ID: 976724443

View in Genome Browser
Species Human (GRCh38)
Location 4:88202072-88202094
Sequence CAAGATCACAAAATGAATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 1, 2: 0, 3: 30, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976724440_976724443 24 Left 976724440 4:88202025-88202047 CCAAGCAATTTAAAATTCAGCAA 0: 1
1: 0
2: 1
3: 35
4: 452
Right 976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG 0: 1
1: 1
2: 0
3: 30
4: 350
976724439_976724443 25 Left 976724439 4:88202024-88202046 CCCAAGCAATTTAAAATTCAGCA 0: 1
1: 0
2: 4
3: 36
4: 414
Right 976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG 0: 1
1: 1
2: 0
3: 30
4: 350
976724438_976724443 26 Left 976724438 4:88202023-88202045 CCCCAAGCAATTTAAAATTCAGC 0: 1
1: 0
2: 1
3: 48
4: 481
Right 976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG 0: 1
1: 1
2: 0
3: 30
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976724443 Original CRISPR CAAGATCACAAAATGAATAT CGG Intronic
900877613 1:5356061-5356083 CCAGATCAGAAAATAAAAATTGG - Intergenic
903313377 1:22478730-22478752 CAACATCTAAAAATGAGTATGGG - Intronic
906973287 1:50541860-50541882 CATTTTCACAAAAAGAATATGGG - Intronic
907058947 1:51401358-51401380 CAAGAACACAAAATGGAGAAAGG + Intronic
907636888 1:56144324-56144346 CAAGATCACACAATTAGTAAAGG + Intergenic
908272354 1:62434463-62434485 CAAGATTAGAAAATGTATATAGG - Intergenic
908470882 1:64442876-64442898 CAAAATCAGAAAATGAACATTGG + Intergenic
909418281 1:75432656-75432678 CAATATTACAAAATGAAGCTGGG - Intronic
910125685 1:83839183-83839205 CAAGATCACACAACTAATAAGGG + Intergenic
910336641 1:86139880-86139902 AAATAATACAAAATGAATATTGG - Intronic
910695979 1:90016245-90016267 CAAGATCACAAAATGGAATTAGG + Intronic
910742396 1:90534209-90534231 CAAGATCAAAATATAAAAATAGG - Intergenic
911135597 1:94436115-94436137 CAAGATCACAATTGGAATTTAGG + Intronic
911292384 1:96072804-96072826 CAAGTTCACATAATGAATAAAGG - Intergenic
911313287 1:96324172-96324194 CAAGAACACAAAATGAGAAAAGG + Intergenic
911538996 1:99135864-99135886 CTAGATCACAAAATGACTGTGGG + Intergenic
911879744 1:103221149-103221171 AAAGATCAGAAAGTGCATATTGG - Intergenic
912238025 1:107873816-107873838 CTAGATCACAAAATGACCATGGG + Intronic
912426787 1:109600599-109600621 AAACATCATAAGATGAATATAGG + Exonic
913038925 1:115004347-115004369 AAAAAACACAAAAGGAATATTGG + Intergenic
913262899 1:117016893-117016915 CAAGATAGCAGAAAGAATATCGG - Intronic
913465443 1:119137161-119137183 CAAAATCAAGAAATTAATATTGG - Intronic
913655473 1:120955840-120955862 CAAGTTAACAGAATGAATAAAGG - Intergenic
914405201 1:147363703-147363725 CATAATCACAAAATTATTATAGG + Intergenic
916409440 1:164530997-164531019 CAGGTTCACAAAATCAATAAGGG - Intergenic
917903135 1:179563780-179563802 CAAGATACCAAAATGTATCTTGG + Intronic
918223485 1:182457186-182457208 TAAGATCACACAGTGAATCTAGG + Intronic
918816228 1:189188407-189188429 CAAAGTCAAAAAATGAATAAAGG + Intergenic
919054073 1:192547267-192547289 AAAAATCAGAAAATTAATATTGG + Intergenic
919079524 1:192853233-192853255 CAAAATCAAAAAATTAACATTGG + Intergenic
919115690 1:193277712-193277734 AAAGAAAGCAAAATGAATATTGG + Intergenic
919311822 1:195918842-195918864 AAAAATGACAAAATGAATATGGG + Intergenic
919364827 1:196645483-196645505 CAAGAACACACAATGAAGAAAGG + Intergenic
920999985 1:211034517-211034539 CAATATCACAACCTGGATATTGG - Intronic
923254510 1:232209867-232209889 AAGGATGACAAAATGAAAATGGG - Intergenic
923657052 1:235926213-235926235 CAAGATTAAAAACTGCATATTGG - Intergenic
