ID: 976726919

View in Genome Browser
Species Human (GRCh38)
Location 4:88223794-88223816
Sequence CCTCATCTGGAGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 8, 2: 9, 3: 36, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976726911_976726919 30 Left 976726911 4:88223741-88223763 CCTGAAGTAGGAACTGGAGCTCT 0: 1
1: 2
2: 1
3: 12
4: 153
Right 976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG 0: 1
1: 8
2: 9
3: 36
4: 278
976726913_976726919 4 Left 976726913 4:88223767-88223789 CCAGGCACTTCTTGTATTTCCTC 0: 1
1: 0
2: 2
3: 26
4: 331
Right 976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG 0: 1
1: 8
2: 9
3: 36
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976726919 Original CRISPR CCTCATCTGGAGAGGGATGA AGG Intronic
900751173 1:4398756-4398778 CCTCAACTAGAGAGGGCTGGGGG - Intergenic
900788237 1:4663097-4663119 CATCATCTAGTGAGGGCTGAAGG + Intronic
900790738 1:4678559-4678581 TCTCATTTGGAGAGGGCTGCAGG - Intronic
900835917 1:5003867-5003889 TCTCATTTGGAGAGGGCTGCAGG - Intergenic
902661111 1:17904517-17904539 CCCCAACTGGAGACGGAAGAAGG - Intergenic
902819614 1:18936005-18936027 CCTGATCTTGAAAGAGATGAGGG - Intronic
903068021 1:20711618-20711640 CCTGATCTGGTGAGGCCTGAGGG - Intronic
904114224 1:28149841-28149863 CCTCACCTGGGCAGGGATGATGG - Exonic
905346952 1:37317879-37317901 CCTCATCTGTAAAGAGGTGATGG + Intergenic
905380162 1:37556267-37556289 CCTCTTCTGGGGAGGGATGAAGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906015981 1:42580014-42580036 TCTCTGGTGGAGAGGGATGAGGG + Intronic
907191934 1:52656891-52656913 CCGCAGCTGGAGAGCAATGAGGG + Exonic
908231303 1:62107484-62107506 GCTCAACAGGAGGGGGATGAGGG + Intronic
908474219 1:64471771-64471793 CCTCCTCGGGAGAGGAAGGAGGG + Intronic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
911908169 1:103595544-103595566 ACTAAAATGGAGAGGGATGAGGG + Intergenic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911914749 1:103683922-103683944 ACTAAAATGGAGAGGGATGAGGG - Intronic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912352777 1:109030086-109030108 CTTCTTCTGGGGAGGGATGAAGG - Intronic
912481305 1:109984200-109984222 CCTCATTGGGATAGGGCTGATGG - Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
915138534 1:153751364-153751386 CCTCATCTGTTGATGAATGATGG - Intronic
915172995 1:153991129-153991151 CCTCTTCTGGAGAGGGATGAAGG - Exonic
915443038 1:155958391-155958413 GCACATCTGGAAGGGGATGAAGG + Exonic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917317595 1:173741695-173741717 CCTCTTCTGGAGAGGGATGAAGG - Intronic
918387325 1:184022972-184022994 CCAAGACTGGAGAGGGATGAGGG + Intronic
919182357 1:194103182-194103204 CCTACACTGGAGATGGATGATGG - Intergenic
919961287 1:202472075-202472097 CCTCTTCTGGAGAGGGATGAAGG + Intronic
920507389 1:206526157-206526179 CCTCATGTGGACAGGCAAGATGG - Intronic
920741139 1:208582319-208582341 CAGCATCTGGAGAGAGAAGATGG + Intergenic
922252544 1:223863236-223863258 CCTCAACTTGAGATGTATGAAGG - Intergenic
922591603 1:226781521-226781543 TCTCTTCTGGAAAGGGATGCAGG - Intergenic
923130571 1:231071348-231071370 GCACATCTGGAGGGGGATGGAGG - Intergenic
924529549 1:244881746-244881768 CTTCATCAGGGAAGGGATGAAGG + Intergenic
1062769072 10:85547-85569 GCCCACCTGGACAGGGATGAGGG - Intergenic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1070079779 10:73174714-73174736 GCTTCTCTGGAGGGGGATGATGG - Exonic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1070476277 10:76832318-76832340 CATTATCTGAAGTGGGATGAAGG + Intergenic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1072752471 10:97992232-97992254 CCTTATTTGGAGGGGGTTGAGGG + Intronic
