ID: 976723389

View in Genome Browser
Species Human (GRCh38)
Location 4:88192443-88192465
Sequence TCGCTCCATCGCCCAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 902
Summary {0: 1, 1: 1, 2: 14, 3: 91, 4: 795}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976723380_976723389 24 Left 976723380 4:88192396-88192418 CCTTCCCTTTCCTTTTCCCTTTC 0: 3
1: 41
2: 335
3: 1241
4: 5896
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723382_976723389 19 Left 976723382 4:88192401-88192423 CCTTTCCTTTTCCCTTTCTTTTC 0: 2
1: 14
2: 271
3: 1407
4: 6492
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723384_976723389 8 Left 976723384 4:88192412-88192434 CCCTTTCTTTTCCTTTTTTTGAG 0: 2
1: 31
2: 248
3: 3031
4: 7044
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723383_976723389 14 Left 976723383 4:88192406-88192428 CCTTTTCCCTTTCTTTTCCTTTT 0: 2
1: 17
2: 261
3: 1743
4: 9060
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723379_976723389 25 Left 976723379 4:88192395-88192417 CCCTTCCCTTTCCTTTTCCCTTT 0: 13
1: 179
2: 467
3: 1388
4: 5655
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723385_976723389 7 Left 976723385 4:88192413-88192435 CCTTTCTTTTCCTTTTTTTGAGA 0: 1
1: 28
2: 242
3: 2950
4: 5757
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723387_976723389 -3 Left 976723387 4:88192423-88192445 CCTTTTTTTGAGATGGAGTCTCG 0: 36
1: 164
2: 262
3: 468
4: 692
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795
976723381_976723389 20 Left 976723381 4:88192400-88192422 CCCTTTCCTTTTCCCTTTCTTTT 0: 2
1: 24
2: 340
3: 1781
4: 8501
Right 976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG 0: 1
1: 1
2: 14
3: 91
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976723389 Original CRISPR TCGCTCCATCGCCCAGGCCC AGG Intronic
900189974 1:1349204-1349226 CCGCCCGACCGCCCAGGCCCCGG + Intronic
900249049 1:1656712-1656734 TCGCACTGTCGCCCAGGGCCGGG - Intronic
900259996 1:1722073-1722095 TCGCACTGTCGCCCAGGGCCAGG - Intronic
900348914 1:2225802-2225824 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
900479250 1:2890117-2890139 GCTCCCCATCCCCCAGGCCCAGG - Intergenic
900928845 1:5723331-5723353 TCTCTCCTCCTCCCAGGCCCTGG + Intergenic
901496376 1:9624678-9624700 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
901540396 1:9911459-9911481 TCGCTCTGTCGCCCAGGCTCAGG + Intergenic
901583093 1:10262177-10262199 TCACTCTGTTGCCCAGGCCCTGG + Intronic
901632276 1:10653692-10653714 TGGCTCAATCCCCCTGGCCCTGG - Exonic
901843652 1:11968871-11968893 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
902404145 1:16173875-16173897 TCACTCCATCCCCCTGCCCCAGG - Intergenic
902406418 1:16186198-16186220 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
902423204 1:16298192-16298214 TTGCTCTATCGCCCAGGCTGGGG - Intronic
902701214 1:18173783-18173805 TCACTCTATCGCCCAGGCTGGGG + Intronic
902937631 1:19775945-19775967 TCGCTCTGTCGCCCAGGCTGTGG + Intronic
903110664 1:21130254-21130276 TCGCTCTGTCGCCCAGGCTAGGG + Intronic
903375633 1:22864070-22864092 TCACTCTGTCGCCCAGGCTCTGG + Intronic
903651381 1:24924327-24924349 TCGCTCTGTCGCCCAGGCCAGGG - Intronic
903748940 1:25607511-25607533 TCTTCCCATCGCCCAGCCCCTGG - Intergenic
903850407 1:26302328-26302350 TCGCTCTGTCGCCCAGGCTGTGG - Intronic
903954223 1:27013618-27013640 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
904027175 1:27511654-27511676 TTGCTCTGTCGCCCAGGCCAGGG - Intergenic
904142594 1:28365617-28365639 TCGCTCTGTCACCCAGGCTCTGG + Intergenic
904699794 1:32351536-32351558 TCGCCCCTTCGCATAGGCCCCGG + Intronic
904758472 1:32783340-32783362 TTGCTCCGTCGCCCAGGCTGGGG + Intronic
904837759 1:33349934-33349956 CCGCTCCCTCGCCCCGCCCCCGG - Intronic
904875667 1:33652778-33652800 TCGCTCTGTCCCCCAGCCCCAGG + Intronic
904972449 1:34429679-34429701 TCCCTCCATTGCCCAGGCTGGGG + Intergenic
905109008 1:35580741-35580763 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
905136673 1:35805845-35805867 TCGCTCTGTCGCCCAGGCTTGGG - Intergenic
905144506 1:35877212-35877234 TCGCTCCCTAGCCCAAGCCAGGG - Intronic
905173116 1:36120714-36120736 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
905383488 1:37581694-37581716 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
905442092 1:38002128-38002150 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
906024661 1:42663426-42663448 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
906217341 1:44050883-44050905 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
906394454 1:45449188-45449210 TCGCTCTGTCACCCAGGCTCGGG - Intronic
907045394 1:51297240-51297262 TCGCTCTGTCGCCCAGGCTAAGG + Intronic
907498464 1:54860954-54860976 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
907845363 1:58201046-58201068 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
907898683 1:58717616-58717638 GTGCTCCCTCCCCCAGGCCCAGG - Intergenic
908257476 1:62314835-62314857 TCACTGTCTCGCCCAGGCCCTGG - Intronic
908498133 1:64715837-64715859 TTGCTCCATTGCCCAGGCAGAGG + Intergenic
908612447 1:65877581-65877603 TTGCTCTATCGCCCAGGCTGGGG - Intronic
911047788 1:93642815-93642837 TCCCTCCATCACCCAGGCACTGG - Intronic
911861240 1:102951708-102951730 TGGCTCCGTTGCCCAGGCTCTGG - Intronic
912091047 1:106076786-106076808 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
912627295 1:111216169-111216191 TAGCTCCACCTCCTAGGCCCCGG - Intronic
912838250 1:113016041-113016063 TCACTCTATCGCCCAGGCTGGGG + Intergenic
913049696 1:115106435-115106457 TCTCTCTGTCGCCCAGGCTCGGG + Intergenic
913574830 1:120161665-120161687 TCGCTCTATTGCCCAGGCTGGGG - Intronic
914296095 1:146326505-146326527 TCGCTCTATTGCCCAGGCTGGGG - Intergenic
914557137 1:148777291-148777313 TCGCTCTATTGCCCAGGCTGGGG - Intergenic
914615697 1:149352939-149352961 TCGCTCTATTGCCCAGGCTGGGG + Intergenic
914721452 1:150292564-150292586 TCACTCTATTGCCCAGGCCAGGG + Intergenic
914757534 1:150572472-150572494 TGGCTCTGTCGCCCAGGCCCCGG + Intergenic
914769193 1:150668412-150668434 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
915126925 1:153672148-153672170 TCCCTCTATCGCCCAGGCTGGGG - Intergenic
915188902 1:154131834-154131856 TCACTCCGTCGCCCAGGCTGGGG + Intronic
915411653 1:155705569-155705591 TCGCTCCATTGCCCAGGATGGGG - Intronic
915429216 1:155852709-155852731 TCGCTCTGTCACCCAGGCCAGGG - Intronic
915460734 1:156069211-156069233 TCGCTCCGTCACCCAGGCTGGGG + Intronic
915907020 1:159886308-159886330 TCACTCTGTCGCCCAGGCTCTGG - Intronic
915988440 1:160489805-160489827 TCTATCCATTGCCCAGACCCTGG + Intronic
916532520 1:165671037-165671059 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
916677896 1:167079450-167079472 TCGCTCTGTCGCCCAGGCTGTGG - Intronic
917737552 1:177934298-177934320 TCTCCCCTTCCCCCAGGCCCTGG + Intronic
917894952 1:179478554-179478576 TGGCTTCATGGGCCAGGCCCAGG - Intronic
918412770 1:184277438-184277460 TCCCTCCATCCCCCAACCCCTGG - Intergenic
919233993 1:194814168-194814190 TCGCTCCATCGCCCAGGCTGGGG + Intergenic
919402096 1:197131582-197131604 TCGCTCTGTCACCCAGGCCCAGG + Intronic
919689288 1:200514976-200514998 TCGCTCTGTCACCCAGGCACTGG + Intergenic
919739252 1:200972464-200972486 TCACCCCACAGCCCAGGCCCCGG - Intronic
919920372 1:202163558-202163580 CCCCTCCCTAGCCCAGGCCCGGG + Intergenic
920429306 1:205906215-205906237 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
921003144 1:211065466-211065488 TCCCTCTTTCTCCCAGGCCCTGG - Intronic
921178833 1:212615819-212615841 TTGCTCCATCACCCAGGCTGGGG + Intronic
921754943 1:218844008-218844030 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
921892899 1:220370750-220370772 TCACTCCCTCTCCCAGGACCTGG - Intergenic
921930802 1:220752815-220752837 TCACTCTATCACCCAGGCTCTGG - Intronic
923017542 1:230138491-230138513 TCGCTGCATCGCCCAGGCTGGGG - Intronic
923023985 1:230189811-230189833 TTCCTCCCTCTCCCAGGCCCTGG + Intronic
923595312 1:235356628-235356650 TCGCTCCGTAGCCCAGGCTGGGG - Intergenic
923598661 1:235381651-235381673 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
923605528 1:235439521-235439543 TTGCTCTGTCGCCCAGGCCCAGG + Intronic
923619586 1:235567467-235567489 TCTCTCCTTCCCCCAGGCCCTGG + Intronic
923785719 1:237066671-237066693 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
924560381 1:245153768-245153790 TCGCGCCCTCGCCCACCCCCGGG + Intergenic
924572238 1:245247424-245247446 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
924728158 1:246689279-246689301 TTGCTCTGTTGCCCAGGCCCTGG + Intergenic
1063335629 10:5210635-5210657 TCACTCTGTCACCCAGGCCCAGG + Intronic
1063451112 10:6150966-6150988 TGGCTCTGTCGCCCAGGCCAGGG - Intronic
