ID: 976727086

View in Genome Browser
Species Human (GRCh38)
Location 4:88225312-88225334
Sequence ATTTATAAAAATAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 7, 3: 84, 4: 790}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976727086 Original CRISPR ATTTATAAAAATAAGCAGGA AGG Intronic
900757530 1:4447008-4447030 ATTTACAAAACTGGGCAGGAGGG - Intergenic
901344150 1:8524074-8524096 TTTTATTAAAAGAAGCAGGAAGG + Intronic
901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG + Intronic
902240820 1:15088229-15088251 ATTTAGAAAAATAGGAGGGAGGG + Intronic
903835231 1:26199276-26199298 ATATACAAAAATTAGCCGGACGG + Intronic
903961806 1:27062690-27062712 ATTTATAAAAAGAAAGATGAGGG + Intergenic
904294817 1:29513339-29513361 ATTTATAGAAATCAGGATGATGG + Intergenic
904633668 1:31862932-31862954 ATATATAAATATTAGAAGGAAGG + Intergenic
904925067 1:34041152-34041174 ATTTATTTAAATAAGGAAGAGGG + Intronic
905400066 1:37695054-37695076 AGATAGAAAAATAAGCAGGCTGG + Intronic
905489101 1:38329592-38329614 CTTTATCAAAATGAGCAGGTTGG - Intergenic
907080923 1:51621048-51621070 ATTCATAAAACTAAAGAGGACGG + Intronic
908092915 1:60705378-60705400 ATTTTTAAAAAGAAGAAGAAAGG + Intergenic
909315781 1:74216460-74216482 ATTTAAAAAAAGAAGAAGAAAGG - Intronic
909664084 1:78114440-78114462 ATAGACAAAAACAAGCAGGATGG - Intronic
909994468 1:82262034-82262056 ATATATATAAATATGCAGTATGG + Intergenic
910083962 1:83375940-83375962 ATTAATGAAAATAAGCCAGATGG + Intergenic
910124787 1:83828697-83828719 ATTCCTCAAAATAAGCAGGCTGG - Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910769813 1:90819635-90819657 ATTTACAAGAGTAAGCATGACGG - Intergenic
911236401 1:95417034-95417056 ATTTACAAAAATGAGGAGTAGGG + Intergenic
911422877 1:97666994-97667016 ATTTAAAAAAATGAGTAGCAGGG - Intronic
911603909 1:99879283-99879305 AGTTTTAAAAATAAGCAAGCAGG + Intronic
911772852 1:101769255-101769277 ATTTATAAAAATAAGAATAATGG - Intergenic
911874392 1:103140578-103140600 ACTGATAAAAATAAGCAACAGGG + Intergenic
911924187 1:103806846-103806868 ATATATAAAAATAACCAAGTGGG + Intergenic
912137330 1:106677615-106677637 ATTTTTAAAAATAACAAAGAAGG + Intergenic
913076576 1:115345200-115345222 TATTATAGAAATAAACAGGAAGG - Intergenic
913646743 1:120863357-120863379 ATGTGTAAAAATATGCAGCAAGG + Intergenic
914079904 1:144399513-144399535 ATGTGTAAAAATATGCAGCAAGG - Intergenic
914174808 1:145268048-145268070 ATGTGTAAAAATATGCAGCAAGG - Intergenic
914214180 1:145609328-145609350 ATTTAAGAAAATAAGAAAGAAGG + Intronic
914356468 1:146889113-146889135 ATTTAGAAAACCATGCAGGAGGG + Intergenic
914466121 1:147929731-147929753 ATTTAAGAAAATAAGAAAGAAGG + Intronic
916087294 1:161280797-161280819 ATTAAGAAAAATCAACAGGATGG - Intronic
916661320 1:166924712-166924734 ATTTATAAAAATAGGAAGTGGGG + Intronic
916780128 1:168017626-168017648 ATTTATGAAATTCAGCAGGAGGG + Intronic
917443388 1:175086055-175086077 AGCTATTAAAATAAGCAGAACGG - Intronic
917686203 1:177418617-177418639 ATTCATAATAACAACCAGGAGGG - Intergenic
918726967 1:187937901-187937923 ATTTATAGAAATGAGAAGCATGG + Intergenic
918757231 1:188354370-188354392 AGTTGTAAAAATAAGGAGGAGGG - Intergenic
918869703 1:189953292-189953314 ATTTTTTAAAATAATCAGAAAGG + Intergenic
919098484 1:193064593-193064615 ATTTATATAATCAAGTAGGAAGG + Intronic
919178417 1:194049780-194049802 ATGTGTAGAAATAACCAGGAAGG - Intergenic
919331944 1:196183103-196183125 TGTTACACAAATAAGCAGGAAGG - Intergenic
920899795 1:210097041-210097063 AGACACAAAAATAAGCAGGACGG - Intronic
921525205 1:216209105-216209127 CTTTCTAAAAATAAGCAGTCAGG + Intronic
921744422 1:218722681-218722703 ATTTATAAAATTAAGAAATAAGG + Intergenic
921775986 1:219100584-219100606 ATTTAGAAAAATACCAAGGAGGG - Intergenic
921822365 1:219631709-219631731 ATTTATAAAAACAAGCAGTAGGG - Intergenic
922899699 1:229126759-229126781 ATTTATAAAGAAAACCAGTACGG - Intergenic
923008462 1:230070091-230070113 GTTTAGTAAACTAAGCAGGAGGG + Intronic
923071628 1:230570632-230570654 ATATATAAAAATAAACTTGATGG - Intergenic
923303705 1:232668190-232668212 ATTTACAAAAAAAAAAAGGAAGG - Intergenic
924927118 1:248693777-248693799 ATTTAAAAAAAAAAAAAGGATGG + Intergenic