1073522267 10:104144055-104144077 CTTCAGCTGGAAAGGGAAGAAGG + Intronic
1073956810 10:108882227-108882249 CCTCATCAGGAAAGTGATGGGGG - Intergenic
1074424539 10:113339239-113339261 CCCCATCTGGAGAAAGGTGAAGG - Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1076466382 10:130685113-130685135 CCTCAGCTGGAGTGGCTTGATGG + Intergenic
1078725977 11:13931388-13931410 CCTCAGGAGTAGAGGGATGAGGG + Intergenic
1079574560 11:21987277-21987299 CAGCATTTGGAAAGGGATGAGGG + Intergenic
1080576816 11:33607229-33607251 CGTCATATGGACAGGGATGTGGG + Intronic
1082088309 11:48068095-48068117 CCTCATTTGGAGAGGCAACAGGG + Intronic
1084085199 11:66851846-66851868 CAGCATCTGGAAAGGGATGTTGG + Exonic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1087516233 11:99165896-99165918 CGTCATCTGAGGTGGGATGATGG + Intronic
1088242119 11:107783671-107783693 CCTCATCTGGAGAGGGGCAGAGG - Intergenic
1088254363 11:107888943-107888965 CCTCATGTGGATAGTGCTGAAGG + Intronic
1089097383 11:115930706-115930728 CCAAATCTGGACAGGGATGGTGG - Intergenic
1089236842 11:117036009-117036031 CCTTTTCTGGAGAGGGATGAAGG + Intronic
1089310802 11:117556987-117557009 CCTCTCCTGGAGATGGATGCAGG + Intronic
1090237787 11:125162190-125162212 CTTCATCCTCAGAGGGATGATGG + Intergenic
1090727074 11:129537889-129537911 TGTCTTCTGGAGAGGGATGAAGG - Intergenic
1091333649 11:134750799-134750821 CCTCACCTGGAGAGCCACGATGG + Intergenic
1091538769 12:1439810-1439832 CCTAATCTCAAGAGGGAAGAGGG - Intronic
1091780547 12:3211875-3211897 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1095485383 12:42679082-42679104 CCTCTTCTGGGGAGGGATGAAGG + Intergenic
1098019883 12:66143331-66143353 CTTCTTGTTGAGAGGGATGAGGG - Intronic
1098686566 12:73429950-73429972 CCACATCTGGAGATTGATGTAGG + Intergenic
1101104273 12:101424461-101424483 TCTCTCCTGAAGAGGGATGAAGG - Intergenic
1101242753 12:102854668-102854690 ACTCAGCTGGAGAGGATTGAAGG + Intronic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101777478 12:107807399-107807421 GCTCTTCTTCAGAGGGATGATGG + Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1103364514 12:120371408-120371430 TCTCTTCTGGAGAAGGATGAAGG - Intergenic
1103723807 12:122988165-122988187 CCTCATCTGGACACGGAGGCTGG + Intronic
1104933789 12:132353950-132353972 CATCATCTGGAGAGACAGGAAGG + Intergenic
1104936156 12:132365448-132365470 CCACTCCTGGAGAGGGAGGAAGG + Intergenic
1104979621 12:132568021-132568043 CCCCCTCTGGAGAGGGTTGCTGG - Intronic
1105020955 12:132816654-132816676 CCACACCTGGAGAGGCATCAGGG + Exonic
1105368859 13:19785453-19785475 CCACTTCTGGAGAGGGCTGCAGG - Intergenic
1106589874 13:31089947-31089969 CCTCACCTGCAGAGGAATCAAGG - Intergenic
1107058536 13:36131352-36131374 CCTCCTCTGGAGAGAGAGGCTGG - Intergenic
1107263297 13:38520517-38520539 CCTCAGCTGGAAAGACATGAAGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108542905 13:51460934-51460956 CCTCATCTGGTGACTCATGATGG + Intergenic
1110638293 13:77791410-77791432 CCCCATCTGGACTGGGATGGAGG - Intergenic
1113420083 13:110164547-110164569 CCCCATCTGGAGCGGGAGGCAGG + Intronic
1113482960 13:110635047-110635069 CCTCATCTGTAATGTGATGATGG + Intronic
1113684490 13:112272933-112272955 CCTCATCTGGAGTGGGCAGGTGG + Intergenic
1115415008 14:33122334-33122356 CCTCTTCTGGAGAAAGGTGATGG - Intronic
1118886477 14:69870986-69871008 ACTCATGTGGAGAGGAATGGAGG + Intronic
1120763116 14:88303685-88303707 CTTCATCTAGAGAGGAATCAAGG + Intronic