923958333 1:239048355-239048377 GAAGATAACATAAAGAATATTGG - Intergenic
924391633 1:243566639-243566661 CAAGGTCACACAGTGAATAAGGG - Intronic
924469590 1:244330007-244330029 CAATATCACAGAAAGAAAATAGG - Intergenic
924794208 1:247280826-247280848 CAAGGATTCAAAATGAATATGGG + Intergenic
1062872880 10:921904-921926 GAAGACCAAAGAATGAATATGGG - Intronic
1064566387 10:16643633-16643655 CAAGATCACAGAGTTAATAAAGG - Intronic
1065138333 10:22695042-22695064 CCAAATAGCAAAATGAATATAGG + Intronic
1066286285 10:33969187-33969209 CAAGATCCCAAAATGACTGCTGG - Intergenic
1066330470 10:34416181-34416203 CAAAATCACAAGATGTAAATGGG + Intronic
1069213549 10:65791540-65791562 TAAGATCCCAATATGAAAATGGG + Intergenic
1069236548 10:66082515-66082537 CTAGAACAGAAAAAGAATATAGG + Intronic
1070545863 10:77452019-77452041 CAAGATCATTAAGTAAATATAGG - Intronic
1071082874 10:81833316-81833338 AAATATCACACTATGAATATTGG - Intergenic
1071591562 10:86879350-86879372 CAAGAGCATATAATGAATTTTGG - Intronic
1071857486 10:89640568-89640590 CAAGGTCCCAAGATGAATACTGG + Intronic
1072041634 10:91611979-91612001 CAAGATCACACAGTTAATAAGGG - Intergenic
1073841663 10:107504923-107504945 CAACACCATAGAATGAATATTGG - Intergenic
1074089400 10:110233964-110233986 GAAGATCACAAAATGTAGAAAGG + Intronic
1074581545 10:114724004-114724026 GCAGATATCAAAATGAATATAGG - Intergenic
1074590457 10:114807977-114807999 CAAGATATCAAATTGAAAATAGG + Intergenic
1075605040 10:123798765-123798787 CAAGGTCACCAAATGAAGTTAGG + Intronic
1077275965 11:1708481-1708503 CAATATCACAATCAGAATATTGG - Intergenic
1077345406 11:2047110-2047132 AAAGATCACAAAATGTAGTTAGG - Intergenic
1077760130 11:5086135-5086157 GAATAACACAAAATGAAAATTGG - Intergenic
1078541907 11:12219624-12219646 CAAGACCAGAAAAAGAAAATGGG - Intronic
1078674092 11:13393214-13393236 CAATCTCTCAATATGAATATGGG + Intronic
1079384009 11:19962832-19962854 CAAGATCAAGAAGTGAATGTGGG - Intronic
1079493445 11:21014502-21014524 CTAGGTTACAAAACGAATATAGG + Intronic
1079687988 11:23385531-23385553 CAAGCTAACAAAGTGAAGATGGG + Intergenic
1079897632 11:26141729-26141751 CAAAAGCACAAAAGGAAAATTGG - Intergenic
1079924376 11:26475455-26475477 TAATAACACAAAATCAATATGGG + Intronic
1080798653 11:35589262-35589284 CAAAATGACAAAAGGATTATAGG - Intergenic
1080946606 11:36981257-36981279 CATTATCACAAAAACAATATGGG + Intergenic
1081155639 11:39686225-39686247 AAAGATTACAGAATGAATGTGGG - Intergenic
1081318595 11:41662330-41662352 TAAAAACACAAAAGGAATATTGG + Intergenic
1081398561 11:42616000-42616022 CAAGATATCAGAAGGAATATTGG + Intergenic
1083085624 11:60141314-60141336 CAAGGACACAAAAAGAATAAAGG - Intergenic
1086071950 11:82809536-82809558 CAAAATCAGGAAATTAATATTGG - Intergenic
1087874967 11:103343849-103343871 CCAAATCACAAACTCAATATAGG - Intronic
1088033088 11:105276104-105276126 CAAGATCCTAAAATTAATAATGG + Intergenic
1088476271 11:110242581-110242603 AAAGCTGATAAAATGAATATTGG - Intronic
1088511955 11:110585941-110585963 TAAGATCATAAACTGAAGATTGG + Intronic
1088699646 11:112400527-112400549 CAAGATCCCAAAAGGAAAGTAGG + Intergenic
1091893378 12:4081143-4081165 CATGGTCACAAAATGGGTATTGG + Intergenic
1093572806 12:20687668-20687690 GCAAATCACAAAATGAAAATTGG + Intergenic
1093852395 12:24056448-24056470 TAAAATTACAAAATTAATATTGG + Intergenic
1094011308 12:25813172-25813194 CTATATCAGAGAATGAATATGGG - Intergenic
1095488268 12:42706896-42706918 CAAGATCACACAGCGAATAATGG - Intergenic
1095796293 12:46222439-46222461 CATGAATACAAACTGAATATTGG - Intronic
