4:87216993-87217015 ACAGCCAATAAGTGGAGATCTGG + Intronic
976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG + Intronic
977370927 4:96134660-96134682 ACTGCCAATAAATGGATAGCAGG + Intergenic
978150765 4:105431895-105431917 ACAGTAAATTAGTGGTTGCCAGG + Intronic
978503274 4:109432187-109432209 ACAGCAAATTAGTGGACAAGGGG + Intergenic
979762362 4:124422101-124422123 ACACCAGATAAATGGATGCCTGG + Intergenic
981693727 4:147538157-147538179 TCAGCAAAACAGTAGATACCTGG - Intronic
981901710 4:149872996-149873018 AAAGCAAACCAGTGGTTACCTGG - Intergenic
982671987 4:158331898-158331920 AAAGCATATCAGTGGTTACCAGG - Intronic
984442268 4:179787242-179787264 AGGACAAATAAGTGGATACAGGG - Intergenic
985714918 5:1450835-1450857 AGAGCAAATCAGTGGTTGCCTGG - Intergenic
986548072 5:8920977-8920999 ACAGCAAAGAGGAGGATGCCTGG + Intergenic
988305199 5:29485834-29485856 ACAGGAAATAATTAGTTACCGGG - Intergenic
989206580 5:38815331-38815353 AAAGCCAATAAGTGGTTGCCAGG - Intergenic
990424640 5:55674253-55674275 AGAGCAAATATGTGGATATAGGG + Intronic
990886023 5:60594652-60594674 ACAGCAGATAAATGGGAACCAGG + Intergenic
991661637 5:68956825-68956847 ACAGCAGAAAAGTGGTTATCAGG + Intergenic
993038222 5:82781925-82781947 AAAGCAAATCAGTGGTTACCTGG + Intergenic
994121281 5:96116123-96116145 AAAGCAAATCAATGGTTACCTGG - Intergenic
994487442 5:100397596-100397618 AGAGAAAATAAGTGGACAACTGG - Intergenic
995030917 5:107480605-107480627 ACACCAATTACGTGAATACCTGG + Intronic
995834099 5:116383362-116383384 ACAGCAAAAAGGTGAGTACCTGG + Intronic
997482924 5:134202417-134202439 ACAGTAAATCAGTGGTTGCCAGG - Intronic
997494882 5:134314771-134314793 AAAGCAAATCAGTGGTTATCTGG + Intronic
998285155 5:140852753-140852775 ACATCAAATAATCAGATACCTGG - Intronic
999459303 5:151744119-151744141 AAAGCAAATTAGTGGCTGCCAGG + Intronic
1000276838 5:159745198-159745220 ATAGCAAATCAGTGGTTATCTGG + Intergenic
1002293666 5:178216163-178216185 AAAGCAGATCAGTGGATGCCTGG - Intronic
1004541831 6:16557984-16558006 ACATAGATTAAGTGGATACCAGG + Intronic
1004616764 6:17298152-17298174 AAAGTAAATAAGTTCATACCTGG - Intergenic
1006497685 6:34435550-34435572 AAAGCAAATTAGTGGTTGCCTGG - Intergenic
1007290742 6:40784606-40784628 ACAGAAAAGGAGCGGATACCAGG - Intergenic
1009903593 6:69840640-69840662 ACAGTAAAACAGTGGTTACCAGG - Intergenic
1011184942 6:84663710-84663732 ACAGCAAATATGTAGATAAAAGG - Intergenic
1011620655 6:89239375-89239397 AGAGCAAATAAGTGGATAACTGG - Intergenic
1012316716 6:97790344-97790366 ACAGGAGATAAGTGGGTAACTGG - Intergenic
1015194783 6:130513819-130513841 ACAGCAGACAAGCGGAAACCTGG - Intergenic
1016089301 6:139956371-139956393 AAAGCAGATCAGTGGATATCTGG + Intergenic
1016209729 6:141515750-141515772 ACAACAAATAAGAGGTCACCTGG + Intergenic
1016861910 6:148729279-148729301 AAAGCAAATCAGTGGTTCCCTGG + Intergenic
1017746295 6:157449560-157449582 ACAGCAGATGGGTGGCTACCAGG - Intronic
1018124658 6:160670033-160670055 ACAGCCAGTAAGTGGGAACCAGG + Intergenic
1018558312 6:165073486-165073508 TCAGCAAATAAATGCATCCCTGG - Intergenic
1019866584 7:3716909-3716931 AGAACAAATAAGTGGATAATAGG + Intronic
1020955088 7:14730555-14730577 ACAGCAAATAGTTGGATATGGGG + Intronic
1021203073 7:17747194-17747216 ACAGAAAATAAGTTGATTTCTGG - Intergenic
1022869855 7:34464987-34465009 ACAGCATATAAATAGATGCCAGG - Intergenic
1023038135 7:36150699-36150721 AAAGCAGATCAGTGGTTACCTGG - Intergenic
1026712240 7:72752285-72752307 AAAGCAAATCAGTGGTTTCCAGG + Intronic
1027444157 7:78253362-78253384 AAAGCATATTAGTGGTTACCTGG + Intronic
1027566105 7:79796853-79796875 AGAACAAATAAGTGGTTCCCAGG + Intergenic
1029046392 7:97633815-97633837 ACATCAAATAAGTGCTTATCAGG + Intergenic