1122785789 14:104162778-104162800 CCTCCTCTGGAAATGGATGTGGG - Intronic
1123904828 15:24911083-24911105 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG + Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128090472 15:64915635-64915657 CCTGACCTTGAGAGGGAGGAGGG + Intronic
1129622231 15:77158565-77158587 CCTGAACTGGAAAGGGAAGATGG - Exonic
1130997433 15:88911818-88911840 CCTTCCCTGGAGTGGGATGAAGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132458176 16:35791-35813 GCCCACCTGGACAGGGATGAGGG - Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1134569889 16:15282050-15282072 CATCATCTGGCCAGGCATGATGG - Intergenic
1134934949 16:18237964-18237986 CATCATCTGGCCAGGCATGATGG - Intergenic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1136713521 16:32259138-32259160 CCTCTTCCTGAGAGGGATGATGG - Intergenic
1136754390 16:32670293-32670315 CCTCTTCCTGAGAGGGATGATGG + Intergenic
1136813723 16:33200072-33200094 CCTCTTCCTGAGAGGGATGATGG - Intronic
1136820199 16:33310152-33310174 CCTCTTCCTGAGAGGGATGATGG - Intergenic
1136826762 16:33366691-33366713 CCTCTTCCTGAGAGGGATGATGG - Intergenic
1136831828 16:33465462-33465484 CCTCTTCCTGAGAGGGATGATGG - Intergenic
1137010345 16:35314693-35314715 CCTCTTCCTGAGAGGGATGATGG + Intergenic
1137024029 16:35455668-35455690 CCTCTTCCTGAGAGGGATGATGG + Intergenic
1138652108 16:58466508-58466530 CCCCATCTGGTGGGGGAAGAGGG - Intronic
1140306725 16:73809670-73809692 CCAGATCTGGAGACTGATGAGGG - Intergenic
1141393093 16:83680948-83680970 GCACATCTGTAGAGGGAAGAGGG + Intronic
1202992299 16_KI270728v1_random:23046-23068 CCTCTTCCTGAGAGGGATGATGG - Intergenic
1203056537 16_KI270728v1_random:930624-930646 CCTCTTCCTGAGAGGGATGATGG + Intergenic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1143263377 17:5616979-5617001 CCTCCTCTGGGGTGGGGTGAAGG - Intronic
1144630002 17:16866441-16866463 CTTCATCTGGGGTGTGATGATGG + Intergenic
1144651376 17:17009366-17009388 CTTCATCTGGGGTGTGATGACGG - Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145975005 17:28978813-28978835 CATCATCAGGGGAGGGATGGTGG + Intronic
1146286164 17:31575401-31575423 CCTCACCTGGAGAGTGTTCAAGG + Intronic
1147613364 17:41813941-41813963 CCTAAAATGGAGAGAGATGAGGG - Intronic
1148553973 17:48566835-48566857 CCTCATCTGGAAAGTGTTGGGGG - Intronic
1150119521 17:62588520-62588542 CCTCATCAGAGGAGGGATCATGG + Intronic
1151804634 17:76397793-76397815 CCTCACCTGGGGCAGGATGATGG + Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152962129 18:86357-86379 GCCCACCTGGATAGGGATGAGGG - Intergenic
1153957290 18:10108524-10108546 CATCATTTCGAAAGGGATGAGGG - Intergenic
1154072068 18:11161707-11161729 GCTCAGGAGGAGAGGGATGAGGG + Intergenic
1155177046 18:23310044-23310066 CCTTCCCTGGAGAGAGATGAGGG - Intronic
1156144616 18:34159883-34159905 TCTCAGCGGGAGAGGGATGCGGG + Intronic
1156870485 18:41939761-41939783 CCTCATTTGAAGGGGGATGAAGG - Intergenic
1157669728 18:49518153-49518175 TCCCATCTGGAAAGGGAAGATGG + Intergenic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1160327750 18:77966597-77966619 CCTCCACTGGAGAGGGTCGAGGG - Intergenic
1160464341 18:79063570-79063592 CCTCATCTGGGGAAAGGTGAAGG + Intergenic
1161636487 19:5392568-5392590 CCTCCGCTGGAGAGGCAGGAAGG - Intergenic
1161994872 19:7705986-7706008 GCTCAGCTGGAGATGGTTGAGGG - Intergenic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164264217 19:23597361-23597383 TCTCTTCTGGAGAGGGATGAAGG - Intronic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1165595661 19:37009744-37009766 CCTCATCTGGTGAGGCAGGCAGG - Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1168059366 19:53882656-53882678 CTTCATCTGGTGAGGGAAGGGGG + Exonic