1097152910 12:56992700-56992722 CAAGATCACAAAATCTATCATGG - Intergenic
1097366933 12:58726119-58726141 CAAAATCAGAAAACGAACATTGG - Intronic
1097831358 12:64227532-64227554 CAAAATCAACAAATGAAAATTGG - Intergenic
1099162174 12:79256024-79256046 CTAGAATACAAAATGAATAGTGG + Intronic
1099544892 12:83966318-83966340 CAAGAGCACACAATGAGTAAAGG - Intergenic
1100863154 12:98828833-98828855 CTAGATTACAAAATGTAAATTGG - Intronic
1100887926 12:99092949-99092971 CAAGTTCACAAGATAAGTATAGG + Intronic
1101171614 12:102102856-102102878 CAAGAACATAAAATGAAGAAAGG - Intronic
1101489171 12:105196113-105196135 CAAGATCACATAGTGAATCAGGG - Intronic
1101667164 12:106828836-106828858 CATGATCACAGGATGAACATAGG - Intronic
1102020773 12:109680800-109680822 CAAGGTCACACAATGAGTAAAGG + Intergenic
1102343964 12:112146466-112146488 CCAGATCACAAAACGGATAGTGG - Intronic
1102940225 12:116934609-116934631 AAAGTTTAAAAAATGAATATTGG - Intronic
1104656463 12:130577134-130577156 CAAGGTCACACAGTGAATAGAGG - Intronic
1105276345 13:18931148-18931170 CAAGAACACAAAATTATAATTGG + Intergenic
1107587016 13:41861466-41861488 CAAGACCAAAAAATAAAAATAGG + Intronic
1107688988 13:42933169-42933191 CAAAATCAGAAAATTAACATTGG - Intronic
1107697475 13:43014372-43014394 CAAAAGCACAAAATGTAAATTGG + Intergenic
1108136073 13:47362466-47362488 CAAGAGCACAAAACGAAGAAAGG + Intergenic
1108194701 13:47981448-47981470 AAAAAACAGAAAATGAATATTGG + Intronic
1108241803 13:48472371-48472393 CAAGAACACCAAATAAATAAAGG - Intronic
1109763015 13:66855489-66855511 CAAAATCAGAAAATGAATGAAGG - Intronic
1109859051 13:68172932-68172954 TAATATCACAAAATGGATACAGG + Intergenic
1109956601 13:69576031-69576053 CAAGAACACATAATGAGGATAGG - Intergenic
1110373039 13:74760567-74760589 GAAGATGAGAAAGTGAATATTGG + Intergenic
1110550747 13:76808656-76808678 CAGGATCACAAAATGGACTTTGG - Intergenic
1111017963 13:82405706-82405728 CAGGTTCTCACAATGAATATTGG + Intergenic
1112217841 13:97453276-97453298 CAATATCACAAACAGAATATTGG + Intronic
1116132573 14:40875695-40875717 CAATATCACAACCAGAATATTGG - Intergenic
1116685207 14:48030373-48030395 CTAGATTACAAAATGAAAATAGG + Intergenic
1117043729 14:51791474-51791496 CAAGATGACAATAAGAATTTTGG + Intergenic
1118522645 14:66603200-66603222 TTAGATTACAAAAAGAATATGGG + Intronic
1118729704 14:68657827-68657849 CAGGCTCACCAAATGAATCTAGG - Intronic
1120296988 14:82654287-82654309 CAAGACCAGAAAATGAAAAAAGG + Intergenic
1121546398 14:94766862-94766884 CAAGGTCACAAAATGAAGTCTGG + Intergenic
1202942129 14_KI270725v1_random:160554-160576 AAACATCACAAAATGACTACTGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126297181 15:47153134-47153156 CAACCTCACAATATGAATACTGG + Intergenic
1127200719 15:56646952-56646974 CAAGATGACAATATGAGAATTGG + Intronic
1127888387 15:63224718-63224740 CGCGATCACAAAAGGAAAATTGG - Intronic
1128690343 15:69719973-69719995 CAAGATCACATAGTGAGTAATGG + Intergenic
1128712781 15:69884690-69884712 CAAGATCAAAAAAAGGAGATGGG + Intergenic
1131972148 15:97903697-97903719 CAAGATCACAAACTTATTACTGG - Intergenic
1132425494 15:101712720-101712742 CAAAGTCACCAAATAAATATAGG + Intronic
1133357949 16:5150599-5150621 CAAAAACAAAAAAAGAATATAGG + Intergenic
1133876079 16:9735757-9735779 CAAGATGAATAAATGGATATTGG + Intergenic
1135982897 16:27162417-27162439 AAAAATTACAAAATTAATATTGG + Intergenic
1136777173 16:32878259-32878281 CAAGCTCACACAATTGATATTGG + Intergenic
1136893449 16:33983254-33983276 CAAGCTCACACAATTGATATTGG - Intergenic