1062766131 10:66673-66695 ATTTTTAAAAATCAACAGGCTGG + Intergenic
1063462281 10:6222314-6222336 AAATGTAAAAAGAAGCAGGAGGG - Intronic
1063707497 10:8445078-8445100 AATTTTAAAAATAAGAAGGGTGG - Intergenic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1063753429 10:8978204-8978226 ATTAACAAAAACAAGCAGGTGGG - Intergenic
1063956952 10:11276099-11276121 ATTTAAAAAAAGAAACAGAAAGG - Intronic
1064131764 10:12716010-12716032 ATTTATTAAAATAAGCAAAATGG - Intronic
1065543327 10:26792622-26792644 TTTTATAAAAATAAGTAGATTGG + Intronic
1065566507 10:27016431-27016453 ATTTAAAAAAATAATCAGCCAGG - Intronic
1065805833 10:29393040-29393062 CTTTATAATTAAAAGCAGGATGG - Intergenic
1065836048 10:29659493-29659515 ATTTATAAAAATGAGCGCCAAGG - Intronic
1065939043 10:30547163-30547185 ATGTATAAAAATATACAGAATGG - Intergenic
1066403623 10:35098632-35098654 CTTAATAAAAATAAGCAGGCGGG + Intergenic
1067377011 10:45736605-45736627 AAATAAATAAATAAGCAGGAAGG + Intronic
1067884715 10:50077299-50077321 AAATAAATAAATAAGCAGGAAGG + Intronic
1067899381 10:50222791-50222813 ATTTATAAAGATATGCAGAAAGG + Intronic
1068050894 10:51947610-51947632 ATTTAAAACAAACAGCAGGAGGG - Intronic
1068359670 10:55960668-55960690 AGTTACAAAAAAATGCAGGATGG + Intergenic
1069069668 10:63980274-63980296 ATTTAGAAAAATAACCAGTCTGG + Intergenic
1069232954 10:66035168-66035190 ATATTTCAAAATAAGCAGGGAGG + Intronic
1069359544 10:67625882-67625904 ATTTATAAAAATTAGTTTGAGGG + Intronic
1069426243 10:68290984-68291006 ATATAAACAAATAAGCATGATGG - Intronic
1069454848 10:68545990-68546012 ATAAATAAAAATAAGCCGGCTGG + Intergenic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1070958902 10:80485390-80485412 ATTTACACAAAAATGCAGGAAGG - Intronic
1071774894 10:88775184-88775206 ATTTATCAAAATCAGCATGCTGG - Intronic
1072411952 10:95210973-95210995 AATTCTAAGAGTAAGCAGGAGGG + Intronic
1072415556 10:95243906-95243928 ATTCATAGAGACAAGCAGGAGGG + Intronic
1072873541 10:99146868-99146890 AAAAATAAAAATAAGCAAGAGGG + Intronic
1073369897 10:102978323-102978345 ATTAATTAAAATAAGGATGATGG - Intronic
1073671952 10:105601174-105601196 ATTTTTAAAACTATGCATGAAGG + Intergenic
1075058413 10:119237410-119237432 ATTTGAAAAAATAAGCACTATGG + Intronic
1075154972 10:119967750-119967772 CTTTATAAAATTAATCAGGGAGG - Intergenic
1075361798 10:121844258-121844280 ATTTTTAAAAATAAGGGAGAAGG + Intronic
1075476170 10:122735956-122735978 ATTTTTAAAAATAAAAAAGATGG - Intergenic
1075588124 10:123671991-123672013 AATCATAATAATAAGCAAGAGGG + Intronic
1076468361 10:130701345-130701367 ATTTATAAAAGCACACAGGAAGG - Intergenic
1076574472 10:131454545-131454567 AATTTTAAAAATCAGCTGGAAGG - Intergenic
1077261291 11:1622294-1622316 ATTTAGAAACATAAGCAGGTGGG - Intergenic
1077363806 11:2153273-2153295 AATCAAAAAAACAAGCAGGAGGG - Intronic
1077677130 11:4205048-4205070 GTTTAAAAAAATAAGCATGCAGG + Intergenic
1077785765 11:5382024-5382046 ATTGTTAACAATATGCAGGAAGG - Intronic
1078031703 11:7758981-7759003 ATTTATGAATGTGAGCAGGATGG - Intergenic
1078308675 11:10216879-10216901 ATTTTTAAAAAAAAGTAGAAAGG + Intronic
1078588767 11:12619404-12619426 ATTTAAAAAAATAAGAAGATTGG + Intergenic
1078676446 11:13421136-13421158 ATTTATAATACTGAGTAGGAAGG + Intronic
1078880580 11:15444995-15445017 ATTTACAAAAACAGGCAGCAGGG - Intergenic
1081314061 11:41610059-41610081 ATGTACAAAAATAAGAAGAAAGG + Intergenic
1081467484 11:43335509-43335531 ATTTGTAAAAATAAACTGGTGGG + Intronic
1081509306 11:43752893-43752915 TTTTATAAAAATAAAAAGGTTGG - Intronic
1081886705 11:46504152-46504174 AGCTATAAAAAGAGGCAGGAAGG + Intronic
1083050629 11:59773303-59773325 ATTTAGAAAAAAATACAGGAAGG - Intronic
1083319489 11:61836970-61836992 ATGTATAGAAAAAAGCTGGAAGG + Intronic
1084481265 11:69421619-69421641 ATTTAAGAAAATAAGCAGAGTGG - Intergenic
1084913055 11:72406857-72406879 ATTTATAAAAGAAGGAAGGAGGG - Intronic
1085006496 11:73096242-73096264 ATTTAAAAAAGAAAGCAGGCAGG + Intronic
1085067072 11:73506321-73506343 ATCTATAGAAATAAGAAGAAAGG + Intronic
1085376453 11:76066768-76066790 ATTTATAAAAATAAATAGGCTGG - Intronic
1085378593 11:76091280-76091302 ATTTCTAAAAATAAAAAGCAAGG - Intronic
1085381723 11:76125768-76125790 AGTTGTAAAAATATGCAGAAGGG + Intronic