1030534849 7:110753375-110753397 ATAGCCAAGAAGTGGAGACCAGG + Intronic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1032350661 7:131160097-131160119 AAAGCAGATAAGTGGTTGCCAGG - Intronic
1033277582 7:139984255-139984277 AAAAAAAATAAGTGGGTACCAGG - Intronic
1034271924 7:149807292-149807314 ACAGAAATCAAGTGGATCCCAGG - Intergenic
1038450623 8:27636860-27636882 ACAGCAAATAATTGGCTTCCGGG + Intronic
1041927264 8:63249846-63249868 ACAGCTAATAAATTGATAACTGG - Intergenic
1042295027 8:67209388-67209410 ACAGCTAATTAGTGGCTGCCAGG + Intronic
1042383158 8:68142315-68142337 AGAGAAAATCAGTGGATGCCAGG - Intronic
1042882093 8:73504933-73504955 ATAGAAAATAACTGGAAACCAGG - Intronic
1044172899 8:89078631-89078653 AAAGCAGATTAGTGGATTCCAGG - Intergenic
1044647004 8:94454238-94454260 AAAGCAAATTAGTGGTTGCCAGG + Intronic
1044771647 8:95641943-95641965 AAAGCAGATAAGTGGTTTCCAGG - Intergenic
1044876314 8:96670837-96670859 ACAACAAATTAGTGGTTGCCAGG + Intronic
1045867754 8:106888024-106888046 AAAGCAAATCAGTAAATACCTGG - Intergenic
1047636779 8:126772315-126772337 TCAGCAAATCAGTGGAAACCAGG - Intergenic
1047983319 8:130206187-130206209 TCAGGAAATAAGGGGATACCTGG + Intronic
1048114731 8:131508943-131508965 ATAGTAAATAAATGTATACCTGG + Intergenic
1049910529 9:262645-262667 AAAGCAAATTAGTAGTTACCAGG + Intronic
1051104722 9:13566388-13566410 ACAGCAAATAATAGGTTAGCAGG + Intergenic
1051813026 9:21072247-21072269 AAAGCAGATTAGTGGTTACCTGG - Intergenic
1052083131 9:24231243-24231265 TCAGCAAATAAGTACATACAAGG - Intergenic
1052587350 9:30446515-30446537 ACTGCAAATAAGTTAATAACTGG + Intergenic
1052845854 9:33335721-33335743 AAAGCAGATCAGTGGTTACCTGG - Intronic
1053170149 9:35872540-35872562 AGAGCAAATCAGTGGCTGCCTGG - Intergenic
1053277685 9:36795609-36795631 ACAGCAAGCAAGTGGAGAACAGG - Intergenic
1053386465 9:37694528-37694550 AAAGTAAATTAGTGGTTACCTGG - Intronic
1057031325 9:91777723-91777745 ACAGCAGATTCGTGGTTACCAGG - Intronic
1059056899 9:110992799-110992821 AAAGCAATTAAGTGGTTGCCTGG + Intronic
1060093825 9:120768906-120768928 ACAAAAAATAGGTGGCTACCGGG + Intronic
1061619581 9:131803126-131803148 ACGGCAAAGAAGTGAATACAAGG + Intergenic
1186591478 X:10934460-10934482 AAAGCAGATTAGTGGTTACCAGG - Intergenic
1186677876 X:11838664-11838686 AAAGCAGATCAGTGGTTACCTGG - Intergenic
1186828195 X:13362982-13363004 ACAGCATTTCAGTGGTTACCTGG + Intergenic
1188965851 X:36550248-36550270 ACAGTAAATTAGAGGATAGCAGG + Intergenic
1189741802 X:44125220-44125242 ACAGCAGATCAGTAGATGCCAGG - Intergenic
1189905726 X:45757194-45757216 AAAGCAGATCAGTGGTTACCTGG - Intergenic
1192288587 X:69765901-69765923 AAAGCAAATTAGTGGTTGCCAGG - Intronic
1192303239 X:69928717-69928739 ACAGCACATAATTGTAAACCAGG + Intronic
1192536282 X:71930565-71930587 AAAGTAAATTAGTGGTTACCAGG - Intergenic
1195612760 X:106887399-106887421 ACAGTAGATTAGTGGTTACCTGG - Intronic
1198557906 X:137815593-137815615 AAAGCAGATAAGTGGTTATCTGG + Intergenic
1199465922 X:148137079-148137101 AAAGCAAATTAGTGGTTTCCAGG - Intergenic
1199891901 X:152092861-152092883 ACAGCAGATAAGTAGTTGCCTGG + Intergenic
1200183676 X:154167763-154167785 GCATCAAGTAAGTGGAGACCAGG + Intergenic
1200189330 X:154204891-154204913 GCATCAAGTAAGTGGAGACCAGG + Intergenic
1200195085 X:154242700-154242722 GCATCAAGTAAGTGGAGACCAGG + Intergenic
1200200735 X:154279821-154279843 GCATCAAGTAAGTGGAGACCAGG + Intronic
1201238462 Y:11934514-11934536 ACAGAAAATAACTGGTTTCCAGG + Intergenic
1201332018 Y:12834558-12834580 ACAGCAACTAAGTAGATAACAGG - Intronic
1201378949 Y:13351551-13351573 ACAGCAACTAAGTGAATAAAGGG + Intronic