1138291939 16:55855248-55855270 CAAGTGAACAAAATGAACATCGG + Intronic
1140243170 16:73223012-73223034 CAATATAAAAAAATGAATCTAGG + Intergenic
1140930705 16:79625098-79625120 AAAGAACACAAGATGAATTTAGG - Intergenic
1141643790 16:85356790-85356812 CAACATGACAAAATGGATACAGG - Intergenic
1203079587 16_KI270728v1_random:1140368-1140390 CAAGCTCACACAATTGATATTGG + Intergenic
1143133805 17:4698820-4698842 CATGATCAGAGAATTAATATTGG - Intronic
1149921764 17:60667068-60667090 CAAAATAACAAAATGAAAACAGG + Intergenic
1153083475 18:1256058-1256080 CAGGATCTCAAAGTGAAAATTGG + Intergenic
1155284685 18:24275508-24275530 CAGGGTCACAAAATGACTACAGG + Intronic
1155360631 18:24996959-24996981 CAAAAGCATAAAATGAATACAGG - Intergenic
1155584264 18:27346892-27346914 CAAATTCTTAAAATGAATATGGG + Intergenic
1155706382 18:28819859-28819881 CAAGATCATACATTGAATACAGG - Intergenic
1156067174 18:33157707-33157729 CGAGATCTTAAAATCAATATAGG - Intronic
1156190080 18:34708935-34708957 CAAGATCACAAAAGTAGTATGGG + Intronic
1156242709 18:35268774-35268796 CAAGAAAAGAAAAAGAATATTGG + Intronic
1156510011 18:37628389-37628411 CAAGATCACACAGTGGATTTGGG - Intergenic
1156619450 18:38831995-38832017 AAAGAGAAGAAAATGAATATAGG + Intergenic
1157102836 18:44745410-44745432 CAAGGTCACACAATGAATCAAGG - Intronic
1158744978 18:60189213-60189235 CAAGATCAGAGAATGAGAATGGG + Intergenic
1158806157 18:60976092-60976114 CAAAATCACAAAATTATAATTGG + Intergenic
1159802830 18:72922077-72922099 CAAGGTCACAAAAGTAATAGCGG + Intergenic
1160262311 18:77306025-77306047 CAAGAATAAAAAATAAATATTGG + Intergenic
1161918371 19:7247716-7247738 CAAGGTCACAAAACAGATATAGG + Intronic
1163051034 19:14683739-14683761 CAACATCACATGATAAATATGGG + Intronic
1163687390 19:18719467-18719489 CCAAATCACAAAATGACTTTTGG + Intronic
1163696544 19:18766787-18766809 TAAAATCAGAAAATGAAAATGGG - Intronic
1164042082 19:21501937-21501959 CAATATCAAAAACAGAATATTGG + Intronic
1164074987 19:21807128-21807150 CAACATCAGAAAATTTATATTGG - Intronic
1164197054 19:22978389-22978411 CAAATTCACAAAAAGTATATCGG + Intronic
1164245413 19:23424141-23424163 CAATATCAGAAACAGAATATTGG + Intergenic
1164308650 19:24027396-24027418 CAATATCAGAAACAGAATATTGG - Intergenic
1167572269 19:50296270-50296292 CCAGATCACAACGTGGATATAGG - Intronic
1167882713 19:52475070-52475092 CAACATCACAGAATTCATATAGG - Intronic
926257588 2:11220493-11220515 CAAGATCATTCAATAAATATTGG - Intronic
926975240 2:18509459-18509481 AAAAATCAAAAAATAAATATTGG - Intergenic
928577720 2:32672936-32672958 CAAAATCAGAAAATTAATGTTGG + Intronic
930543343 2:52735376-52735398 TAAGATCACAAAATTGATAAAGG + Intergenic
931043109 2:58319513-58319535 CAAGACCACAAAATAAAAAAAGG + Intergenic
933049830 2:77589997-77590019 CAAGATCATAAACTGAAATTGGG + Intronic
935762992 2:106338671-106338693 CAATATCACCTAAAGAATATAGG - Intergenic
936791027 2:116152130-116152152 CAAGAACACAAAATGGAGAAAGG - Intergenic
940386896 2:153084582-153084604 CACTATCACAAGAAGAATATGGG - Intergenic
942186303 2:173427908-173427930 CAAGTTCACAAAAGCAATAAGGG - Intergenic
942445841 2:176078561-176078583 CAAGTTACCAAAATGAAAATCGG + Exonic
944139528 2:196439954-196439976 CATGATGACAGATTGAATATAGG + Intronic
944328329 2:198434038-198434060 GAAGATTACAAAAAGAAAATTGG + Intronic
945424697 2:209685968-209685990 CATGATCAATAAATGAAAATGGG - Intronic
945636388 2:212357567-212357589 CATTTTCATAAAATGAATATGGG - Intronic
946187327 2:217988417-217988439 CAAGGTCACACAGTGAATGTTGG + Intronic