1168318200 19:55493462-55493484 CCTCATTTGGATAGTGAAGATGG + Intronic
927138531 2:20114448-20114470 CCGCCTCTGGAGAAGGATGATGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927870007 2:26617362-26617384 CCACTTCTGGAGCTGGATGAAGG + Intronic
929969843 2:46564627-46564649 CCTCATCTGGACATAGAGGAAGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
935605089 2:104963981-104964003 CCACAAATGCAGAGGGATGATGG - Intergenic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
942184373 2:173410653-173410675 CCTCATCTGGAAATGGGAGATGG - Intergenic
942461927 2:176174701-176174723 CCTCCTCTCGAGTGGGGTGAGGG + Intergenic
944780707 2:203014610-203014632 CCTCAGCTGGACATGGAGGAGGG - Intronic
944862217 2:203825946-203825968 CTGCACCTGGATAGGGATGATGG - Intergenic
945471461 2:210232273-210232295 ACACATCTGGTGAGAGATGAAGG + Intergenic
946335908 2:219036310-219036332 CTTCATCTAGAAAGGGGTGATGG - Intronic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
948698401 2:239745631-239745653 CATCAGCCGGAGAGTGATGACGG - Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1171180554 20:23087803-23087825 ACTCACCTGGAGGGGGGTGAAGG + Intergenic
1171406096 20:24913306-24913328 CCTCAGTTGAAGAAGGATGAGGG + Intergenic
1171424168 20:25039172-25039194 CCTCATCAGGAAAGTGAAGAAGG - Intronic
1172010160 20:31841959-31841981 CCTCATCTGGACAGGGGTTGCGG - Intergenic
1172149383 20:32779694-32779716 CCCCAGCTGGTGAGGGAGGAGGG + Intronic
1172837475 20:37882329-37882351 CCTCACCTGGCCAGAGATGAAGG + Intergenic
1173171149 20:40724810-40724832 CCTCAGCATGAGAGGGATCAGGG + Intergenic
1173345816 20:42199101-42199123 CCTGATATGGACTGGGATGAAGG - Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175296820 20:57914202-57914224 TCACCTCTGCAGAGGGATGATGG - Intergenic
1175723149 20:61299774-61299796 CCTCATCTGCATCTGGATGACGG - Intronic
1176161632 20:63651711-63651733 CCTTATCTGGGTAGAGATGACGG - Intronic
1176342913 21:5714782-5714804 GCTCATCCTGAGAGGGAAGATGG - Intergenic
1176475167 21:7146933-7146955 GCTCATCCTGAGAGGGAAGATGG - Intergenic
1176501914 21:7609674-7609696 GCTCATCCTGAGAGGGAAGATGG + Intergenic
1176537234 21:8112851-8112873 GCTCATCCTGAGAGGGAAGATGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179954233 21:44729375-44729397 TCTCTTCAGGAGAGGGATGACGG - Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180205057 21:46254682-46254704 CCTCAGTTGGAGATGCATGAAGG + Intronic
1180205230 21:46255683-46255705 CCTCAGTTGGAGATGCATGATGG + Intronic
1180220081 21:46352966-46352988 CCAGAACCGGAGAGGGATGAGGG - Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1203242177 22_KI270733v1_random:29255-29277 GCTCATCCTGAGAGGGATGATGG - Intergenic
949249791 3:1970181-1970203 CCACATCTGGGGAGGGGTCATGG - Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
950034911 3:9878428-9878450 CCTCACCTGGAGAGGGACTTGGG + Exonic
953199068 3:40761565-40761587 CCTCTTCTGGAGAGGGATGAAGG - Intergenic
954688474 3:52383369-52383391 CTTGATCTGGGGAGGGGTGAAGG - Exonic
957539100 3:81545818-81545840 TCACATCTGGAGTGGGATGCAGG - Intronic
958708084 3:97681843-97681865 ACTGATTGGGAGAGGGATGAAGG + Intronic
959689046 3:109178601-109178623 CCTCATCTGGAAAGGGCTAAGGG + Intergenic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
964628709 3:158784934-158784956 CCTCACCTGGAGAGGGATGAGGG + Intronic