1085426556 11:76409897-76409919 ACTTATAAGAATGAGCAGGGTGG - Intronic
1085752684 11:79175793-79175815 ATTTGTAAAAATAGTCAGGCTGG + Intronic
1086046616 11:82540270-82540292 ATATATAAAAATAAACACAATGG + Intergenic
1086196748 11:84149481-84149503 GTCTACAAAAATAAGCAGTAGGG - Intronic
1087064347 11:94012997-94013019 ATTTTTAAAAATAAGTAAAATGG - Intergenic
1087115023 11:94515527-94515549 ATTTAAAAAAGAAAGAAGGAAGG - Intergenic
1087415050 11:97844129-97844151 ATTTAGAAATCTAAGCAAGATGG - Intergenic
1087469857 11:98558985-98559007 ATTTATAATAACAAGCAGGAGGG - Intergenic
1087771667 11:102217284-102217306 ATTTAGAAAAATAATGAGAAAGG + Intronic
1087863002 11:103186637-103186659 ACTTATAAAAATAAGAACTATGG + Intronic
1088068715 11:105754714-105754736 ATATTTAAAAATAAGCATTAGGG + Intronic
1088260179 11:107936263-107936285 AAAAATAAAAATAAGCTGGAGGG - Intronic
1089023065 11:115238357-115238379 ATTTTTAAAATTCAGCAAGATGG + Intronic
1089406129 11:118199150-118199172 ATTTTTAATTATAAGCAAGACGG + Intronic
1090564273 11:127970296-127970318 ATTTTTAAAAATAAATGGGATGG + Intergenic
1091370327 11:135052084-135052106 ATTTACAAAAACAAGGAAGACGG - Intergenic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1092317616 12:7435383-7435405 ATTTAGAAAAATAAGCAAAATGG + Intronic
1092450746 12:8599885-8599907 ATTTAAAGAAATTAGCTGGACGG - Intergenic
1092738656 12:11607924-11607946 ATCTATAAAAATGAACAGGTTGG - Intergenic
1092908728 12:13125982-13126004 ATTTTTTAAAATGAGTAGGAGGG - Intronic
1093334385 12:17883924-17883946 ATTTTTAAAAATAATCAGGCAGG - Intergenic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1093566799 12:20616017-20616039 TATTATAAAAATAAGCAGTCAGG - Intronic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1093918842 12:24836772-24836794 ATTTAAAAAAAGAAGAAAGAAGG + Intronic
1094278047 12:28701233-28701255 ATTGAAAATAATAAGCAAGAGGG - Intergenic
1095144352 12:38707155-38707177 ATTTTAAAAAATAACCAGGTTGG + Intronic
1095251824 12:39988468-39988490 ATTTAAAAAAAGAGGAAGGAAGG + Intronic
1095398292 12:41786405-41786427 AATGAAAAAAATAAGCAGGGTGG - Intergenic
1095404496 12:41853104-41853126 ATTTCTAATAATAAGCACAATGG + Intergenic
1095551526 12:43447095-43447117 ATTTAAAAAATTGAGGAGGAGGG + Intronic
1096362128 12:50997070-50997092 AAATATAAAAATAAGGAAGAAGG - Intronic
1096929126 12:55185012-55185034 ATTTATACAAATAAGAAATAGGG - Intergenic
1097039875 12:56149498-56149520 ATTTTTTAAAAAAAGCAGGCCGG - Intergenic
1097309062 12:58098877-58098899 GTTTATAAAGGGAAGCAGGAGGG - Intergenic
1097389037 12:58986513-58986535 TCTTATAAAAATATTCAGGATGG + Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097571607 12:61340071-61340093 ATTTCTAAAAATAGGTAGGCTGG - Intergenic
1097655661 12:62359331-62359353 AGTTATTATAATAAGCAGGAAGG - Intronic
1098454929 12:70661384-70661406 ATTTATTATAATAAACAAGATGG + Intronic
1098647497 12:72921552-72921574 ATGTTAAAAAATAAGCAGAAAGG + Intergenic
1098693381 12:73519214-73519236 ATATATAAAAATAAGCATCTTGG - Intergenic
1098829769 12:75347392-75347414 ATTTATAAGAATTACCAGTAAGG + Intronic
1099205876 12:79725805-79725827 ATTTATAAGAATATGCTGGTTGG - Intergenic
1099445249 12:82744124-82744146 ATTTTTAAAAATTAGCAGCCGGG + Intronic
1099675300 12:85754034-85754056 TTGTATAAAAATAATCAGAACGG + Intergenic
1099681147 12:85829599-85829621 ATTTAGAAAAATATGTAGGAGGG - Intronic
1099703902 12:86125642-86125664 AATTATTACAATAAACAGGAGGG + Intronic
1100147487 12:91696214-91696236 AATTATAGAAATAAGCAGCAAGG + Intergenic
1100175663 12:92028114-92028136 ATTTTTAAAAATATGCAGATTGG + Intronic
1100298634 12:93286645-93286667 CTTTTTAAAAATATGCAGTACGG + Intergenic
1100405569 12:94270256-94270278 CTTTATAAAAATAGGCAGAGGGG - Intronic
1100693293 12:97062919-97062941 ATTTATAAATAAAAGCAGACAGG - Intergenic
1102699270 12:114825115-114825137 ATTTATTAGAGAAAGCAGGAGGG + Intergenic
1102777646 12:115534590-115534612 ATTTACAAAAATAGACAGCAAGG + Intergenic
1102841610 12:116130891-116130913 AACTAGAAAAATAAACAGGAAGG + Intronic
1102848751 12:116217665-116217687 AATTAGATAAGTAAGCAGGAAGG - Intronic
1102851136 12:116246514-116246536 TTTTAGAAAAGTAAGCAGGCTGG + Intronic