946523158 2:220488523-220488545 CAGGAAGACAAAAGGAATATTGG - Intergenic
946645052 2:221824279-221824301 CATAATTACAAAATCAATATTGG - Intergenic
1169264673 20:4160658-4160680 CATGATCACAAAACGAAAAAAGG - Intronic
1169831049 20:9825370-9825392 AAAAATCTCAAAATCAATATTGG - Intronic
1171184115 20:23112496-23112518 CAAGGTCAACAAATGAATTTTGG + Intergenic
1173352578 20:42258573-42258595 CAAGATCAAAGAAAGAATATTGG - Intronic
1176360326 21:5989847-5989869 CAAAACCACAAAATTAACATTGG + Intergenic
1176581041 21:8526376-8526398 AAACATCACAAAATGACTACTGG + Intergenic
1177156979 21:17510559-17510581 GAAGATAACAAAACTAATATTGG + Intergenic
1177818603 21:26005108-26005130 CCACATAAAAAAATGAATATAGG + Intronic
1177947232 21:27485956-27485978 CATGCTTACAGAATGAATATAGG + Intergenic
1179763192 21:43548703-43548725 CAAAACCACAAAATTAACATTGG - Intronic
1182171749 22:28237103-28237125 CAAGAACACAAAGTCAATAGAGG - Intronic
1182747914 22:32619835-32619857 CTAGTTCACAAAATGATTACGGG - Intronic
1184531689 22:45060290-45060312 CAAGAACAGAAAGTGAATACGGG - Intergenic
1185039418 22:48496855-48496877 CAGGATCTCTGAATGAATATAGG + Intronic
950688723 3:14638525-14638547 CAAAAACAGAGAATGAATATTGG - Intergenic
951079917 3:18441922-18441944 AACGACAACAAAATGAATATTGG - Intronic
951392731 3:22127263-22127285 CACTTTCACAAAAAGAATATAGG - Intronic
951539650 3:23770152-23770174 CAAGATCATAAAATACATTTAGG + Intergenic
951936373 3:28027329-28027351 CAAGAACACAAAATGAGGAAAGG - Intergenic
952986431 3:38789135-38789157 CAAGATCATAAAGCTAATATTGG - Intronic
953468838 3:43149599-43149621 CGAGATCACAAAATCACTCTAGG + Intergenic
953591351 3:44258339-44258361 CAATATCACAACCAGAATATTGG + Intronic
954528254 3:51293358-51293380 CAAGAACACACAATGAAAAAAGG + Intronic
954824181 3:53356916-53356938 CAAGCTCTCAAAATAGATATTGG + Intergenic
955133829 3:56196326-56196348 CAAGATCACAAAAGATATAGTGG - Intronic
955171983 3:56575118-56575140 CAAAATTACAAAATTAAAATTGG - Intronic
955455851 3:59120855-59120877 CATGATCATAAAAGGACTATAGG + Intergenic
955970005 3:64429460-64429482 CATGAGAACAATATGAATATTGG + Intronic
956113411 3:65894274-65894296 CAAGGTCACACAATAAATAATGG + Intronic
956749210 3:72332920-72332942 CAAGGTCACAGAATGAGTAAGGG - Intergenic
956977988 3:74604047-74604069 CAAGAACACATAATGAAGAAGGG + Intergenic
958108564 3:89108747-89108769 ATAGATCACAAAAGGAATACAGG - Intronic
958953567 3:100442462-100442484 CAACATTGCAATATGAATATCGG + Intronic
959243047 3:103824675-103824697 TAAGATCACAAAAGGAAAATTGG - Intergenic
959363816 3:105430657-105430679 AAAGACCACAAAATGAAAAAAGG - Intronic
962580734 3:136795629-136795651 AAAGAAAACAAAATGAAAATGGG + Intergenic
962635899 3:137331046-137331068 TAAGAACAGAAAATGAATTTGGG - Intergenic
963531943 3:146481958-146481980 CAAGAACAAAAAATGAAGAAAGG + Intronic
963618899 3:147579237-147579259 AAATATGACACAATGAATATAGG + Intergenic
963824855 3:149941969-149941991 CAAGATGACACAGTGAATAAAGG - Intronic
963845087 3:150147414-150147436 CAACGTCACAAAGTGAATTTGGG - Intergenic
964169103 3:153746164-153746186 AAAGATCACAACATAAATGTAGG + Intergenic
964594118 3:158402585-158402607 CAAAATCAGAAAATTAATAGAGG + Intronic
965842893 3:172927648-172927670 CAAGATCACACACTGAGCATAGG + Intronic
966595038 3:181718306-181718328 CAAGATCAATAAATGAAACTGGG - Intergenic
967097677 3:186190762-186190784 AAAGGTCACAGAATGAAGATTGG - Intronic
967785952 3:193496453-193496475 CAAGAACACACAATGGATAAAGG + Intronic
968409451 4:375350-375372 CAACATCAGAAAATTTATATTGG + Intronic