966298552 3:178452438-178452460 CATCATCTGCAAAGGCATGAAGG + Intronic
966808468 3:183824492-183824514 ACTCGTCTGGGGAGGGATCAAGG + Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967588978 3:191249606-191249628 GCTCATCTAAAGAAGGATGATGG - Intronic
968010049 3:195268697-195268719 CCTCCTCTGTTGAGGGGTGAGGG - Intronic
970510602 4:16777979-16778001 CCTGAGGTGGAGAGGGATGGGGG - Intronic
971026526 4:22594216-22594238 CCTGTTCTGGAGAGGGATGAAGG - Intergenic
971242071 4:24898206-24898228 CCTCACCTGGAGAGGGTTGGGGG + Intronic
972924042 4:43981864-43981886 TATACTCTGGAGAGGGATGACGG - Intergenic
973552960 4:52053325-52053347 CCTCTACTGTAGAGAGATGAAGG - Intronic
974507247 4:62791578-62791600 CCTCATCTGGGGTGGGTTGAGGG - Intergenic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
981555391 4:145988001-145988023 ACTCTTCTGGGGAGGGAGGAAGG - Intergenic
981602614 4:146507638-146507660 AAGCATCTGGACAGGGATGATGG - Intronic
985234306 4:187856310-187856332 CCTTTTCTTGAGAGGCATGAAGG + Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985806928 5:2052720-2052742 CCTCATCTGAATAGAGAAGATGG - Intergenic
986453385 5:7889855-7889877 CTTCATCTGAAATGGGATGATGG - Intronic
986883307 5:12202931-12202953 CCTCAAGAGTAGAGGGATGAAGG - Intergenic
987967061 5:24891088-24891110 CCTCACCTTTAGAGGGATGCTGG - Intergenic
988506263 5:31826117-31826139 CCTCACCTTGAGAGAGAAGAGGG - Intronic
989105488 5:37859123-37859145 CCTCTTCTGGCCAGGGATGGTGG + Intergenic
991718019 5:69469903-69469925 CCTATTCTGGAGAGGGATGAAGG - Intergenic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
995227903 5:109723823-109723845 CATCATCTGGAGAGAGAAAAAGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995949201 5:117689305-117689327 CCACATCTAGAGAAGGATAAAGG - Intergenic
996503321 5:124240819-124240841 CTTCATATGGAGAGGAAAGATGG + Intergenic
997354688 5:133254729-133254751 CCTTCTCTGGAGAGTGATGGGGG + Intronic
998159998 5:139808079-139808101 TCTGCTCTGGAGAGGGATGCTGG - Intronic
998292003 5:140925072-140925094 GCTCATCTGGAAAGGAAGGAAGG + Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
1001286186 5:170425734-170425756 CCTCACCTGGAGAGGTCTGGTGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001448839 5:171808390-171808412 CCACCTCTGCAGAGGGATGCGGG + Intergenic
1002209402 5:177587707-177587729 CTGCATCTGGAAAGGGATGGAGG + Intergenic
1002318405 5:178360465-178360487 CCTCATGTGGGGGGGGATGGAGG + Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1007752796 6:44080598-44080620 CCCCCTCTGGAAAGGGTTGATGG - Intergenic
1009197858 6:60708950-60708972 GCTCATCTGGCGAGGGAAAAGGG - Intergenic
1010241321 6:73618363-73618385 CCTCTTCTGGAGAGGGATGAAGG - Intronic
1010248962 6:73688653-73688675 CATCCTCTGGAGAGGGGAGAAGG + Intergenic
1011797749 6:90975967-90975989 CCTCATCTGTCGACAGATGAGGG + Intergenic
1013872381 6:114780900-114780922 CCTCATCTGCTGAGATATGAAGG + Intergenic
1014094154 6:117441473-117441495 CCTCATCTGGGTAGGGCTGGGGG + Intronic
1015025135 6:128523259-128523281 ACTGTTCTGGAGAGGGATGGTGG + Intergenic
1017029611 6:150209259-150209281 CCTCACCTGAAGATGGATCATGG - Intronic
1017415856 6:154219895-154219917 CCTCATCTGGAGGGTGATGCTGG + Intronic
1017614578 6:156230967-156230989 CATCAACTTGAGAGGGATGGAGG + Intergenic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1019359267 7:596380-596402 CCTCTTCTGGAGAGAGCTAAGGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1022248803 7:28586478-28586500 CTTCAGCTGGAGAGGGAAGGGGG - Intronic