1064068330 10:12202981-12203003 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1064090387 10:12378276-12378298 TCACTCCATTGCCCAGGCTAGGG + Intronic
1064390848 10:14940912-14940934 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1064896602 10:20244031-20244053 TCGCTCTGTCGTCCAGGCCCAGG - Intronic
1065204673 10:23345219-23345241 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1066959164 10:42204175-42204197 TCGCTCTGTCGCCCAGGCCCAGG + Intergenic
1067091853 10:43270969-43270991 TCGCTCTATTGCCCAGGCTGGGG + Intergenic
1067444205 10:46330478-46330500 TCGCTCTGTCGCCCAGGCCCAGG + Intergenic
1067606666 10:47670018-47670040 TCCCTCCCTCCCCCAGCCCCTGG + Intergenic
1068362557 10:55997118-55997140 TCGCTCCACCCTCCAGGCCCTGG + Intergenic
1068552011 10:58417098-58417120 TCACTCTATTGCCCAGGCTCTGG - Intergenic
1068830895 10:61493844-61493866 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1068985074 10:63100468-63100490 TCACTCCATCACCCAGGCTTGGG - Intergenic
1069331834 10:67301935-67301957 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1069540100 10:69287591-69287613 TCGATCCTTCCCCCAGCCCCTGG - Intronic
1069558026 10:69410487-69410509 TCACTCTATCGCCCAGGCTAGGG - Intronic
1069601853 10:69712951-69712973 TCACTCTGTCGCCCAGGCTCTGG + Intergenic
1069919882 10:71810094-71810116 TCCCTCCACTGCCCCGGCCCCGG - Intronic
1069977691 10:72227997-72228019 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1070163879 10:73883219-73883241 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1070261860 10:74864320-74864342 ACGCTCCATCTCCCAGGTTCAGG + Intronic
1070299446 10:75192613-75192635 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1070621360 10:78014123-78014145 TCGCTCTATCACCCAGGCTGGGG - Intronic
1071576607 10:86731254-86731276 TCGCTCTGTCGCCCAGGCTTGGG + Intronic
1071695789 10:87869255-87869277 TCGCTCTATCGCCCAGTCTGGGG + Intronic
1072692500 10:97581178-97581200 TTGGTCCATTGCCCATGCCCAGG + Intronic
1073280303 10:102349115-102349137 TTGCTCTATCGCCCAGGCTGGGG - Intronic
1073790008 10:106930248-106930270 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1073973628 10:109074395-109074417 TCTCTCTGTTGCCCAGGCCCAGG + Intergenic
1074587421 10:114781470-114781492 TCACTCCATCACCCAGGCTGGGG - Intergenic
1075362136 10:121848037-121848059 TTGCTCTGTCGCCCAGGCCAGGG - Intronic
1075726992 10:124615775-124615797 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1076204110 10:128581611-128581633 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1076397918 10:130155001-130155023 TCGCTCTGTCACCCAGGCCAGGG + Intronic
1076461271 10:130649073-130649095 TCGCTCCTTCGCTCTGTCCCTGG - Intergenic
1076986164 11:237166-237188 TCCCTCTATCGCCGGGGCCCAGG - Intronic
1077071864 11:678175-678197 TCGCTCTATTGCCCAGGCTGGGG - Intronic
1077666138 11:4111377-4111399 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1078284802 11:9941288-9941310 TTGCTCCATTGCCCAGGCTGGGG - Intronic
1079051375 11:17163274-17163296 TCGCTCTGTCACCCAGGCTCTGG - Intronic
1079172062 11:18105855-18105877 TCCCTACATCCCCCAGGCACCGG - Intronic
1079346943 11:19661103-19661125 TCGCCCCAGCTCCCAGCCCCAGG + Intronic
1079465313 11:20724099-20724121 TGGCTTCATAGGCCAGGCCCAGG - Intronic
1079642454 11:22823759-22823781 TCACTCTATCGCCCAGGCTGGGG + Intronic
1079908930 11:26284871-26284893 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1081134849 11:39428052-39428074 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1081701949 11:45157920-45157942 TTGGGCCATTGCCCAGGCCCTGG + Intronic
1081867178 11:46366406-46366428 CCGCTCCAGCGCCCAGCTCCAGG + Exonic
1081891800 11:46548959-46548981 TTGCTCTGTCGCCCAGGCACTGG - Intronic
1081989858 11:47332032-47332054 TCTTCCCATCTCCCAGGCCCTGG + Intronic
1082834439 11:57641153-57641175 TCACTCCTTCTCCCAGTCCCTGG - Intergenic
1083398204 11:62405765-62405787 TAGCCCCCTCACCCAGGCCCGGG + Intronic
1083688520 11:64392205-64392227 TCGTTCTATTGCCCAGGCTCTGG + Intergenic
1084171711 11:67404196-67404218 GGGCACCATGGCCCAGGCCCTGG + Exonic
1084404214 11:68961584-68961606 TTGCTCTGTCGCCCAGGCTCTGG + Intergenic
1085964507 11:81504707-81504729 TCACTCCATCACCCAGGCTGGGG - Intergenic
1086004148 11:82016055-82016077 TCGCTACATTGCCCAGGCACTGG + Intergenic
1086465251 11:87046345-87046367 TCGCTCCGTCTCCCAGGCTGGGG - Intronic
1086955879 11:92934138-92934160 TCTCTCCGTCGCCCAGGCTGGGG - Intergenic
1087528400 11:99348305-99348327 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1088032683 11:105270646-105270668 TTGCTCCATCGCCCAGGCTGGGG + Intergenic
1088236765 11:107733071-107733093 TTGCTCCGTCGCCCAGGCTGGGG - Intergenic
1088624208 11:111717284-111717306 TCGCTCTGTCGCCCAGGCTCTGG - Intronic
1089028138 11:115293399-115293421 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1089450704 11:118594179-118594201 ACCCTCCACCTCCCAGGCCCAGG + Intronic
1089532632 11:119140896-119140918 TCACTCTGTCGCCCAGGCCGGGG + Intergenic
1089681592 11:120121823-120121845 TCCATCCATGGACCAGGCCCTGG - Intronic
1090039644 11:123279460-123279482 TCGCTCTGTCGCCCAGGCTCGGG + Intergenic
1090186433 11:124741984-124742006 TATCTCCATGGCCCAGGGCCTGG + Intronic
1090927731 11:131263765-131263787 TCGCTCTATCACCCAGGCGCTGG - Intergenic
1091499140 12:998889-998911 TTGCTCTATCGCCCAGGCTGGGG + Intronic
1091790590 12:3269849-3269871 TGGCCCCACTGCCCAGGCCCAGG + Intronic
1091948837 12:4574191-4574213 TCGCTCTGTCGCCCAGGCCAGGG - Intronic
1092387848 12:8049998-8050020 TCGCTCTGTCGCCCAGGCTCTGG + Intronic
1092488554 12:8923796-8923818 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1092761938 12:11818494-11818516 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1092854362 12:12658609-12658631 TCGCTCTATCACCCAGGCTGCGG - Intergenic
1093995748 12:25640690-25640712 TCGCTCTGTCGCCCAGGCCCTGG + Intronic
1094168486 12:27466378-27466400 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1094352043 12:29537743-29537765 CCCCTCCATCTCCCACGCCCCGG + Intronic
1095583354 12:43824900-43824922 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1095903186 12:47349865-47349887 TAGCTCTGTGGCCCAGGCCCAGG + Intergenic
1096048015 12:48581451-48581473 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1096097660 12:48947336-48947358 TCGCTCTCTCGCCCAGGCTGGGG + Intronic
1096294243 12:50370090-50370112 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1096331914 12:50720874-50720896 TCGCTCTGTCGCCCAGGCATTGG + Intronic
1096635951 12:52959625-52959647 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1096664846 12:53157353-53157375 TCGCTCTGTCGCCCAGGCTAAGG + Intergenic
1096694853 12:53342024-53342046 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1096708110 12:53435549-53435571 TCGCTCTGTCGCCCAGGCTGTGG - Intergenic
1097293843 12:57942453-57942475 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1097352023 12:58558884-58558906 TCGCTCTTTCGCCCAGGCCGGGG - Intronic
1097698282 12:62795756-62795778 TCGCTCCGTTGCCCAGGCTAGGG + Intronic
1097875281 12:64637453-64637475 TTGCTCTGTTGCCCAGGCCCAGG + Intronic
1097892245 12:64789212-64789234 TCACTCTGTCGCCCAGGCCCAGG + Intronic
1098474749 12:70887418-70887440 TCGCTCTGTTGCCCAGGCCACGG - Intronic
1098682102 12:73369408-73369430 TCCCTCCTTCCCCCAGCCCCAGG + Intergenic
1099260309 12:80372718-80372740 TTGCTCTATTGCCCAGGCCGGGG + Intronic
1099386408 12:82018674-82018696 TGGCTTCATGGGCCAGGCCCAGG + Intergenic
1099611155 12:84872123-84872145 TCTCTCTGTCGCCCAGGCCGGGG - Intronic
1099662321 12:85579598-85579620 TCGCTCTGTCGCCCAGGCTAGGG + Intergenic
1099757057 12:86865302-86865324 TCGCTCCATCGCCCAGGAGTTGG + Intergenic
1100113758 12:91277524-91277546 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1100380395 12:94056316-94056338 TCTCTCCATCTCCCACTCCCTGG - Intergenic
1100395449 12:94182384-94182406 TTGCTCCATCACCCAGGCTAGGG - Intronic
1100418747 12:94407848-94407870 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1100719608 12:97343816-97343838 TCACTCTGTCACCCAGGCCCAGG + Intergenic
1100801522 12:98236127-98236149 TCACTCCATCACCCAGGCTGGGG - Intergenic
1101522962 12:105502037-105502059 TCCCTCCCTCTCCCAGCCCCAGG - Intergenic
1101785508 12:107879541-107879563 TCGCTCTATCGCCCAGGGACTGG - Intergenic
1102038389 12:109785051-109785073 TCACTCCATTGCCCAGGCTAGGG + Intronic
1102339376 12:112109484-112109506 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1102731685 12:115116849-115116871 TCCCTCCATCCCTCAGCCCCTGG + Intergenic
1102732484 12:115124885-115124907 TCGCTCCGTCACCCAGGCTGGGG - Intergenic
1102873262 12:116430568-116430590 TCGCTCCCTCTCCCAGGCTGGGG + Intergenic
1102975830 12:117206619-117206641 TCGCTCCATCGCCATCGCCCAGG - Intergenic