970702984 4:18764800-18764822 CATGATAAGAAAATGAAGATGGG + Intergenic
970773274 4:19641319-19641341 AATGATGAAAAAATGAATATGGG - Intergenic
971547182 4:27900802-27900824 CTAGATCACAAAAAAAATATTGG + Intergenic
973319469 4:48795231-48795253 CAAGGTCACAATATAAAAATAGG + Intergenic
973649067 4:52979553-52979575 CAATAACACAAAATCAACATAGG + Intronic
974332796 4:60501390-60501412 AATTATCACAAAATGATTATGGG - Intergenic
974658486 4:64855680-64855702 CACTATCACAAGATGAGTATGGG - Intergenic
974938381 4:68434468-68434490 CAAGATTGCACAATAAATATTGG + Intergenic
975123907 4:70760217-70760239 CAAGATGAGAAAATGTAGATGGG + Intronic
976724316 4:88200501-88200523 AAAGATCAGAAAATCAATAAAGG + Intronic
976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG + Intronic
979475308 4:121149851-121149873 CAAGATCACACAATTAAAAGAGG - Intronic
979550474 4:121985443-121985465 CAATAGCACAAATTGAAAATAGG + Intergenic
980643568 4:135611883-135611905 AAAAAGCACAAAAGGAATATAGG - Intergenic
981137834 4:141232834-141232856 CCAAATATCAAAATGAATATTGG - Intronic
981840987 4:149111900-149111922 CAAGATCACAGAACAAATAAAGG + Intergenic
981976307 4:150733284-150733306 CAAAATCAGAAAATTAACATTGG - Intronic
982719294 4:158842864-158842886 CCAAATCACAAAATGATTTTAGG - Intronic
982785768 4:159534604-159534626 CAAGATCACACAATGAGGAAAGG - Intergenic
982824823 4:159989950-159989972 CAAGAACAGAAAATTAACATTGG + Intergenic
983089781 4:163489472-163489494 CAACTTCACAATAGGAATATTGG + Intergenic
983143082 4:164177348-164177370 CAAAATCACACAATAAATAAGGG + Intronic
983161730 4:164425096-164425118 CAAGAACACAAAATGACAAATGG + Intergenic
984304569 4:177971766-177971788 CAAGATCAAAAATAGCATATTGG - Intronic
986254400 5:6090031-6090053 CACGATCACTAAAAGAATACTGG + Intergenic
987479127 5:18430660-18430682 AAATATGACAAAATGAATTTTGG + Intergenic
987499367 5:18687441-18687463 CAATATCAAAAAATGAATACAGG - Intergenic
987700937 5:21397380-21397402 CAAAATCAGAAAATTTATATTGG - Intergenic
987841604 5:23228820-23228842 TAAAATCACAAAATTAATAAAGG - Intergenic
989352269 5:40499934-40499956 CAAAAACACCAAATGAAGATTGG + Intergenic
990289821 5:54338502-54338524 CAAGAACATAAAATGGATAAAGG + Intergenic
990548106 5:56843758-56843780 CAATAATTCAAAATGAATATGGG - Intronic
990601381 5:57361866-57361888 CATGATCACAAAGTGGACATCGG - Intergenic
990833016 5:59981942-59981964 CAAGAGCACAAGATGAAGAGTGG + Intronic
991316106 5:65308817-65308839 TAAGATTCCAAAATTAATATAGG + Intronic
991435125 5:66590158-66590180 CAAGATCCCAAATTGTATTTAGG + Intergenic
993927538 5:93888392-93888414 CAAAATCCCTAAATGAATTTAGG + Intronic
994306910 5:98215988-98216010 CAATTTTACAAATTGAATATTGG - Intergenic
994459464 5:100053971-100053993 CATGATAGCAAAATGAATTTTGG + Intergenic
995315765 5:110771185-110771207 CAAGAACAGAAAATTAACATTGG + Intergenic
995916419 5:117250888-117250910 TAATATCATATAATGAATATTGG + Intergenic
996007271 5:118436668-118436690 CAAGGTCACCCAATAAATATAGG + Intergenic
996861979 5:128077720-128077742 CAAGATCACACAACAAATAGCGG + Intergenic
997028679 5:130096936-130096958 ATAGATCACAAAACGAATATAGG - Intronic
997756242 5:136402032-136402054 CAAGATGAAAACATAAATATGGG + Intergenic
998680115 5:144457693-144457715 CAATATCACAACATATATATTGG - Intronic
999419639 5:151429651-151429673 CAAGGTCACACAACTAATATAGG + Intergenic
999479386 5:151932670-151932692 CAAAATTAAAAAATCAATATTGG + Intergenic
1000517771 5:162260629-162260651 CAAGATCACAAATAAAAAATGGG + Intergenic
1000897800 5:166877719-166877741 CAAGAACACACAATGAAGAAAGG + Intergenic