1102925328 12:116821684-116821706 ATGTGGAAAAATAAGCAGGAGGG - Intronic
1102993686 12:117332566-117332588 ATTTAAAAAAAAAATCAGGCCGG + Intronic
1103260345 12:119582808-119582830 ATTAATAAAAATTGGGAGGAAGG - Intergenic
1103388338 12:120551601-120551623 ATTTAAAAATAAAATCAGGATGG - Intronic
1103531030 12:121601895-121601917 ATAAATAAAAAAAAGAAGGAAGG - Intergenic
1103810472 12:123609526-123609548 ATTAAAAAAAAAAAGCATGATGG - Intronic
1104337608 12:127914558-127914580 ATTTACAAAAACAAGCAGTGGGG + Intergenic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1105275954 13:18926628-18926650 ATTTATAAATAAAAGCAGAATGG - Intergenic
1105424251 13:20281490-20281512 ATTTATAACAATAATCAGAATGG + Intergenic
1106021287 13:25918286-25918308 AGTTATTAAAATAGGAAGGAGGG + Intronic
1106732330 13:32554433-32554455 ATTTCCCAAAATAAACAGGAAGG + Intergenic
1106748836 13:32735623-32735645 ATTTTTAAAAATATGCAGATTGG + Intronic
1106803081 13:33276663-33276685 ATTTTCAGAAGTAAGCAGGAAGG + Intronic
1107164383 13:37268172-37268194 ATATAAATAAATAAGCAGGCTGG + Intergenic
1107676041 13:42798116-42798138 ATTTATCACAATAAACAGCACGG - Intergenic
1107843395 13:44483930-44483952 ATTCATAAAAATAATCTAGAAGG - Intronic
1108348445 13:49568628-49568650 ACTTAAAAAAATAATCAGGCCGG + Intronic
1109041533 13:57344846-57344868 ATATATAAGAATAAACTGGAGGG - Intergenic
1109047482 13:57432007-57432029 ATTTACAAAAATAATCAGTGGGG + Intergenic
1109290255 13:60465268-60465290 ATAAATAAAAATAAGCACCAAGG - Intronic
1109565068 13:64102572-64102594 ATTTTTCAAAATAAGCAGTTGGG - Intergenic
1109696088 13:65960047-65960069 ATTTAAAATAATATGCATGAGGG + Intergenic
1109802031 13:67392990-67393012 ATTTATGAAAATAAGCGAAATGG - Intergenic
1109867506 13:68284560-68284582 AATAATAAAAAAAAGCAGGTTGG + Intergenic
1109980863 13:69904386-69904408 ATTTATAAAGATATTGAGGAGGG - Intronic
1110029102 13:70583214-70583236 ATTTTTAAAAATATCCAGCAGGG + Intergenic
1110164201 13:72418352-72418374 ATTTGTAAATAAAAGCAGGAGGG + Intergenic
1110165529 13:72438243-72438265 ATATATGTAAATATGCAGGATGG - Intergenic
1110247576 13:73343446-73343468 ATTTTTAAAAATATTCAGGCCGG - Intergenic
1110334100 13:74306413-74306435 AGTTTTAAAAATAAGAAAGATGG - Intergenic
1110334948 13:74316917-74316939 TATTATAAACACAAGCAGGAAGG + Intergenic
1110394993 13:75019477-75019499 ATTTAGAAAAATAAGGATAATGG + Intergenic
1110640343 13:77816551-77816573 ATTTATACAAATAAGAAGATGGG - Intergenic
1110668377 13:78145335-78145357 ATTTATCAAATTAAAAAGGAAGG - Intergenic
1110684362 13:78354366-78354388 AATTATAAAAGTAAACAAGAGGG - Intergenic
1110940991 13:81348252-81348274 ATTTCTAAAAATAAATATGAAGG + Intergenic
1111077229 13:83252865-83252887 ATTTCAAAAATTAAGGAGGAGGG + Intergenic
1111304570 13:86390481-86390503 ATAAATAAAAATAAGGAGAAAGG + Intergenic
1111522812 13:89427782-89427804 CTGTTTAAAAATAAGCAGTATGG + Intergenic
1111574881 13:90140605-90140627 ATTTTTAAAAATAAGGATAATGG + Intergenic
1111947744 13:94683215-94683237 ATTCACAAAAATGAGAAGGATGG + Intergenic
1112258738 13:97858523-97858545 ATTAATAAAACTAGACAGGATGG - Intergenic
1112274199 13:98001176-98001198 ATTCATAGAAATAAAAAGGAAGG - Intronic
1112294426 13:98174188-98174210 ATTTGCAAAATTAAGCAGAAAGG - Intronic
1112704822 13:102055732-102055754 ATTTGCAAAAATAGGCAGGCTGG - Intronic
1112705012 13:102058795-102058817 ACTCAGAAAAATAAGCAGTAGGG - Intronic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1112961798 13:105136066-105136088 ATTTACAAAAACAAGCTGGCTGG + Intergenic
1113636943 13:111926003-111926025 AGTATTAAAAATAAGCAGGCTGG + Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114497639 14:23144512-23144534 AATTTTAAAAATAAGCTGGGTGG + Intronic
1115263460 14:31476458-31476480 ATTTACAGAAATAAGGAAGAAGG - Intergenic
1115292867 14:31792657-31792679 AATTATAAAAAATAGCAGCAAGG + Intronic
1115463425 14:33686916-33686938 TTTTATAAAAATGTACAGGATGG + Intronic
1115845509 14:37528103-37528125 ATTTGTAAAAATATGTATGATGG - Intronic
1115926445 14:38441148-38441170 ACTTACAAAAATGAGCAGAATGG - Intergenic
1116012019 14:39362604-39362626 ATTTGTAAAGATAAGCAAAATGG - Intronic
1116334166 14:43635910-43635932 ATATATAAAAATAAGAAGAGAGG + Intergenic