1103527891 12:121579700-121579722 TCCCTCCACCGCCCAGCGCCCGG + Intronic
1103579089 12:121900953-121900975 TCACTCTGTCGCCCAGGCTCTGG - Intronic
1103695933 12:122815475-122815497 TCGCTCTGTCGCCCAGGCCTTGG + Intronic
1103775481 12:123364224-123364246 TCCCTCCCTCGCCCAGAGCCGGG + Intronic
1104021999 12:124998594-124998616 TTGCTCCCTCCCCCAGCCCCTGG - Intronic
1104445818 12:128832390-128832412 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1104786113 12:131448883-131448905 TCTCTCCATTCCCCAGCCCCTGG + Intergenic
1105461843 13:20597712-20597734 TCGCTCTGTCGCCCAGGCTCTGG - Intronic
1105519496 13:21118959-21118981 TGGCTCCACCTCCCAGGCTCAGG - Intergenic
1105635897 13:22215009-22215031 TCACTCTCTCGCCCAGGCTCTGG - Intergenic
1106331286 13:28741903-28741925 TCACTCTGTTGCCCAGGCCCAGG + Intergenic
1106733537 13:32567016-32567038 TTGCTCTGTCGCCCAGGCCGGGG + Intergenic
1106744146 13:32681592-32681614 TTGCTCTATCGCCCAGGCTGGGG - Intronic
1107272037 13:38631351-38631373 TCACTCCATCACCCAGGCTGGGG + Intergenic
1108180421 13:47835009-47835031 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1108514667 13:51189073-51189095 TCGCTCTGTCGCCCAGGCTCTGG - Intergenic
1108560463 13:51638230-51638252 TCCCTTCTTCACCCAGGCCCTGG - Intronic
1108687931 13:52837002-52837024 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1109070075 13:57754149-57754171 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1109634786 13:65100875-65100897 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1110399989 13:75078797-75078819 CTGCTCCATTGCCCAGGCCAGGG - Intergenic
1114319203 14:21532929-21532951 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1114470443 14:22957432-22957454 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1114505837 14:23212605-23212627 TCGCTCTGTCGCCCAGGCCCAGG + Intronic
1115302436 14:31899593-31899615 TCGCTCCACCTCCCAGGCTGGGG - Intergenic
1115813581 14:37137030-37137052 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1115983272 14:39077194-39077216 TTGCTCCATTGCCCAGGCTAAGG - Intronic
1115986332 14:39106415-39106437 TCACTCTATCGCCCAGGCAGTGG - Intronic
1116483297 14:45417148-45417170 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1116710346 14:48360426-48360448 TCGCTCTGTCACCCAGACCCAGG + Intergenic
1117486716 14:56204996-56205018 TCGCTCTGTCGCCCAGGCTGCGG - Intronic
1118164836 14:63326132-63326154 TCGCTCTGTCGCCCAGGCTCTGG + Intergenic
1118405851 14:65422847-65422869 TCGCTGTATTGCCCAGGCCCAGG + Intronic
1118564838 14:67128286-67128308 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1118656560 14:67956452-67956474 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1119069751 14:71570816-71570838 TCGCTCTATCACCCAGGCTGGGG + Intronic
1119838064 14:77769242-77769264 TCACTCTATCGCCCAGGCTGGGG + Intronic
1119843660 14:77812287-77812309 TCCCTCCAACCCCCAGCCCCTGG + Intronic
1120185588 14:81390532-81390554 TCGCTCTGTTGCCCAGGCTCTGG - Intronic
1120870364 14:89331206-89331228 TCCCACCTTCCCCCAGGCCCTGG + Intronic
1121159008 14:91717201-91717223 CCTCTCCATCTCCCAGTCCCTGG - Intronic
1122388284 14:101363553-101363575 TTGCCCCATCTCCCAGCCCCTGG - Intergenic
1122664013 14:103316440-103316462 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1122912007 14:104834773-104834795 TCGCTCTGTCGCCCAGGCCACGG - Intergenic
1122981239 14:105193211-105193233 TCGGTCCAGCGGCCAGCCCCAGG - Intergenic
1123034923 14:105468060-105468082 CCTCTCCAGCGCCCAGGTCCTGG - Intronic
1202902444 14_GL000194v1_random:51452-51474 TCCCATTATCGCCCAGGCCCAGG - Intergenic
1123500245 15:20875532-20875554 TCTCTCCTTCCCCCAGCCCCTGG + Intergenic
1123557491 15:21449226-21449248 TCTCTCCTTCCCCCAGCCCCTGG + Intergenic
1123593718 15:21886488-21886510 TCTCTCCTTCCCCCAGCCCCTGG + Intergenic
1123681133 15:22765032-22765054 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1124251535 15:28109355-28109377 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1124773403 15:32562800-32562822 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1124933804 15:34150560-34150582 TCGCTCTATCACCCAGGCTGGGG - Intronic
1125509483 15:40285104-40285126 TCTCTCCAGCTCCCAGGCTCCGG + Intronic
1126006458 15:44262608-44262630 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1126627466 15:50698643-50698665 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1126761590 15:51974625-51974647 TCGCTCTGTCTCCCAGGCTCGGG - Intronic
1126797013 15:52267652-52267674 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1126982586 15:54261572-54261594 TCGCTCTGTCGCCCAGGCTGCGG + Intronic
1126983516 15:54274701-54274723 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1127379938 15:58422216-58422238 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1127869226 15:63056633-63056655 TCGCTCTATCACCCAGGCTGGGG - Intronic
1127995645 15:64151929-64151951 GCGCTCGTTCACCCAGGCCCGGG - Intronic
1128018868 15:64372580-64372602 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1128560198 15:68659881-68659903 TCGCTCTGTCACCCAGGCCTTGG - Intronic
1128654473 15:69450406-69450428 TCACTCCATTGCCCAGGCTGGGG - Intergenic
1128743591 15:70098997-70099019 CCGCTCGCTCGCCCCGGCCCCGG + Intergenic
1128758835 15:70201097-70201119 CCGCCCCCTCGCCCAGGCCCAGG - Intergenic
1129198617 15:73985472-73985494 TACCTCCAGCCCCCAGGCCCTGG + Exonic
1129275731 15:74444055-74444077 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1129352003 15:74960955-74960977 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1129447219 15:75626958-75626980 TCGCTCTGTCGCCCAGGCTCTGG + Intergenic
1129786042 15:78310841-78310863 TCACTCTGTTGCCCAGGCCCAGG + Intergenic
1130315844 15:82795798-82795820 TCGCTCCATCACCCAGGCTGAGG - Intronic
1130603718 15:85296200-85296222 TCGCTCTGTCTCCCAGGCTCTGG - Intergenic
1130996459 15:88907155-88907177 TCTCTCCATTGCCCCGCCCCAGG + Intronic
1131100967 15:89690090-89690112 TCGCTCTGTCGCCCAGGCAGTGG - Intronic
1131152908 15:90058094-90058116 TTGATCCATTCCCCAGGCCCGGG - Intronic
1131174382 15:90201091-90201113 TCCCACCGCCGCCCAGGCCCTGG - Intronic
1131638625 15:94264577-94264599 TCGCTCTGTCGCCCAGGCTCTGG - Intronic
1132056037 15:98650360-98650382 TCACCCCACCGCCCAGCCCCGGG - Intronic
1202965841 15_KI270727v1_random:176399-176421 TCTCTCCTTCCCCCAGCCCCTGG + Intergenic
1132919469 16:2377997-2378019 TTGCTCTATTGCCCAGGCTCGGG - Intergenic
1133407819 16:5539567-5539589 TCGCTCTATTGCCCAGGCTGGGG - Intergenic
1133797720 16:9059838-9059860 TCGCTCCGTCGCCCAGGCTGGGG + Intergenic
1133976176 16:10601251-10601273 TCCCTCCAACGCCCAGCCTCTGG - Intergenic
1133999527 16:10771848-10771870 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1134060263 16:11195251-11195273 TCGCTCTATCGCCCAGGCTGGGG + Intergenic
1134101927 16:11458598-11458620 TCTCTCCTTCTCCCAGTCCCTGG - Intronic
1134152099 16:11813000-11813022 TCCCTCTATCGCCCAGGCTGCGG - Intergenic
1134193309 16:12139165-12139187 TCGCTCTATCGCCCAGGCTCTGG - Intronic
1134210664 16:12273768-12273790 TCCCTCCTTCCCCCAGACCCTGG + Intronic
1135012518 16:18894847-18894869 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1135709990 16:24708270-24708292 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1135973126 16:27086826-27086848 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1136187359 16:28596165-28596187 CTGCACCATGGCCCAGGCCCTGG - Exonic
1136189839 16:28609090-28609112 CTGCACCATGGCCCAGGCCCTGG - Intronic
1136522487 16:30805901-30805923 TCGCTCCCTCGGCCAGCCTCGGG - Intergenic
1136587519 16:31196899-31196921 TCGCACTGTCGCCCAGGCCAGGG - Intergenic
1136849389 16:33601611-33601633 TCGCTCTGTCGCCCAGGCTTGGG - Intergenic
1137809887 16:51342961-51342983 ACGCTCTAACTCCCAGGCCCAGG + Intergenic
1138136080 16:54523826-54523848 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1138469812 16:57225088-57225110 TCGCTCTGTCACCCAGGCCAGGG + Intronic
1139092611 16:63667003-63667025 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1139462018 16:67130076-67130098 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1139549607 16:67666329-67666351 TCGCACCACCGCCAAGCCCCCGG + Intronic
1139571915 16:67818175-67818197 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1139591072 16:67933354-67933376 TCGCTCTGTCACCCAGGCTCTGG - Intronic
1139591081 16:67933475-67933497 TCGCTCTGTCACCCAGGCTCTGG - Intronic
1139718580 16:68834291-68834313 TCGCTCCATCGCCCAGGCCTGGG + Exonic
1139740320 16:69030074-69030096 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1140033547 16:71356804-71356826 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1140492469 16:75349617-75349639 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1140604446 16:76517826-76517848 TCGCTCCATCTCCCTAACCCTGG + Intronic