1004197250 6:13516167-13516189 CAAGATCACACAATAAATAAGGG + Intergenic
1008046921 6:46860526-46860548 TAAGGTCTCAAAATGAATACTGG + Intronic
1008316019 6:50042215-50042237 CAAAATCACAAGATGCAAATAGG + Intergenic
1009863116 6:69361243-69361265 GAAGAAAGCAAAATGAATATTGG + Exonic
1009955742 6:70450526-70450548 CAAGAACACACAATGAAGAAAGG - Intronic
1010416643 6:75619159-75619181 AAAGATCCAAAAATAAATATTGG - Intronic
1010849614 6:80756051-80756073 CAAGAACACACAATGAAAATAGG - Intergenic
1011046863 6:83094027-83094049 AATGAACTCAAAATGAATATAGG - Intronic
1011173770 6:84537146-84537168 CAGGATAAACAAATGAATATTGG + Intergenic
1011265363 6:85512275-85512297 CAAGATCCCACAGTGAATATTGG - Intronic
1011690482 6:89862752-89862774 AAAGATCACAAAATATAAATAGG + Exonic
1012601393 6:101101903-101101925 CAAGAACACACAATGAAGAAAGG - Intergenic
1012736703 6:102955661-102955683 CAAAAGCACAAATTGAGTATAGG - Intergenic
1013080095 6:106804955-106804977 CAATAACACACAATAAATATTGG + Intergenic
1013651303 6:112197759-112197781 AAAGATTCCAAAATGAAAATTGG - Intronic
1013678378 6:112492853-112492875 CAAAATCAGAAAATTAACATTGG - Intergenic
1013981522 6:116135279-116135301 CAAGTTTATAAAATGAAAATTGG + Intronic
1014625927 6:123725007-123725029 CAAGATCACACATTGAAGAAAGG - Intergenic
1016561715 6:145402534-145402556 CAAAATCAGGAAATTAATATTGG - Intergenic
1016715475 6:147222760-147222782 CAGGTTCTCACAATGAATATTGG - Intronic
1017675471 6:156809407-156809429 CAAGATCTCAAAATTCAAATAGG - Intronic
1018526338 6:164713857-164713879 CAGGTTCTCACAATGAATATTGG + Intergenic
1019340155 7:505114-505136 CAAGAACACAAAATGAATATTGG + Intronic
1020003764 7:4770780-4770802 CAAGAACAAAAACTCAATATTGG - Exonic
1020616694 7:10467318-10467340 CAAGAATAAAATATGAATATTGG + Intergenic
1021084142 7:16401464-16401486 CAAGAGCATAAAATGACTAGAGG + Intronic
1021497043 7:21287013-21287035 CAAGATCAAAGCATGAATCTGGG - Intergenic
1022916745 7:34963321-34963343 CAAGAGCAGAAAATAAATGTTGG + Intronic
1023538280 7:41237040-41237062 TAAAATCACAAAATGTATAGAGG - Intergenic
1024117050 7:46204458-46204480 CAAGATCACAACATGGAGAGAGG - Intergenic
1024124279 7:46276089-46276111 CAAAATCAAGAAATGATTATTGG + Intergenic
1025148482 7:56525696-56525718 CAACATCAGAAAATTAATACTGG - Intergenic
1025963960 7:66250473-66250495 CAAGGTCACATAATCAATAAAGG - Intronic
1026365058 7:69639964-69639986 CAAGATCATACAGTGAATCTAGG - Intronic
1026531661 7:71204159-71204181 CAAGAACACACAATGAATAAGGG - Intronic
1026843117 7:73682069-73682091 CAAGGTCACACATTAAATATGGG + Exonic
1028247989 7:88505710-88505732 AAAGAGAACAAATTGAATATGGG - Intergenic
1028272792 7:88813627-88813649 CAACATAACAAAATGTATCTTGG + Intronic
1028542639 7:91960493-91960515 CAAGATTTAAAGATGAATATGGG - Intronic
1029994851 7:104997623-104997645 CAATATTCCAAAATGAATGTTGG + Intergenic
1030556385 7:111030078-111030100 CATTACCACAAAAGGAATATTGG + Intronic
1031001699 7:116422986-116423008 CAAACTCACAGAAAGAATATGGG + Intronic
1031227724 7:119061793-119061815 CAATAGAACAAAATGTATATGGG + Intergenic
1031388814 7:121187575-121187597 CAAGATCACAAGTTTAATTTTGG - Intronic
1033533729 7:142292454-142292476 GAAGATTACTAAATTAATATGGG - Intergenic
1037100495 8:15038337-15038359 CAAGAACACAAAATGAGGAAAGG + Intronic
1037395697 8:18440374-18440396 CTAGATCAAAATATGAAAATGGG + Intergenic
1038343044 8:26704853-26704875 CAAGAAAAGAAAATGAATGTAGG - Intergenic
1038695086 8:29799351-29799373 GAAGAAGACAGAATGAATATTGG + Intergenic
1038941643 8:32312131-32312153 CAAGGTCAAATAATGAATGTAGG - Intronic