1116590589 14:46767012-46767034 AGTTATAAAATAATGCAGGATGG + Intergenic
1116779306 14:49218647-49218669 ATTTGTACAAAGAAGCAGAAGGG + Intergenic
1117720548 14:58624758-58624780 ATTTATAAAAATAGGTAGAAGGG - Intergenic
1118177971 14:63461803-63461825 ATAAATAAAAATAAAAAGGAGGG + Intronic
1118238521 14:64034717-64034739 ATCTATAAAAATATGCAGTATGG - Intronic
1118545415 14:66881849-66881871 ATTAATACATATAAGCAGCATGG + Intronic
1119154841 14:72400416-72400438 ATCTATAAAAATCAGGAGGTGGG - Intronic
1119267124 14:73269594-73269616 ATATGTTCAAATAAGCAGGAGGG + Intronic
1119451553 14:74715961-74715983 TATTGGAAAAATAAGCAGGAAGG - Exonic
1119794620 14:77384880-77384902 ATGTATTAAAATAAGCATGGGGG + Intronic
1119937888 14:78609736-78609758 AATTATAAAAATAAGCAAAGTGG - Intronic
1120052117 14:79878857-79878879 AATAATAAAAATAAGCAGAGAGG - Intergenic
1121073531 14:91047114-91047136 ATATATAAACATAAGTAGTAGGG - Intronic
1121359315 14:93242017-93242039 ATTTTTAAGAACAAGCAGGCTGG - Exonic
1121367026 14:93322414-93322436 TTTTAAATAAATAAGCAGGCTGG - Intronic
1121609209 14:95264334-95264356 ATTTATTAAAATAAGATGCAGGG - Intronic
1121842626 14:97146764-97146786 ATTTAAAAAAATAATCAGCCAGG - Intergenic
1123483726 15:20663892-20663914 TTTTATTATAATAGGCAGGATGG - Intergenic
1123806593 15:23880227-23880249 ATTTAGAAAAATAAGAATTAGGG + Intergenic
1123883866 15:24703450-24703472 ATTGATAAAAATAAGCAATGTGG - Intergenic
1123888719 15:24753288-24753310 ATTTACAAAAACAAGTTGGAAGG - Intergenic
1124138122 15:27052890-27052912 ATTGATAAAAATAAGCAATAGGG + Intronic
1124701947 15:31922456-31922478 TTTTAGAAAAAAAAGCAGGAGGG - Intergenic
1124717162 15:32074055-32074077 ATTTTTAACAATAAGAAGGAAGG - Intronic
1124839237 15:33226412-33226434 ATATGAAAAAATAATCAGGAAGG + Intergenic
1125460377 15:39901068-39901090 ATTTATTCAAAAAGGCAGGAGGG - Intronic
1125460393 15:39901234-39901256 ATTTATTCAAAAAGGCAGGAGGG - Intronic
1125992901 15:44127574-44127596 ATTAATAAAAATAACCAGGCCGG + Intronic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1127213318 15:56798355-56798377 ATTTACAAAAAGAGGCAGTATGG + Intronic
1127357976 15:58219562-58219584 ATTGACAAAAATAAGCAGTGGGG - Intronic
1128710246 15:69866336-69866358 ATTTAAAAAAAAAATCAGCAGGG - Intergenic
1128971041 15:72106329-72106351 ATTTAAAAAAATAATTAGGAAGG + Intronic
1129275735 15:74444114-74444136 AATAATAAAAATAAGAAGAAAGG + Intergenic
1130201041 15:81826971-81826993 CCTGATAAAAATAGGCAGGAAGG - Intergenic
1130261873 15:82360827-82360849 ATTTATAAAAAGAGGCAGCATGG - Intergenic
1130279362 15:82508184-82508206 ATTTATAAAAAGAGGCAGCATGG + Intergenic
1130433440 15:83872897-83872919 ATTTTTAAAAATAATTTGGAAGG + Intronic
1131371363 15:91884822-91884844 ATATATGAAAATATGCAGCATGG - Intronic
1131703780 15:94970593-94970615 ATTTAAAGAAATAAAAAGGAGGG + Intergenic
1132326706 15:100976515-100976537 TTTGATAAAAATCAGAAGGAAGG + Intronic
1133240447 16:4411231-4411253 ATTTTTAAAAATTAGCTGGAGGG + Intronic
1133470327 16:6069007-6069029 ATTTATAAAAAAAAGAATGAAGG + Intronic
1133598768 16:7318872-7318894 AATTATAAAAATAACAACGAAGG + Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1134135996 16:11676691-11676713 ATTTTTAAAAATCAGCAAAAGGG - Exonic
1134340377 16:13339539-13339561 TTTTATTAAAAGAAGCACGAGGG - Intergenic
1134585233 16:15404531-15404553 ATTTAAAAAAATAAACATGGTGG + Intronic
1134746426 16:16592656-16592678 AATTAAAAAAATATTCAGGAAGG - Intergenic
1134822111 16:17255293-17255315 ACTTATAAAAATAGGCTGGCTGG - Intronic
1134999054 16:18761044-18761066 AATTAAAAAAATATTCAGGAAGG + Intergenic
1136645025 16:31606460-31606482 ATTCCAAAAAATAAGGAGGAGGG + Intergenic
1136739304 16:32500297-32500319 CTAGATAAAAATTAGCAGGAAGG + Intergenic
1137448555 16:48549346-48549368 ATTAACAAAAATAGGCAGTAAGG + Intronic
1137658136 16:50179008-50179030 AATTATAAAAAACATCAGGATGG + Intronic
1137922307 16:52502532-52502554 ATTTTTAATAAAAAGCAGTAAGG + Intronic
1138751126 16:59422420-59422442 ATGTACAAAAATCAGCAGCATGG - Intergenic
1138925908 16:61591179-61591201 ATTTATAAAAATGTGAAGGAGGG + Intergenic
1138927621 16:61611726-61611748 ATGAAAAAAAATAAGCATGAGGG + Intergenic
1139153631 16:64414820-64414842 ATTTAAAAAAATAAGTAACAAGG + Intergenic