1141208656 16:81956060-81956082 TCACTCCATCCCCCAGACCCCGG + Intronic
1141456688 16:84146711-84146733 TTGCTCCATTGCCCAGGCTGGGG - Intronic
1142262510 16:89049590-89049612 TCCCTCCAGAGCCCAGCCCCAGG + Intergenic
1203111097 16_KI270728v1_random:1450261-1450283 TCGCTCTGTCGCCCAGGCTTGGG - Intergenic
1142562923 17:821717-821739 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1142631804 17:1230151-1230173 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1142661718 17:1434749-1434771 TCACTCCATCGCCCAGGCTGGGG - Intronic
1142734553 17:1887859-1887881 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1142736094 17:1900752-1900774 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1142988132 17:3709875-3709897 TCGCTCTTTCGCCCAGGCTGGGG - Intergenic
1143213361 17:5205979-5206001 TCACTCTATCGCCCAGGCTGGGG + Intergenic
1143243404 17:5463045-5463067 TCGCTCGGTCGCCCAGGCTGAGG - Intronic
1143455152 17:7062677-7062699 TGGCTCCGTCGCCCAGGCTGTGG - Intergenic
1143516767 17:7423183-7423205 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1143627775 17:8121157-8121179 GCTCTCCATGGCCCAAGCCCCGG - Exonic
1143948607 17:10615830-10615852 TGTCTCCAGCGCCCAGACCCAGG + Intergenic
1144014500 17:11181343-11181365 TCGCTCTGTCACCCAGACCCAGG + Intergenic
1144807321 17:17976640-17976662 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1145039152 17:19563955-19563977 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1145064508 17:19752999-19753021 TGGCTCCCAGGCCCAGGCCCTGG + Intergenic
1145885603 17:28380631-28380653 TCACTCCATGGCCCATGACCGGG - Intronic
1147377351 17:40030688-40030710 TCACTCTATCGCCCAGGCTGGGG + Intronic
1147600542 17:41742548-41742570 TCACTCTATCGCCCAGGCTGGGG + Intergenic
1147966722 17:44198236-44198258 TCTCTCCCTCCCCAAGGCCCAGG + Intronic
1148096095 17:45053287-45053309 TCGCTCTATTGCCCAGGCTGGGG + Intronic
1148384521 17:47224534-47224556 TCCCTCCTTCCCCCAGCCCCTGG + Intergenic
1148487627 17:48001133-48001155 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1148511394 17:48173152-48173174 TCGCTCTGTTGCCCAGGCCCAGG - Intronic
1148561835 17:48610783-48610805 CCGCTCCATAGCCCGGGCGCTGG + Exonic
1148692340 17:49536454-49536476 TCACTCTGTCGCCCAGGCTCAGG - Intergenic
1148843159 17:50512081-50512103 TTGCTCTGTCGCCCAGGCTCTGG + Intronic
1149208271 17:54274454-54274476 TCTCTCCATCACCCAGGCCCAGG + Intergenic
1149624285 17:58069024-58069046 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1149673437 17:58435865-58435887 TCGCTCTGTCGCCCAGGCTGCGG - Intronic
1149832190 17:59882313-59882335 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1149936566 17:60812769-60812791 TCCCTCGGTCACCCAGGCCCAGG + Intronic
1149995754 17:61405234-61405256 TCGCTCAACCGCTCAGGCTCCGG - Exonic
1150162181 17:62907806-62907828 TCGCTCTATCGCCCAGACTGCGG - Intergenic
1150758525 17:67938071-67938093 TCGCTCTATTGCCCAGGCTGAGG - Intronic
1150992202 17:70272284-70272306 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1151141939 17:72001590-72001612 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1151463793 17:74271751-74271773 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1151533381 17:74722249-74722271 TCGCTCTGTCGCCCAGGCCAGGG - Intronic
1151829856 17:76543156-76543178 TCTCCCCTTCCCCCAGGCCCTGG + Exonic
1151836578 17:76586120-76586142 TCTCTCCAGAGCCCAGCCCCGGG + Exonic
1152064087 17:78100572-78100594 TGGCTTCATGGGCCAGGCCCAGG - Intronic
1152186324 17:78858415-78858437 TCGCTCTGTCGCCCAGGCCCAGG - Intronic
1152348952 17:79772594-79772616 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1152362616 17:79839571-79839593 TCCCCCCGCCGCCCAGGCCCGGG - Intergenic
1152450226 17:80373971-80373993 TCGCTCTATCGCCCAGGCGCTGG - Intronic
1152601653 17:81265350-81265372 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1152651851 17:81498523-81498545 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1152652800 17:81503531-81503553 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1152713376 17:81886128-81886150 TTGCTCCAACACCGAGGCCCGGG + Intergenic
1152805436 17:82353679-82353701 TCCCCCCATCACCCAGGGCCAGG - Intergenic
1152806356 17:82358473-82358495 TCACTCCCTCTCCCAGCCCCTGG - Intergenic
1152811213 17:82383595-82383617 GCGATCCCTCGGCCAGGCCCCGG - Intergenic
1152973193 18:185727-185749 TCGCTCTGTTGCCCAGGCTCTGG + Intronic
1153284809 18:3448232-3448254 TCGCAGCGTCGCCCAGCCCCCGG + Intronic
1153779326 18:8480037-8480059 TCGCCCCCTCGCCCACCCCCAGG + Intergenic
1154393123 18:13960562-13960584 TCGCTCTTTCGCCCAGGCTGGGG + Intergenic
1155180388 18:23340301-23340323 TCTCTCTATCACCCAGGCCAGGG - Intronic
1155950863 18:31911838-31911860 TCGCTCTGTCGCCCAGGCCTTGG - Intronic
1156007718 18:32463599-32463621 TTGCTCTGTCGCCCAGGCCGGGG + Intronic
1157584413 18:48791958-48791980 TCCCACCATAGCCCAGGGCCTGG - Intronic
1157701220 18:49762486-49762508 TCGCTCCATCTTCCACCCCCGGG - Intergenic
1158071411 18:53475403-53475425 TGGTTCCATGGACCAGGCCCAGG + Intronic
1158686914 18:59622846-59622868 TCTCTCCCTCCCCCAGACCCTGG - Intronic
1158802703 18:60931579-60931601 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1159668781 18:71197457-71197479 TTGCTCTATCGCCCAGGCTGGGG + Intergenic
1159969347 18:74630200-74630222 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1160086328 18:75780570-75780592 TCACTCCATCCCCCAGTCTCTGG + Intergenic
1160751056 19:734798-734820 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1160998421 19:1896055-1896077 TTGCTCCCTCGCCCAGGCTGGGG + Intergenic
1161193446 19:2972582-2972604 TCGCTCTATCACCCAGGCTGGGG - Intergenic
1161336001 19:3713743-3713765 TCGCTCTGTCGCCCAGGCTCTGG + Intronic
1161694879 19:5760905-5760927 TCGCTCTGTCGCCCAGGGTCAGG - Intronic
1161710679 19:5846018-5846040 TTGCTCCATCACCCAGGCTGGGG - Intronic
1161720939 19:5902293-5902315 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1161870437 19:6865513-6865535 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1162545484 19:11326633-11326655 TCTCTCTATTGCCCAGGCCGGGG + Intronic
1162586921 19:11565574-11565596 TCACTCCATCATCCAGGCTCAGG + Intronic
1162597163 19:11638537-11638559 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1162729126 19:12707028-12707050 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1162873064 19:13600321-13600343 TCGCTCCACCTCCCAGGTGCCGG + Intronic
1162970415 19:14177774-14177796 TCCCTTCCTGGCCCAGGCCCAGG - Intronic
1163038103 19:14583293-14583315 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163038792 19:14587550-14587572 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163039538 19:14592217-14592239 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163535395 19:17873722-17873744 TCGCTCTGTCGCCCAGGCTAGGG - Intronic
1163557396 19:18000560-18000582 TCGCTCTGTCGCCCAGGCCGGGG - Intergenic
1163580032 19:18133065-18133087 TCGCTCTGTCGCCCAGGCTTGGG - Intronic
1163626711 19:18394335-18394357 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1163793748 19:19323536-19323558 TCGCTCCATCACCCCGGCTGGGG + Intronic
1164070847 19:21766960-21766982 TCGCTCTGTCGCCCAGGCTAGGG - Intronic
1164315685 19:24086335-24086357 TCGCTCTGTCGCCCAGGCTAGGG + Intronic
1165087284 19:33359612-33359634 TCTCTCCTGCTCCCAGGCCCTGG + Intergenic
1165838606 19:38773677-38773699 TCCCCCCATCACCCAGGGCCCGG + Intergenic
1165875463 19:39003442-39003464 TTGCTCTGTTGCCCAGGCCCAGG - Intronic
1165986827 19:39776839-39776861 TCGCTCTATCACCCAGGCAGTGG - Intronic
1166305155 19:41933101-41933123 TCGCGCCCTCGGCCTGGCCCTGG - Intergenic
1166890669 19:45990561-45990583 TCGCTCCTTCCCCCAGCCTCTGG + Intergenic
1167334418 19:48875727-48875749 ACGCCGCATCACCCAGGCCCAGG + Exonic
1167400527 19:49265193-49265215 TCGCTCCATCGTGCAGGCTAGGG - Intergenic
1167486342 19:49765362-49765384 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1167658514 19:50781955-50781977 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1167779800 19:51591796-51591818 TCGCTCTGTCGCCCAGGCTCTGG + Exonic
1168141958 19:54394029-54394051 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1168328141 19:55548892-55548914 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1168659294 19:58154031-58154053 TTGCTCTATCGCCCAGGCTGGGG + Intronic
925582559 2:5426158-5426180 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
926000915 2:9331734-9331756 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
926638186 2:15206600-15206622 TGGTTCCATGGGCCAGGCCCAGG + Intronic
926641056 2:15237625-15237647 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