1039150655 8:34501604-34501626 CAAGACCACACAATGTACATCGG + Intergenic
1040371142 8:46776447-46776469 AAACATAACAAAAAGAATATCGG + Intergenic
1041146896 8:54885786-54885808 CAAGAATACAAAATGAAGAAAGG - Intergenic
1041189549 8:55339812-55339834 GAAGTTCAGAAAAAGAATATAGG + Intronic
1042061919 8:64827624-64827646 CATGATGACAAAATAATTATGGG + Intergenic
1042065471 8:64870238-64870260 AAAGATTAAAAAATGAATATAGG + Intergenic
1043476751 8:80612625-80612647 AAAGAGAACAAAATAAATATAGG - Intergenic
1043759419 8:84048370-84048392 CAAAATCACAAAATCAATTATGG + Intergenic
1045113743 8:98959102-98959124 CTAAATAAGAAAATGAATATAGG + Intergenic
1045622458 8:103996541-103996563 TAAGATCAGGAAATGAATCTTGG + Intronic
1046240881 8:111490094-111490116 AAAAATCACATAATAAATATTGG + Intergenic
1047439991 8:124869332-124869354 CAAGATAACAAAATAAAAATAGG - Intergenic
1047795890 8:128255222-128255244 CAAGATTCCAAAATGAAAAGAGG + Intergenic
1048019191 8:130522796-130522818 CAAGATAATAAAATAAATATTGG + Intergenic
1048153091 8:131913191-131913213 TATGATCACAAAATGAATGTTGG + Intronic
1052101683 9:24454416-24454438 CAATATCACAAGAACAATATAGG - Intergenic
1052922297 9:33981030-33981052 CAAGACCAAAAAAATAATATGGG + Intronic
1054809213 9:69421639-69421661 CAAGATCACACAGTGACAATTGG + Intergenic
1056058552 9:82857280-82857302 AAAGATCACATAATAAATATTGG + Intergenic
1056252109 9:84759961-84759983 CAAGAATACTAAATGACTATGGG + Intronic
1056991074 9:91411731-91411753 CAAGATCACAAAAAGCATTTTGG - Intronic
1057403677 9:94747307-94747329 CAAGATAACATAATGAAAAGGGG - Intronic
1058569018 9:106320693-106320715 CAAGATCCCATAAAGAATAGGGG - Intergenic
1058649752 9:107164260-107164282 CATGAACAACAAATGAATATAGG - Intergenic
1059817716 9:117936638-117936660 CAAGATCACAATCTGAAATTTGG + Intergenic
1059875961 9:118635056-118635078 GAAGATTACAAAGGGAATATTGG + Intergenic
1203611057 Un_KI270749v1:4419-4441 AAACATCACAAAATGACTACTGG + Intergenic
1186315245 X:8362593-8362615 AAAGAGCACAAAATGAATGGGGG - Intergenic
1186985781 X:15011904-15011926 CAAGGACACACAATGAGTATTGG + Intergenic
1187221804 X:17334481-17334503 CAAGATCACAACATGACTAGAGG - Intergenic
1187549848 X:20291097-20291119 CAAGATCACAAAAGCAGAATGGG + Intergenic
1187931866 X:24300914-24300936 CAAGAACAAAAAATAAATCTTGG - Intergenic
1189995896 X:46637411-46637433 CAAGATAACATAAGGAATAAAGG - Intronic
1190438887 X:50456718-50456740 CAAGACCACACAATCAATATGGG + Intronic
1193266070 X:79471285-79471307 CAACCTCAAAAAATCAATATAGG - Intergenic
1193820432 X:86156686-86156708 TAAGACCATAAAATGATTATTGG + Intronic
1193988985 X:88282770-88282792 ACAGATCACAAAATGCTTATTGG - Intergenic
1194484937 X:94474540-94474562 CAAGAGCACATAATTAATAAAGG - Intergenic
1194909719 X:99626399-99626421 AAACATCAGAAAATGAATAAAGG + Intergenic
1195250149 X:103036063-103036085 CAAGAACACACAATGAAGAAAGG - Intergenic
1196304097 X:114080567-114080589 GAATATCACAAAATCAATATTGG + Intergenic
1197494972 X:127167965-127167987 GAAAATCACATCATGAATATGGG + Intergenic
1197714503 X:129696765-129696787 TAAGATCACAATGTGAATTTTGG + Intergenic
1198487279 X:137100274-137100296 CAAGGTCACAAAGTAAATAAGGG + Intergenic
1198727769 X:139694936-139694958 CAATATCACAAGCAGAATATTGG - Intronic
1199342159 X:146693690-146693712 CAAGAAAACTAAATGAAAATTGG - Intergenic
1202015056 Y:20396301-20396323 CAACATCAAAAAATCCATATAGG + Intergenic
1202345882 Y:23926205-23926227 CAAGAACACAAAATGAAGAAAGG + Intergenic
1202524889 Y:25743885-25743907 CAAGAACACAAAATGAAGAAAGG - Intergenic