1139812233 16:69630469-69630491 ATTCTTAAAAATGAGGAGGAGGG - Intronic
1139977549 16:70826340-70826362 ATTTAGAAAACCATGCAGGAGGG - Intronic
1140119209 16:72068809-72068831 TTTTAAATAAAAAAGCAGGAAGG + Intronic
1140261764 16:73386404-73386426 ATTTAAAAAAATAAGCAAACGGG - Intergenic
1140287559 16:73619161-73619183 GTTAATAAAAATAAGCACTATGG + Intergenic
1140290143 16:73645637-73645659 CTTTATAAAAATACGTAGCATGG + Intergenic
1140648573 16:77062607-77062629 ATTTAGAGAAAGGAGCAGGATGG - Intergenic
1140980687 16:80105982-80106004 GTTTACAAAAACAAGCAGGGGGG + Intergenic
1141333601 16:83134763-83134785 ATTAATTAAAATTTGCAGGAGGG - Intronic
1141834526 16:86529965-86529987 AGATATAAAAATAAGAGGGATGG + Intergenic
1142439287 16:90084604-90084626 ATTTTTAAAAATCAGCAGGCTGG - Intronic
1203013909 16_KI270728v1_random:331495-331517 CTAGATAAAAATTAGCAGGAAGG - Intergenic
1203032244 16_KI270728v1_random:604654-604676 CTAGATAAAAATTAGCAGGAAGG - Intergenic
1142845810 17:2675393-2675415 ATTTAGAAAAATAAGTGGGATGG - Intronic
1142886410 17:2915084-2915106 ATTTCTAAAAAGAAGAAGGCCGG - Intronic
1142895467 17:2974636-2974658 ATTTATAAACAAAAGTAGCAAGG + Intronic
1143418109 17:6765098-6765120 ATTTTTAAAAATCAGGAGGTAGG - Intronic
1143643155 17:8211093-8211115 TTTTATAAAAAGAAGAAGGCCGG - Intergenic
1143975997 17:10830233-10830255 ATCTATAAACAGAAGCAGGCAGG + Intronic
1145098060 17:20048737-20048759 ATATACAAAAATTAGCATGATGG + Intronic
1145949951 17:28809050-28809072 ACTCACAGAAATAAGCAGGATGG + Intronic
1146065230 17:29629803-29629825 ATTTAAAAAAATAGGCAGCATGG + Exonic
1146716595 17:35091207-35091229 AGTTACAAAAATAGCCAGGAAGG - Intronic
1147663925 17:42133445-42133467 ATTTTTAAAAACAAGCCAGAAGG + Intronic
1147807696 17:43143922-43143944 AATTATAAAAAAAACCAGGCCGG + Intergenic
1148474529 17:47918826-47918848 ATTTACAAAAACAGGCAGGTGGG - Intronic
1148509039 17:48153320-48153342 ATTTATAAAAATTACCTGGAAGG + Intronic
1148705571 17:49627814-49627836 ATTTTTAAAAATTAGAAGAAGGG - Intronic
1148839457 17:50485268-50485290 TATTATTAATATAAGCAGGAAGG + Exonic
1149217725 17:54377389-54377411 ATTTAGAAAATTATGCAGCATGG - Intergenic
1149275425 17:55029047-55029069 ATTTAAAAAAAAAAGCAGATTGG + Intronic
1149652843 17:58287909-58287931 ATTTTTAAAAAGAATGAGGAAGG - Intergenic
1149893163 17:60408160-60408182 ATTTATACCAAGAAGCAGGGGGG + Intronic
1149975225 17:61258881-61258903 ATTAATAAAATTAAGAGGGACGG - Intronic
1150045521 17:61909408-61909430 ATCTATAAAAATAAGAAGTAAGG - Intronic
1150824831 17:68465232-68465254 ACTTATAAAAATAACCCGGCCGG - Intergenic
1151011526 17:70503415-70503437 ATTTTTAAAAATAAGTGTGAGGG - Intergenic
1151035214 17:70791351-70791373 ATTTATAAATATAATCATGATGG + Intergenic
1151049531 17:70961453-70961475 ATTTATTAAGATAAGCAAAATGG + Intergenic
1151947537 17:77327730-77327752 ATTTAGAAAAAAAAAGAGGAGGG - Intronic
1152096441 17:78274710-78274732 TTTTTTAAAAATAGGCAGAAGGG + Intergenic
1152096492 17:78275035-78275057 ATAAATAAAAATAGGCAGAAGGG + Intergenic
1152314583 17:79572653-79572675 ATTTATTAACAAAGGCAGGAGGG + Intergenic
1152391001 17:80003564-80003586 ATGTATAAAAATAGACAGAAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153584159 18:6604157-6604179 CTTTAAAAAAATAAACAGGCTGG + Intergenic
1153601213 18:6782949-6782971 AATTCTAAAAAGGAGCAGGAGGG + Intronic
1153877772 18:9390459-9390481 ATTTAAAAAAAGAAGAAAGAAGG - Intronic
1154222318 18:12467120-12467142 AAATATAAAAATTAGCTGGATGG + Intronic
1154320763 18:13349609-13349631 ATTTAAAAAAATAAAAATGAGGG - Intronic
1154467574 18:14663994-14664016 ATTTATAAATGAAAGCAGAATGG - Intergenic
1155012850 18:21798636-21798658 ATATGTAAAAATATACAGGAAGG - Intronic
1155130244 18:22927419-22927441 ATTTACTTAAAGAAGCAGGATGG - Intronic
1155337373 18:24778443-24778465 ATTTATAAGAATAAGGAGTTGGG - Intergenic
1155502642 18:26502348-26502370 AAATATAAAAATTAGCAGGGCGG - Intronic
1155728040 18:29114513-29114535 ATACATAAAAATAAGCAAGATGG + Intergenic
1155771566 18:29707228-29707250 ATTTAAAAAAATAAAAAAGATGG - Intergenic
1155938641 18:31780717-31780739 AATCATAAAAATAAGCAAGCAGG + Intergenic
1156501543 18:37562847-37562869 GATTATAAAAATCAGAAGGATGG + Intronic