926653288 2:15370323-15370345 TCGCTCTATTGCCCAGGCTCGGG + Intronic
928444937 2:31325619-31325641 TCCCTCTGTCACCCAGGCCCAGG + Intergenic
928446588 2:31338753-31338775 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
928586769 2:32767482-32767504 TCGCTCTGTCTCCCAGGCCAAGG + Intronic
929058434 2:37899471-37899493 TCGCTCTATCACCCAGGCTTGGG + Intergenic
929075226 2:38075067-38075089 GCGCGCCATCCACCAGGCCCTGG - Exonic
929105228 2:38358658-38358680 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
929303342 2:40331623-40331645 TCGCTCTGTCGCCCAGGCTAGGG + Intronic
929469731 2:42179632-42179654 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
929605723 2:43232838-43232860 TGCCTCCATCGCTCTGGCCCTGG - Exonic
930683013 2:54277644-54277666 TCTCTCTATCGCCCAGGCTGGGG - Intronic
930947346 2:57091728-57091750 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
931270525 2:60698343-60698365 TCGCCCTGTCTCCCAGGCCCAGG + Intergenic
931425606 2:62168357-62168379 TCGCTCTTTCGCCCAGGCTGGGG - Intergenic
931775215 2:65534406-65534428 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
932041224 2:68301860-68301882 TCGCTCTGTCGCCCAGGCTCTGG - Intronic
932223550 2:70021070-70021092 TTGCTCCCTCCCCCAGTCCCTGG + Intergenic
932287051 2:70543492-70543514 TCGCTCTGTCGCCCAGGCTAGGG - Intronic
932811538 2:74830340-74830362 TTGCTCTATCGCCCAGGCTGGGG - Intergenic
933548694 2:83746687-83746709 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
933825948 2:86161185-86161207 TCGCTCTGTCGCCCAGGCTCAGG + Intronic
934504228 2:94878948-94878970 TCCCATTATCGCCCAGGCCCAGG + Intergenic
935113995 2:100118841-100118863 TCGCTCTGTCGCCCAGGCTAGGG + Intronic
935765896 2:106367341-106367363 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
935965187 2:108465884-108465906 TCTCTCTGTCGCCCAGGCCGGGG + Intronic
936236594 2:110747641-110747663 TCACTCCACTGCCCAGCCCCAGG - Intronic
936365060 2:111845943-111845965 TCGCTCTGTCGCCCAGGTTCTGG - Intronic
936722925 2:115275729-115275751 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
937013523 2:118582845-118582867 TCACTGCATCTCCCAGGCCTGGG - Intergenic
937182051 2:120005703-120005725 TCGCTCAGTCACCCAGGCCGGGG + Intergenic
937918356 2:127111993-127112015 TCCCTCCACCCCCCAGCCCCTGG + Intergenic
938048597 2:128146277-128146299 TCACTCCATCACCCAGGCTGGGG - Intronic
938419748 2:131135631-131135653 TCGCTCTGTCACCCAGGCTCTGG + Intronic
939241902 2:139572419-139572441 TGGTTACATGGCCCAGGCCCAGG + Intergenic
939852894 2:147321262-147321284 TGGCTTCATGGGCCAGGCCCAGG + Intergenic
940153947 2:150633089-150633111 TCGCTCGGTCGCCCAGGCTAGGG - Intergenic
940319674 2:152363591-152363613 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
940803390 2:158157261-158157283 TCACTCCATTGCCCAGGGCCTGG - Intergenic
941826075 2:169898731-169898753 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
942335765 2:174883997-174884019 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
943181974 2:184555971-184555993 TCGCTCAGTCGCCCAGGCTAGGG - Intergenic
943481660 2:188427467-188427489 TCGTTTCATGGGCCAGGCCCAGG + Intronic
943527708 2:189038727-189038749 TCGCTCTGTCGCCCAGGCAGTGG + Intronic
943573575 2:189603353-189603375 TCACTCCATCACCCAGGCTGGGG - Intergenic
944061262 2:195571130-195571152 TCGCTTCGTCGCCCAGGCTGGGG - Intergenic
944714096 2:202361781-202361803 TCGCTCTGTCGCCCAGGCTACGG + Intergenic
944870446 2:203906343-203906365 TCTCTCCCTCGTCCAGCCCCTGG - Intergenic
945018760 2:205549616-205549638 TCACTCCTTCCCCCAGGTCCTGG - Intronic
945435647 2:209814265-209814287 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
945831003 2:214784863-214784885 CCGCTCCATCGGACAGGCCCCGG - Intronic
946025409 2:216669081-216669103 TCTCTCCATCTCCCCAGCCCTGG - Intergenic
946317184 2:218924035-218924057 TGGTTTCATGGCCCAGGCCCAGG - Intergenic
946891560 2:224282444-224282466 TCGCTGTATTGCCCATGCCCTGG + Intergenic
947493462 2:230615642-230615664 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
947521470 2:230849362-230849384 TCCCTCCGTCGCCCAGGCTGGGG - Intergenic
948178138 2:235959984-235960006 ACACTCCATAGCCCAGGCCCTGG - Intronic
948367652 2:237468606-237468628 TTGCTCTGTCGCCCAGGCTCTGG + Intergenic
1168946627 20:1765265-1765287 TCACTCCATCGCCCAGGCTGGGG - Intergenic
1169134361 20:3188001-3188023 TCGCTCTGTCGCCCAGGCAGGGG - Intergenic
1169246482 20:4029212-4029234 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1169712432 20:8580010-8580032 CTGCTCCATCACCCAGGGCCAGG - Intronic
1170227882 20:14011938-14011960 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1170553266 20:17495196-17495218 TTGCTCCATGGCCCAGGCTGAGG + Intronic
1172561744 20:35895053-35895075 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1172698922 20:36840812-36840834 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1173625501 20:44469594-44469616 TCGCTCAACCGCCCAGGCAGTGG + Intergenic
1173692887 20:44978828-44978850 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1174067308 20:47874941-47874963 TCACCTCCTCGCCCAGGCCCAGG - Intergenic
1174156991 20:48521932-48521954 TCACCTCCTCGCCCAGGCCCAGG + Intergenic
1175477455 20:59286931-59286953 TAGCTCCATCCTCCAGGCCCAGG - Intergenic
1175873418 20:62218872-62218894 TCCCTCCTGCCCCCAGGCCCAGG - Intronic
1176621812 21:9066219-9066241 TCCCATTATCGCCCAGGCCCAGG - Intergenic
1176785875 21:13255256-13255278 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1176997394 21:15571387-15571409 TCTCCCCATCTCCCAGGTCCTGG - Intergenic
1177463986 21:21450373-21450395 TCGCTCTATCACCCAGGCTGGGG + Intronic
1178121231 21:29472581-29472603 TCACTCTGTCGCCCAGGCTCTGG + Intronic
1179512637 21:41884028-41884050 ACCCTCCATCGCCCAGGACCTGG - Intergenic
1179663693 21:42894582-42894604 TCACTCTGTTGCCCAGGCCCAGG + Intronic
1179830456 21:43993161-43993183 TCACTCTTTCGCCCAGGCCGGGG - Intergenic
1179893704 21:44350287-44350309 TCGCGCCCTCGCCCCGGCCCCGG - Intronic
1180193748 21:46181730-46181752 CTGCTCCATCGTCCAGGACCAGG + Intronic
1180205481 21:46256811-46256833 TCCCTGCATGGCCCAGGTCCAGG + Exonic
1180658922 22:17448909-17448931 TCGCTCTGTCGCCCAGGCTGAGG + Intronic
1180698326 22:17768430-17768452 TCCCTCCCCTGCCCAGGCCCTGG + Intronic
1180823779 22:18849384-18849406 TTGCTCCATCACCCAGGCTAGGG + Intronic
1181124199 22:20692488-20692510 TTGCTCCATCGCCCAGGCTAGGG + Intergenic
1181188957 22:21125163-21125185 TTGCTCCATCACCCAGGCTAGGG - Intergenic
1181210244 22:21285330-21285352 TTGCTCCATCACCCAGGCTAGGG + Intergenic
1182225154 22:28792014-28792036 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1182226296 22:28801040-28801062 TCGCTCTGTCGCCCAGGCCGGGG - Intergenic
1182456341 22:30453442-30453464 TCGCTCCGTTGCCCAGGCTGGGG + Intronic
1182509983 22:30812195-30812217 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1183607105 22:38872260-38872282 GCGCCGCAGCGCCCAGGCCCCGG + Exonic
1183697874 22:39433419-39433441 TCGCTCTGTCGCCCAGGCTCTGG - Intronic
1183805547 22:40207373-40207395 TCACTCCATCGCCCAGGCTGGGG - Intronic
1183916441 22:41124211-41124233 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1183937302 22:41270477-41270499 TCACTCTGTCGCCCAGGCCGGGG + Intronic
1184216510 22:43070942-43070964 TCGCTCTGTTGCCCAGGCCGGGG + Intronic
1184217385 22:43076717-43076739 TCGCTCTATCGCCCAAGCTGGGG - Intronic
1184469255 22:44686366-44686388 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1184990555 22:48166301-48166323 TTGCTCTATCGCCCAGGCTGGGG + Intergenic
1185242290 22:49753124-49753146 TTGCTCTGCCGCCCAGGCCCAGG + Intergenic
1185308547 22:50138734-50138756 TCGCTCTGTTGCCCAGGCCGAGG + Intronic
1185359257 22:50395590-50395612 TCACTCCATCGCCCAGGCTGGGG + Intronic
1203273922 22_KI270734v1_random:75288-75310 TTGCTCCATCACCCAGGCTAGGG + Intergenic
949725520 3:7040332-7040354 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
950384985 3:12651620-12651642 TCGCTCTATTGCCCAGGCTAGGG - Intronic
952373078 3:32741735-32741757 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
952758282 3:36891309-36891331 TCACTCCATTGCCCAGGCTGGGG - Intronic
953238045 3:41123301-41123323 TGTCTGCATCTCCCAGGCCCTGG - Intergenic
953366705 3:42351561-42351583 CAGCTCCACAGCCCAGGCCCAGG - Intergenic
953730012 3:45439251-45439273 TCACTCCATCGCCCAGGCTGGGG + Intronic
954061498 3:48071516-48071538 TCAGTCCATTGCCCAGGCTCTGG - Intronic
954129244 3:48551564-48551586 TCGCTCTGTCGCCCTTGCCCAGG + Intronic
954632545 3:52055295-52055317 AGGCTCCATTGCCCTGGCCCGGG - Intronic
955009234 3:54998158-54998180 TTGCTCTATTGCCCATGCCCAGG + Intronic
955077505 3:55627432-55627454 TCGCTCTGTCGCCCAGGCTAGGG - Intronic
955156109 3:56418262-56418284 TCGCTCCATCACCCAGGCTGGGG - Intronic