1024284644 7:47746733-47746755 CCTCATCTGGAAAGTCATGCTGG - Intronic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1028692563 7:93670035-93670057 TCTCTTCTGGAGAGGGATGAAGG + Intronic
1030393325 7:108954061-108954083 CTTCAACTTGAGAAGGATGAAGG + Intergenic
1031124366 7:117756573-117756595 CATCATCTGGAGAGGGATCATGG + Exonic
1034433506 7:151052305-151052327 CCTCAGCTGGGGCGGGATGGTGG - Intronic
1035009643 7:155702732-155702754 CCTGAACTGGGGAGGGATGGAGG + Intronic
1035162413 7:156960921-156960943 CCTCATGTGGATTGGGATGAAGG + Intronic
1036650786 8:10642322-10642344 CCTCATCTGGAAAGGAATTTGGG - Intronic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1037931570 8:22883474-22883496 CCTTCCCTGGAGAGGGATGTGGG - Intronic
1038444027 8:27590815-27590837 CGTTTTCTGGAGAGGGATGGGGG + Intergenic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1039805784 8:40996714-40996736 GATCATATGGACAGGGATGATGG - Intergenic
1045018942 8:98024608-98024630 CCTCATCAGGAGAGGCATTGAGG + Intronic
1045294610 8:100862405-100862427 CCTCATCTGAGGATGGGTGATGG - Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1047599592 8:126412936-126412958 TCTCATCTGGAGAGAGCAGAGGG - Intergenic
1047820901 8:128519614-128519636 CCTCATCTGGACATGGCTTAAGG - Intergenic
1048970839 8:139644152-139644174 CATCAGTTGGACAGGGATGATGG - Intronic
1048977014 8:139678731-139678753 CCTCACCTGGCCAGGGCTGAAGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1051369811 9:16348681-16348703 CCGCATGAGGAGAGGCATGAGGG + Intergenic
1051586816 9:18735397-18735419 TCTCATGTGGCAAGGGATGAAGG - Intronic
1053817386 9:41926839-41926861 CCACATTTGGAGAGAAATGAAGG + Intronic
1054107635 9:61070490-61070512 CCACATTTGGAGAGAAATGAAGG + Intergenic
1054613222 9:67260635-67260657 CCACATTTGGAGAGAAATGAAGG - Intergenic
1057825460 9:98369346-98369368 CCTCATCTGGAGAGGACAGGGGG + Intronic
1057865072 9:98674088-98674110 CATCATCTAGAGAGGGAACAGGG + Intronic
1058541160 9:106014005-106014027 CCTGAACTGGACAGGGATGGAGG - Intergenic
1058596478 9:106621187-106621209 CCCCATTTGGAGAGCGAAGAGGG + Intergenic
1058609797 9:106763147-106763169 GGTAATCTGGAGAGGGCTGAAGG - Intergenic
1059049898 9:110912800-110912822 TCTCATCTGGAGGGTGAAGAAGG - Intronic
1059634608 9:116158513-116158535 CCTCATGTACAGAGTGATGATGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060218428 9:121752100-121752122 CCTAACCTTGAGAGGGATGGGGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1062736011 9:138137760-138137782 GCCCACCTGGATAGGGATGAGGG + Intergenic
1203458505 Un_GL000220v1:12332-12354 GCTCATCCTGAGAGGGATGATGG - Intergenic
1185530827 X:817013-817035 CTTCATCGCCAGAGGGATGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187189843 X:17023723-17023745 CAGCATTTGGAGAGGAATGAGGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1189715372 X:43859486-43859508 CATCAGCTGAAGAGGGATGGAGG - Intronic
1189872968 X:45404133-45404155 CCTTATCTGGTGAGGGGTGGTGG - Intergenic
1190142503 X:47860517-47860539 CATCCTCTGGGGAGGGAAGAGGG + Intronic
1192849813 X:74942829-74942851 CCCCATCTGGTGAGGGGGGATGG + Intergenic
1195538985 X:106040888-106040910 CCTAGTCTGGAGAGAAATGATGG + Intergenic
1197138949 X:123095562-123095584 CCTCCTCTGCAGTGGCATGAGGG - Intergenic
1197899047 X:131348852-131348874 CCTCAGCGGGAGCAGGATGATGG - Intronic
1199711567 X:150473321-150473343 CCTCTTCTGGAGAGTGGTCAAGG + Intronic
1200101931 X:153692638-153692660 CCTCTTCTGGAGAGAGGTGGGGG - Intronic
1200398220 X:156003579-156003601 GCCCACCTGGACAGGGATGAGGG + Intronic
1201597585 Y:15689043-15689065 CCTCATTTGGGGAGGGCAGAGGG - Intergenic