1156568784 18:38227001-38227023 ACTTAAAAAAATAAGTAGAAAGG - Intergenic
1156772800 18:40749882-40749904 ATTTAGAAAAATAGGCACAAGGG + Intergenic
1156996010 18:43467426-43467448 ATTTTTAAAAGAAGGCAGGAAGG + Intergenic
1157242900 18:46027858-46027880 GTTTATGAAAATAAGTAAGAGGG + Intronic
1157928508 18:51792564-51792586 ATTTATAAAAATCAGTAGGAGGG + Intergenic
1158207703 18:55011956-55011978 TTTTAAAACAATAAGCAGCAGGG - Intergenic
1158385989 18:56992045-56992067 CTTTATAAAATTAAACAGCATGG - Intronic
1158452230 18:57577249-57577271 ATTTACAAAAACAGGCAGTAGGG - Intronic
1158528173 18:58234220-58234242 ATTTTTAAAAGAAAGAAGGAAGG - Intronic
1159128917 18:64257585-64257607 ATTAAAAAAAAAAAGCAGGCCGG - Intergenic
1159236097 18:65674242-65674264 ATTTATATAAATAAATAGGATGG - Intergenic
1163065522 19:14790328-14790350 ATTTGTAAAAACAAGCAGCAGGG + Intergenic
1163264368 19:16209552-16209574 ATTTTTAAAAATTAGAAGCAGGG + Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164220575 19:23189570-23189592 CTTGATAAAAATAAAGAGGATGG + Intergenic
1164389749 19:27807526-27807548 ATTCTGAAAAATAAGGAGGAGGG + Intergenic
1165452512 19:35892350-35892372 TTTTTTAAAAATAAGAAAGATGG - Intronic
1166879207 19:45916879-45916901 AAATACAAAAATTAGCAGGATGG + Intergenic
1166926168 19:46269934-46269956 ACTTATAAAAACAAGAAGGCCGG - Intergenic
1167867062 19:52336979-52337001 ATTTTGAAAAAGAAGCATGAGGG + Intronic
1168247179 19:55118199-55118221 AAATATAAAAATTAGCAGGGCGG - Intergenic
1168641916 19:58036408-58036430 AAAAATAAAAATAAGCAGGGAGG - Intronic
925074303 2:1000722-1000744 ATTTTAAAAAATGAGGAGGAAGG + Intronic
926406909 2:12563127-12563149 TTTTATAAAATTACCCAGGATGG - Intergenic
926420984 2:12699005-12699027 ATTTGGAAAAAAAATCAGGATGG + Intergenic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926512074 2:13794004-13794026 ATTTATGAAAATAAGATTGAAGG + Intergenic
927056584 2:19370910-19370932 ATTTATAGAAATCTGCAGTAAGG - Intergenic
928056338 2:28059094-28059116 ATAAATAAAAATAAAAAGGAGGG - Intronic
928056685 2:28063149-28063171 ATTTACAAACTTAAGTAGGAAGG + Intronic
928079300 2:28295008-28295030 ATTTTTAAAAAACAGCAGCAAGG - Intronic
928153458 2:28854437-28854459 ATTTATAAAAATAAAAAAAATGG + Intronic
928414601 2:31081420-31081442 TAACATAAAAATAAGCAGGAAGG + Intronic
928773290 2:34728165-34728187 ATTTTTAAAAAGAAGAAAGATGG + Intergenic
929031502 2:37653820-37653842 ATGTATAAAAATGGGCAGGTGGG + Intronic
929352631 2:40976933-40976955 ATTTATAATAAAAAACTGGAGGG + Intergenic
929522220 2:42664257-42664279 ATTTATAAAATTGAGTAGTATGG + Intronic
931009920 2:57898715-57898737 ATTTCTACAAAGAAGCAGGCTGG + Intergenic
931337949 2:61367920-61367942 AGTTATAACAATAATGAGGAAGG + Intronic
931405855 2:61977542-61977564 ATTTTTAAAAATTAGCAGACTGG - Intronic
931606105 2:64053714-64053736 ATTTGCAAATATAAGCAGTATGG + Intergenic
931606268 2:64055801-64055823 ATTTATAAAAATTAGAAAGTTGG - Intergenic
931842735 2:66171378-66171400 TTTTATTCAAATAAGGAGGAAGG + Intergenic
931848227 2:66226567-66226589 ATTTAAAAAAAAAATCAGCAAGG - Intergenic
932259695 2:70316919-70316941 ATTTATAAAAGGGAGAAGGAAGG - Intergenic
932489131 2:72107877-72107899 ATTCAGAAAAAGAAACAGGAAGG - Intergenic
933168643 2:79100470-79100492 ATAGCTAAACATAAGCAGGAGGG - Intergenic
933431493 2:82185868-82185890 ATATATAAATATATGAAGGAAGG + Intergenic
933688346 2:85160553-85160575 TTTTAAAAAAAGAAGCAGGCTGG + Intronic
934148546 2:89120596-89120618 ATATATAAAATCAAGGAGGAGGG + Intergenic
935180698 2:100688737-100688759 AATTTTAAAAATAAGTTGGAGGG - Intergenic
935325725 2:101935361-101935383 ATAAATAAAAATAGGCTGGAAGG + Intergenic
936409843 2:112248027-112248049 TTTTATAAAACTAAGGAGGCTGG + Intronic
936673786 2:114690347-114690369 ATTAATAAAAATAAGCAATGGGG - Intronic
936715342 2:115180798-115180820 ATTGAGATAAATAAGCAGAAAGG - Intronic
936806410 2:116337525-116337547 AATCATAAAAATAATGAGGAGGG + Intergenic
937447631 2:121972219-121972241 ATTAAAAAAAAAAAGCAGGCAGG + Intergenic
937498957 2:122456793-122456815 ATCTACAAAAATAAGCAATAGGG + Intergenic
938550629 2:132378305-132378327 ATTTATAAAATAAAGAAGAAAGG - Intergenic
939427154 2:142054073-142054095 CCTTATAAAAATATGCATGATGG - Intronic