956476234 3:69622505-69622527 TCACTCCATCCCCCAGCTCCAGG + Intergenic
956654840 3:71539141-71539163 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
956661888 3:71607073-71607095 TTGCTCTTTTGCCCAGGCCCAGG + Intergenic
956704462 3:71987519-71987541 TCGCTCCGTTGCCCAGGCTAGGG + Intergenic
956837651 3:73108660-73108682 TCCCTCCCTCCCCCAGTCCCTGG + Intergenic
957397290 3:79658798-79658820 TCGCTCTGTCGCCCAGGCTGAGG + Intronic
957739644 3:84248036-84248058 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
958447576 3:94234116-94234138 TCGCTCAGTCGCCCAGGCTGGGG - Intergenic
959706723 3:109344896-109344918 TTGCTCTATCGCCCAGGCTGGGG + Intergenic
960614645 3:119585579-119585601 TCGCTCTGTCACCCAGGCCAGGG + Intronic
960819304 3:121710823-121710845 TCACTCCATCACCCAGGCTGGGG - Intronic
961084802 3:124057643-124057665 GGGCTCCACCACCCAGGCCCAGG - Intergenic
961188696 3:124938926-124938948 TCGCTCTCTCGCCCATGCCGTGG - Intronic
961837733 3:129677956-129677978 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
962542442 3:136396245-136396267 TCGCTCTGTCGCCCAGGCGGGGG + Intronic
962796126 3:138851038-138851060 TCGCTCCATCACCCAGGCTGGGG + Intergenic
962870034 3:139480759-139480781 TCTCTCTCTGGCCCAGGCCCAGG + Intergenic
963901283 3:150735693-150735715 TCCCTCCATTGCCCAAACCCCGG + Intergenic
964199987 3:154108188-154108210 TCGCTCCGTCGCCCAGGCTGGGG - Intergenic
964376423 3:156052383-156052405 TCCATCCATGGCCCAGGCACTGG + Intronic
964977212 3:162635756-162635778 TCGCTCTGTCGCCCAGGCTAGGG - Intergenic
965277714 3:166707355-166707377 TCCCTCTATTGCCCAGGCCATGG - Intergenic
966681401 3:182645470-182645492 TCACTCTATTGCCCAGGCTCTGG + Intergenic
966691969 3:182751064-182751086 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
966697817 3:182810298-182810320 TTGCTCCATCGCTCAGGCTGAGG - Intronic
967069506 3:185950346-185950368 TCGCTCTGTCGCCCAGGCTGCGG + Intergenic
967320079 3:188186177-188186199 TAGCTCCAACCCCCAGGCCTTGG + Intronic
967366079 3:188687804-188687826 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
967822598 3:193852060-193852082 GCACTTCATCGCCCTGGCCCTGG - Intergenic
968190336 3:196662554-196662576 TTGCTCCATCGCCCAGGCTGGGG - Intronic
968655464 4:1776676-1776698 TCCCTGCATCACCCGGGCCCAGG - Intergenic
968670132 4:1845156-1845178 TCACTCTATCGCCCAGGCTGGGG - Intronic
969140722 4:5069222-5069244 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
969328346 4:6457174-6457196 TCGCTCTGTCGCCCAGGTCGGGG - Intronic
969489745 4:7492232-7492254 TCCCTGCCTCGCCCAGCCCCCGG + Intronic
970294566 4:14614554-14614576 TCGCTCTGTCGCCCAGGCTCTGG - Intergenic
970659244 4:18265358-18265380 TGGCTTCATGGGCCAGGCCCAGG - Intergenic
970784914 4:19783973-19783995 TGGCTTCATGGGCCAGGCCCAGG - Intergenic
971000585 4:22317687-22317709 TCGCTCTTTTGCCCAGGCGCCGG - Intergenic
971388072 4:26159948-26159970 TCACTCTATCGCCCAGGCTGGGG + Intergenic
972008524 4:34143101-34143123 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
972449746 4:39184378-39184400 TTGCTCTGTCGCCCAGGCTCTGG - Intronic
973224297 4:47765277-47765299 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
973236797 4:47914387-47914409 TCGGTCCATCTCCAAAGCCCGGG - Exonic
973888547 4:55346696-55346718 GCGCTCCCTCGGCCTGGCCCCGG + Intronic
975118479 4:70704878-70704900 CTGCTCCCCCGCCCAGGCCCGGG + Intronic
975122374 4:70743098-70743120 TCACTCCATCGTCCAGGCTGCGG + Intronic
975619093 4:76277456-76277478 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
975917064 4:79337739-79337761 TCGCTCTGTCGCCCAGGCTCTGG - Intergenic
975969948 4:80021116-80021138 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
976141942 4:82002176-82002198 TGGTTTCATGGCCCAGGCCCAGG + Intronic
976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG + Intronic
979715750 4:123835272-123835294 TCGCTCTTTCGCCCAGGCCGAGG - Intergenic
979974880 4:127184510-127184532 TGGCTTCATGGGCCAGGCCCAGG + Intergenic
980035473 4:127878519-127878541 TCGCTCTGTCGCCCAGGCTGTGG + Intergenic
980059676 4:128115684-128115706 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
980106743 4:128595315-128595337 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
980383512 4:132058123-132058145 TAGTTCCATGGGCCAGGCCCAGG + Intergenic
981794415 4:148579888-148579910 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
982299847 4:153867575-153867597 TGGTTCCATGGGCCAGGCCCAGG + Intergenic
982525697 4:156474961-156474983 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
982902490 4:161024714-161024736 TCGCTCTGTCGCCCAGGCCCAGG - Intergenic
983068158 4:163235932-163235954 TGGCTTCATTGGCCAGGCCCAGG - Intergenic
984746196 4:183220800-183220822 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
984795045 4:183652390-183652412 TCACTCCATTGCCCAGGCTGGGG + Intronic
985296660 4:188443623-188443645 TCGCTCTGTCGCCCAGGCTCCGG + Intergenic
985429869 4:189868687-189868709 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
985862001 5:2478442-2478464 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
986412776 5:7498278-7498300 TCGCTCTATCGCCCAGGCTGGGG + Intronic
986729399 5:10624159-10624181 TTGCTCTATCGCCCAGGCTGGGG + Intronic
987077541 5:14398101-14398123 GCACTCCATCCCCCAGCCCCAGG - Intronic
987231190 5:15895671-15895693 TCGCTCTGTTGCCCAGGCTCTGG + Intronic
987260430 5:16196666-16196688 TGGCTTCATAGGCCAGGCCCAGG - Intergenic
988519098 5:31930235-31930257 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
988909984 5:35829816-35829838 TCACTCTGTTGCCCAGGCCCGGG - Intergenic
990008558 5:50969317-50969339 TCGCTCGTTCCCACAGGCCCCGG - Intergenic
990030152 5:51249043-51249065 TCGCTCTATTGCCCAGGCTCTGG - Intergenic
990265424 5:54070358-54070380 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
990432277 5:55747513-55747535 TTGCTCCATTGCCCAGGCAAGGG - Intronic
990610029 5:57447604-57447626 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
992030828 5:72719899-72719921 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
992051384 5:72944037-72944059 TCACTCTGTCGCCCAGGCTCTGG + Intergenic
992233058 5:74682324-74682346 TCGCTCTATCGCCCAGGCTGGGG - Intronic
992711500 5:79462166-79462188 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
992962211 5:81967578-81967600 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
993369190 5:87071386-87071408 TCACTCCATCGCCCAGGCTGGGG + Intergenic
993369492 5:87074805-87074827 TCCCTCTATCGCCCAGGCTGGGG + Intergenic
993629024 5:90261078-90261100 TCGCTCTATCACCCAGGCTAGGG - Intergenic
993890473 5:93466360-93466382 TCGCTCTGTCACCCAGGCACTGG + Intergenic
994156976 5:96514775-96514797 TCGCTCTATTGCCCAGGCCCAGG + Intergenic
994167895 5:96626797-96626819 TCCTTCCATCGCCGAGGCCTGGG + Intronic
994351970 5:98756645-98756667 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
994608898 5:102010456-102010478 TCGCTCTATTGCCCAGGCTGGGG + Intergenic
996369759 5:122740636-122740658 TCGCTCTCTCGCCCAGGCCAGGG - Intergenic
996916620 5:128720018-128720040 TCACTCTGTCGCCCAGGCCGGGG - Intronic
997591726 5:135077463-135077485 TCGCTCTATCACCCAGGCAGTGG + Intronic
997594224 5:135095534-135095556 TGTCTCCATCTCCCTGGCCCAGG + Intronic
998075455 5:139232616-139232638 TCACTGTATTGCCCAGGCCCAGG - Intronic
998150776 5:139756332-139756354 TCCCTCCAGCGCCGCGGCCCCGG - Intergenic
998499207 5:142617331-142617353 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
998566172 5:143217724-143217746 TCGCTGCCACGCCCAAGCCCAGG + Intronic
998763730 5:145461330-145461352 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1000244975 5:159441744-159441766 TTGCTCCTTCTCCCAGGCCTGGG - Intergenic
1000267029 5:159647520-159647542 GGGCTCCATGGGCCAGGCCCGGG - Intergenic
1000524895 5:162345548-162345570 CCGCTCTGTTGCCCAGGCCCAGG + Intergenic
1001147304 5:169196046-169196068 TCCCTCCTTCTCCCAGCCCCTGG + Intronic
1001537407 5:172507891-172507913 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1001570896 5:172729886-172729908 TCGTTCCAGGGCCCAGGCCTGGG + Intergenic
1001902977 5:175446057-175446079 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1002130044 5:177075370-177075392 TGGCTCTGTCGCCCAGGCCGGGG - Intronic
1002328784 5:178427790-178427812 TCCCTCCCTCCCCCAGCCCCTGG - Intronic
1002374443 5:178778248-178778270 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1002515650 5:179756397-179756419 TCTGTCTGTCGCCCAGGCCCAGG - Intronic
1003148909 6:3532185-3532207 TCCCTCCTTCCCCCAGGCCCTGG + Intergenic
1003160469 6:3630010-3630032 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1003426607 6:6002200-6002222 TGGCTCCAACCCCCAGGCCTAGG - Intronic
1003624243 6:7727671-7727693 TCACTCCATCCCCTGGGCCCGGG - Intronic
1004216123 6:13705835-13705857 TTGCTCTGTCGCCCAGGCCCAGG - Intronic
1004606497 6:17200235-17200257 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1004627104 6:17387264-17387286 TTGCTCTGTAGCCCAGGCCCAGG + Intergenic
1004765600 6:18722865-18722887 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1005047401 6:21654979-21655001 TCACTCTGTCACCCAGGCCCAGG - Intergenic
1005067535 6:21832941-21832963 TCGCTCTGTCGCCCAGGCAGTGG - Intergenic
1005916590 6:30357497-30357519 TCGCTCTGTCGCCCAGGCTGTGG - Intergenic
1006117449 6:31782674-31782696 TCCCTCCATCTCCCTGACCCGGG + Intronic
1006320834 6:33318396-33318418 TCGCTGTGTCGCCCAGGCCAGGG - Intergenic
1006360989 6:33586895-33586917 TGGTTCCAGCCCCCAGGCCCTGG + Intergenic
1006496538 6:34427349-34427371 TCGCTCTGTCGCCCAAGCTCTGG - Intergenic
1006659284 6:35625809-35625831 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1006713192 6:36093685-36093707 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1006932759 6:37697597-37697619 TCGCGCTCTCGCCCAGGCCGGGG + Exonic
1006955789 6:37870261-37870283 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1007453226 6:41956258-41956280 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1007634324 6:43288797-43288819 TCGCTCTGTTGCCCAGGCCGGGG + Intergenic
1007744845 6:44037407-44037429 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1008283959 6:49627000-49627022 TGGCTTCATGGGCCAGGCCCAGG - Intronic
1008322499 6:50133952-50133974 TCGCTCTGTCGCCCAGGCTCTGG - Intergenic
1008358616 6:50587402-50587424 TTCCTCCACCTCCCAGGCCCTGG + Intergenic
1008611742 6:53190655-53190677 TCGCTCTGTTGCCCAGGCCTGGG + Intergenic
1009776632 6:68213694-68213716 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1010225612 6:73486381-73486403 TCTCTCCTTCCCCCAGCCCCTGG + Intronic
1010254317 6:73740630-73740652 TCGCTCTTTTGCCCAGGCCGTGG + Intronic
1010387312 6:75296529-75296551 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1010422443 6:75690723-75690745 TCGCTCTGTCACCCAGGCTCTGG + Intronic
1010884328 6:81217957-81217979 TGGCTTCATGGGCCAGGCCCAGG + Intergenic
1011141219 6:84159594-84159616 TTGCTCCATCACCCAGGCTGAGG + Intronic
1011444511 6:87423278-87423300 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1011658224 6:89571081-89571103 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1012282269 6:97342272-97342294 TCACTCCATCACCCAGGAGCTGG - Intergenic
1012653288 6:101784199-101784221 TGGCTTCATGGGCCAGGCCCAGG + Intronic
1013655292 6:112240022-112240044 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1016021189 6:139237473-139237495 TCACTCCATCCCCCAGGCACTGG - Intergenic
1016820838 6:148344785-148344807 TTGCTCCGTCGCCCAGGCTGGGG + Intronic
1017319854 6:153077903-153077925 TCGCTCCATCACCCAAGCTGGGG + Intronic
1017505978 6:155068947-155068969 TTGCTCCATCGCCCAGGCTGGGG + Intronic
1017658116 6:156649178-156649200 TCTCTCCTCCTCCCAGGCCCTGG - Intergenic
1017895516 6:158675916-158675938 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1017986648 6:159448877-159448899 TGGCTCTGTCGCCCAGGCTCGGG + Intergenic
1018751711 6:166812322-166812344 TCACTCTGTCGCCCAGGCCAGGG - Intronic
1019212666 6:170418978-170419000 TCGCTCCGTCGCCCAGGCTGGGG - Intergenic
1019449921 7:1092190-1092212 CCGCTACATCGCCCTGGCCAGGG + Exonic
1019574704 7:1731681-1731703 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1019726513 7:2605899-2605921 GAGCCCCATCGCCCAGGCCACGG + Exonic
1020163692 7:5791884-5791906 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1020239254 7:6379778-6379800 TCGCTCTGTCACCCAGGCCGGGG + Intronic
1020305568 7:6831483-6831505 TCACTCTATCGCCCAGGCTGGGG + Intergenic
1021112072 7:16706887-16706909 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1021491052 7:21220421-21220443 CCACTCCATCGCCAAGTCCCAGG - Intergenic
1021702572 7:23334296-23334318 TCGCTCTGTTGCCCAGGCTCTGG - Intronic
1021848755 7:24787736-24787758 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1021917800 7:25453195-25453217 TCGCTCTGTCGCCCAGGCTAGGG - Intergenic
1022737145 7:33086692-33086714 TCGCTCTATCGCTCAGGCTGGGG - Intergenic
1022763752 7:33386520-33386542 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1023768886 7:43536733-43536755 TCCCTCCACCCACCAGGCCCTGG + Intronic
1023902569 7:44494327-44494349 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1025143682 7:56486152-56486174 TCGCTCTGTCGCCCAGGCTAGGG + Intergenic
1025213498 7:57035438-57035460 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1025256578 7:57387735-57387757 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1025658455 7:63541385-63541407 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1025733814 7:64129425-64129447 TCCCTCCTTCTCCCAGTCCCTGG - Intronic
1026002676 7:66574073-66574095 TCACTCCATCACCCAGGCTGGGG + Intergenic
1026098576 7:67366375-67366397 TCGCTCATTCGCCCAGGCTGGGG - Intergenic
1026486833 7:70829244-70829266 TCACACCATCGCCCAAGCCTTGG - Intergenic
1026551405 7:71372188-71372210 TCGCTCTGTTGCCCAGGCCCAGG + Intronic
1026572546 7:71544159-71544181 TCGCTCTGTTGCCCAGGCTCTGG + Intronic
1026776253 7:73232829-73232851 TTGCTCCATCACCCAGGCTGGGG - Intergenic
1026975476 7:74495239-74495261 GCCCTCCAGAGCCCAGGCCCAGG + Intronic
1027017107 7:74786201-74786223 TTGCTCCATCACCCAGGCTGGGG - Intronic
1027050859 7:75020272-75020294 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1027220584 7:76211359-76211381 TCGCTCCTCCGCCCGGACCCTGG - Intronic
1027971226 7:85084113-85084135 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1027996736 7:85434448-85434470 TGGTTTCATGGCCCAGGCCCAGG + Intergenic
1028988503 7:97025885-97025907 TCTCTCCATTTCCCAGACCCGGG + Intergenic
1029239862 7:99152150-99152172 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1029416617 7:100447038-100447060 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1029448793 7:100629212-100629234 CCGCTGCCTAGCCCAGGCCCAGG + Intronic
1029561528 7:101306162-101306184 TTCCTCCTTCCCCCAGGCCCTGG - Intergenic
1029647118 7:101864580-101864602 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1029731920 7:102444149-102444171 TCGCTCCATTGCCCAGGCTGGGG + Intronic
1029736570 7:102468770-102468792 GGGCTCCCTCCCCCAGGCCCGGG + Intronic
1030231733 7:107214887-107214909 TCGCTCTATCACCCAGGCTGGGG - Intronic
1030771851 7:113484974-113484996 TCGCTCTGTCGCCCAGGCTGAGG - Intergenic
1031036162 7:116790270-116790292 TCTCTCTCTCCCCCAGGCCCTGG + Intronic
1031261229 7:119523958-119523980 TCGCTCTTTCACCCAGGCCGGGG + Intergenic
1031592562 7:123611324-123611346 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1032410024 7:131688059-131688081 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1032727988 7:134609863-134609885 TCGCTCTACCGCCCAGGCTGGGG - Intergenic
1032814771 7:135461798-135461820 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1032829151 7:135605085-135605107 TCGCTCTATCACCCAGGCTGGGG + Intronic
1032838970 7:135698970-135698992 TTGCTCTATCGCTCAGGCTCGGG + Intronic
1033057556 7:138073117-138073139 TCACTCCATCCCCCAGGCTAGGG - Intronic
1033115253 7:138619367-138619389 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1033319539 7:140327110-140327132 TCGCTCCGTTGCCCAGGCTGGGG - Intronic
1033407118 7:141080586-141080608 TCGCTCTATCACCCAGGCTGGGG - Intronic
1033517932 7:142128525-142128547 TGGTTCCATGGGCCAGGCCCAGG + Intronic
1033632403 7:143171613-143171635 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1034392534 7:150798316-150798338 TCGCTCTGTCGCCCAGGCTAGGG + Intronic
1034525140 7:151654722-151654744 TCGCTCTATGGCCCAGGCTGGGG + Intronic
1034547848 7:151800655-151800677 TCCCTCCCTCACCCAAGCCCTGG - Intronic
1034981979 7:155484875-155484897 TGGCTCCGTCGCGGAGGCCCGGG + Intronic
1035655824 8:1303873-1303895 TCCCTCCACCTCCCAGGCTCTGG - Intergenic
1035656190 8:1307850-1307872 TCCCTCCAGCGCCCAGTCCCCGG - Intergenic
1036498115 8:9288246-9288268 TCACTCTATCGCCCAGGCTGGGG + Intergenic
1036557111 8:9869958-9869980 TTGCTCTGTCGCCCAGGCTCTGG - Intergenic
1037813508 8:22100096-22100118 TTGCTCTATCACCCAGGCCCTGG + Intronic
1038248282 8:25879521-25879543 TAGCTCCATCACCCATGTCCAGG + Intronic
1038368028 8:26956756-26956778 TCGCTCCGTCGCCCAAGCTGTGG - Intergenic
1038481619 8:27905734-27905756 TCACTCTGTCACCCAGGCCCAGG + Intronic
1038621560 8:29148171-29148193 TCGCTCTGTCGCCCAGGCTAGGG - Intronic
1039509372 8:38078603-38078625 TCGCTCTGTCACCCAGGCCAGGG - Intergenic
1039541064 8:38370410-38370432 TCGCTCTGTCGCCCAGGCTCAGG + Intronic
1039688596 8:39837410-39837432 TCACTCTGTCGCCCAGGCCCAGG + Intronic
1040775421 8:51037554-51037576 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1041609717 8:59831082-59831104 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1042289906 8:67159550-67159572 TCGCTCTGTTGCCCAGGCTCTGG + Intronic
1042557342 8:70044509-70044531 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1042575442 8:70213051-70213073 TCACTCTATCGCCCAGGCTGGGG - Intronic
1042649212 8:71021532-71021554 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1043595372 8:81879137-81879159 TCGCTCTATCACCCAGGCCGGGG - Intergenic
1043887156 8:85614230-85614252 TGGCTCCAATGCCAAGGCCCTGG + Intergenic
1044236434 8:89836365-89836387 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1044270194 8:90232786-90232808 TCGCTCTGTCACCCAGGCCGGGG - Intergenic
1044582587 8:93837033-93837055 TCGCTCTGTTGCCCATGCCCAGG + Intergenic
1045691691 8:104765815-104765837 TCGCTCTTTCGCCCAGGCCCCGG - Intronic
1047099483 8:121660272-121660294 TCACTCTGTCGCCCAGGCCCAGG - Intergenic
1047259475 8:123242886-123242908 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1048363224 8:133715589-133715611 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1049106537 8:140617288-140617310 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1049147937 8:141015387-141015409 TCTCTCCGTTGCCCAGGCCCAGG - Intergenic
1049204395 8:141356867-141356889 TCACGCCCTCACCCAGGCCCTGG - Exonic
1049234356 8:141504814-141504836 TCTCTCCAACTCCCAGTCCCAGG - Intergenic
1049570321 8:143367296-143367318 TCGCCACATTGCCCAGGCCCAGG - Intergenic
1049980210 9:897142-897164 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1051285215 9:15488987-15489009 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1051445903 9:17139117-17139139 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1052701302 9:31941245-31941267 TGGCTTCATGGGCCAGGCCCAGG + Intergenic
1052711352 9:32060508-32060530 TCGCTCTGTCGCCCAGGCTGTGG + Intergenic
1052863130 9:33448925-33448947 TTGCTCCATCACCCAGGCTGTGG + Intergenic
1053211608 9:36233633-36233655 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1053212966 9:36247086-36247108 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1053607075 9:39671658-39671680 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1053609902 9:39701582-39701604 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1053627790 9:39894117-39894139 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1053867968 9:42459814-42459836 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1054088351 9:60769568-60769590 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1054216098 9:62356585-62356607 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1054243621 9:62640813-62640835 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1054246460 9:62670750-62670772 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1054906982 9:70420522-70420544 TCACCCCTACGCCCAGGCCCAGG + Intergenic
1055000067 9:71438639-71438661 TCACTCTATCGCCCAGGCTGGGG - Intronic
1055482496 9:76723837-76723859 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1056151259 9:83791369-83791391 TCGCTCTGTCGCCCAGGCTAGGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056186752 9:84142603-84142625 TCCCTCCATCCCCCAGCCCTGGG + Intergenic
1056476323 9:86954601-86954623 TTGCTCTATCGCCCAGGCTGAGG - Intergenic
1056510144 9:87296702-87296724 TCGCTTCATCCCCCAGGCCCTGG + Intergenic
1057109958 9:92460090-92460112 TCGCTCTGTTGCCCATGCCCAGG + Intronic
1057116941 9:92533266-92533288 TCACTCTATCGCCCAGGCTGGGG - Intronic
1057180794 9:93029049-93029071 TCGCTCTATAGCCCAGGCTGGGG + Intronic
1057895154 9:98903376-98903398 TCACTCTATCGCCCAGGCTGGGG + Intergenic
1058274541 9:103023888-103023910 TGGTTCCATGGCCCAGGCCCAGG + Intergenic
1058471890 9:105288378-105288400 TCGCTCTGTCGCCCTGGCCGGGG + Intronic
1059130353 9:111741663-111741685 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1059410435 9:114128725-114128747 TCGCTCCGTCGCCTAGGCTGGGG + Intergenic
1059494147 9:114695682-114695704 TCGCTCTGTTGCCCAGGCTCTGG + Intergenic
1059499981 9:114744064-114744086 TCACTCTATCGCCCAGGCTGGGG + Intergenic
1059685819 9:116634556-116634578 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1060347453 9:122829076-122829098 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1060696631 9:125714595-125714617 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1060704814 9:125788841-125788863 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1060824201 9:126678276-126678298 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1061181476 9:129027524-129027546 TCTCTCCATCCCCCAGGCCCAGG + Intronic
1061227554 9:129289508-129289530 ACCCTCAATCGCCCAGGGCCTGG - Intergenic
1061625632 9:131839176-131839198 TGGCTCCCTCACCCAGGCCTGGG - Intergenic
1061657309 9:132102481-132102503 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1061797179 9:133092992-133093014 TTGCTCCATCGCCCAGGCTGGGG - Intergenic
1061946420 9:133910790-133910812 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1062329466 9:136031367-136031389 TTGCTCCATCACCCAGGCTGGGG + Intronic
1062579442 9:137222846-137222868 GCACTCCAGCGCGCAGGCCCGGG + Intergenic
1062639146 9:137508192-137508214 TTGCTCCATGGCCCAGGCTGGGG - Intronic
1062654612 9:137596661-137596683 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1062693625 9:137859486-137859508 TTGCTCTTTCGCCCAGGCCATGG + Intronic
1186190535 X:7063673-7063695 TCACTCTGTCGCCCAGGCTCGGG + Intronic
1186324267 X:8461607-8461629 TCATTCTGTCGCCCAGGCCCAGG - Intergenic
1187062112 X:15796823-15796845 TCGCTCTGTCGCCCAGGCTAGGG + Intronic
1187376054 X:18755708-18755730 TTGCTCCCTCCCCCAGCCCCTGG + Intronic
1187493395 X:19773822-19773844 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1188209726 X:27407575-27407597 TCACTCCATCCCCCAGGCTGCGG + Intergenic
1188475548 X:30587920-30587942 TCGCTCCGTTGCCCAGGCTAGGG + Intergenic
1189473140 X:41329782-41329804 TCGCTCTATCACCCAGGGGCTGG - Intergenic
1190325953 X:49206902-49206924 GTGCCCCATCTCCCAGGCCCAGG - Intronic
1190401640 X:50042098-50042120 ACTCCCCATCCCCCAGGCCCTGG - Intronic
1190691688 X:52918023-52918045 AAGCTCCATGGCTCAGGCCCTGG + Intergenic
1190694295 X:52937769-52937791 AAGCTCCATGGCTCAGGCCCTGG - Intronic
1190764777 X:53466958-53466980 TCCCTCCTTCTCCCAGCCCCTGG - Intergenic
1190792483 X:53713088-53713110 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1190796698 X:53751848-53751870 TCACTCTATCGCCCAGGCTGGGG - Intergenic
1190832674 X:54073460-54073482 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1192078455 X:68024000-68024022 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1192265631 X:69535757-69535779 TCCCTCCCTCAGCCAGGCCCAGG + Intergenic
1192453430 X:71257885-71257907 TTGCTCTATCGCCCAGGCTGGGG - Intergenic
1192818661 X:74620008-74620030 TCGCTCTGTCGCCCAGGCTGAGG + Intergenic
1193210472 X:78801698-78801720 TGGTTCCATGGACCAGGCCCAGG + Intergenic
1193307315 X:79964415-79964437 TCACTCCGTCGCCCAGGCTGGGG + Intergenic
1193611766 X:83640442-83640464 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1194362168 X:92965061-92965083 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1194638580 X:96375451-96375473 TCGCTCCGTCGCCCAGCCTGGGG + Intergenic
1194949757 X:100111177-100111199 TCACTCTGTTGCCCAGGCCCAGG + Intergenic
1195279319 X:103314732-103314754 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1196688463 X:118532747-118532769 TCGCTCTGTCGCCCAGGCTGGGG - Intronic
1196840705 X:119856630-119856652 TCGCTCTGTCGCCCAGGCTGAGG + Intergenic
1196963172 X:121026192-121026214 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1197217790 X:123882808-123882830 TCGCTCTGTCGCCCAGGCTGGGG + Intronic
1198464298 X:136890680-136890702 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1198537747 X:137602634-137602656 TCACTCTGTCGCCCAGGCCCAGG + Intergenic
1198822881 X:140667811-140667833 TCACTCCATCACCCAGGCCAGGG + Intergenic
1199578947 X:149342509-149342531 TCGCTCTGTCGCCCAGGCTGGGG + Intergenic
1199697302 X:150351876-150351898 TTGCTCCATCCCTCAGCCCCTGG + Intergenic
1200086730 X:153610737-153610759 TAGGTCCAGCGCCCAGGCCAAGG - Intergenic
1200136398 X:153876965-153876987 TCACTCCATCACCCAGGCTGGGG - Intronic
1200138624 X:153886507-153886529 TCTCTCCACCGCCCGGCCCCAGG - Intronic
1200670417 Y:6081298-6081320 TCGCTCTGTCGCCCAGGCTGGGG - Intergenic
1201158330 Y:11151672-11151694 TCCCATTATCGCCCAGGCCCAGG - Intergenic
1202232556 Y:22671312-22671334 TCGATCCCTCCCCCAGACCCAGG + Intergenic
1202310600 Y:23524846-23524868 TCGATCCCTCCCCCAGACCCAGG - Intergenic
1202560202 Y:26145748-26145770 TCGATCCCTCCCCCAGACCCAGG + Intergenic