939699924 2:145377843-145377865 ATTTATATAAATAAGGATTAAGG + Intergenic
939716963 2:145595936-145595958 TTTTTTAAAAATACGCAGCATGG + Intergenic
939909332 2:147961925-147961947 ATTTAAAATATTAAGCAAGATGG + Intronic
940020426 2:149150894-149150916 ATTTAAAAAAATCAGTAGAAGGG - Intronic
940204396 2:151186667-151186689 AGTAATAAAAAAAAGCAGTATGG - Intergenic
940432538 2:153610371-153610393 ATTTATTAAAATAAACAGATTGG + Intergenic
940863193 2:158790902-158790924 ATTTATAAAAATAAGCAGCTGGG - Intergenic
940876940 2:158907331-158907353 AATTATAATAATAAAAAGGAGGG + Intergenic
941335367 2:164237231-164237253 ATTTATAATAGTAAACATGAGGG + Intergenic
941425031 2:165332690-165332712 ATTTCTAAAAAAAAGCAGGGTGG + Intronic
941836796 2:170031094-170031116 AATAATAAAAATAAAGAGGAAGG - Intronic
942969193 2:181936967-181936989 ATTTTTAAAAATAAGAAACACGG - Intergenic
943032278 2:182700273-182700295 ATTTAAAAAAATATGTAGGCCGG + Intergenic
943048710 2:182890045-182890067 ATTTATAAAAATAACCACTAGGG - Intergenic
943138419 2:183945826-183945848 ATATATATATAAAAGCAGGAGGG + Intergenic
943746778 2:191470096-191470118 ATTTAAAAAAGGAAGCAGGCCGG - Intergenic
944481570 2:200162765-200162787 TTTTATAAACTTAAACAGGAGGG + Intergenic
944483355 2:200179284-200179306 GATTATTAAAAAAAGCAGGAAGG - Intergenic
944521634 2:200575861-200575883 ATTTACAAAAATAAAGAGAAAGG - Intronic
944791468 2:203132663-203132685 ATTTAAAAAAATTAGAAGCAGGG - Intronic
944969578 2:204977169-204977191 ATCTCTAAAAACAAGCACGAAGG - Intronic
945121428 2:206461509-206461531 AATTTTAAAAATAAGGAGGTTGG + Intronic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
945999487 2:216469186-216469208 ATTTTTAAAAATAAGCAAAAAGG - Intronic
946595550 2:221302096-221302118 ATTCATAAAAATAATCAGATGGG - Intergenic
947021889 2:225687687-225687709 ATTTATAAATATATGCAAAATGG + Intergenic
947387874 2:229610179-229610201 AGTTCTGAAAATAAACAGGAAGG + Intronic
947676066 2:231981242-231981264 ATTTTTAAAAACATGAAGGAAGG - Intronic
947737202 2:232461927-232461949 TTTTTTAAAAATAAGGAGGGAGG + Intergenic
948008189 2:234628595-234628617 ATTTATAAAAACAATCTGTAAGG + Intergenic
948754714 2:240152198-240152220 AATTTTAAAAATTAGCAGAAAGG + Intergenic
949002404 2:241623631-241623653 ATTTAAAAAAAAAAGAAGGGAGG + Intronic
1169705325 20:8496858-8496880 TATTATAAAAATGAGCATGAAGG - Intronic
1169707403 20:8521243-8521265 ATTTGTACAAATGAGAAGGAGGG - Intronic
1169925763 20:10782477-10782499 ATTTATCCAAATACACAGGAAGG - Intergenic
1170211131 20:13847198-13847220 GTTTATAGAAATGTGCAGGAAGG - Intergenic
1170319704 20:15081734-15081756 TTTTTTAAAAAATAGCAGGAAGG - Intronic
1170425467 20:16231047-16231069 CCTTGTAAAAATAAGCAAGAAGG - Intergenic
1170776666 20:19380658-19380680 ATTTATTAAAGGAAGCATGATGG + Intronic
1172451345 20:35026076-35026098 ATTGATCATAATAAGCATGAGGG + Intronic
1172501104 20:35428175-35428197 ATTAAAAAAAATTAGCTGGATGG - Intergenic
1172570895 20:35969496-35969518 ATATAAAAATATAAACAGGAAGG - Intronic
1172802127 20:37583192-37583214 ATAAATAAAAATAAACATGATGG + Intergenic
1173267112 20:41494201-41494223 ATGTACAAAAATCAGCAGAAGGG + Intronic
1173816569 20:45993250-45993272 ATTTAAAAAAAAAAGGAAGAAGG + Intergenic
1173937186 20:46877039-46877061 ATTTTTAAAAATAATCAGGCAGG + Intergenic
1174171824 20:48622485-48622507 AAGTATAAAACTAAGCACGAAGG - Intergenic
1174207044 20:48847808-48847830 ATTTATAGAAATCAGAAGGATGG - Intergenic
1174492981 20:50915928-50915950 CTTAATAAAGATAAGCAGGCAGG + Intronic
1174551016 20:51361758-51361780 ATTTTTAAAAATGGGCTGGATGG + Intergenic
1174630574 20:51953457-51953479 ATTTTTAAAGAAAAGAAGGAAGG - Intergenic
1174883476 20:54306218-54306240 ATTTATATAATTAAGAAGGTTGG + Intergenic
1175589271 20:60174551-60174573 ATTTATAAAAATGAGTAATATGG - Intergenic
1175602148 20:60283283-60283305 ATTTATTAAAAAAGGTAGGAAGG + Intergenic
1175627004 20:60497290-60497312 ATATTTAAAAAGAAACAGGAAGG + Intergenic
1176260731 20:64178148-64178170 ATTTTTGAAAATAATGAGGATGG - Intronic
1176347225 21:5760259-5760281 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176354039 21:5880843-5880865 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176497602 21:7564196-7564218 ATTTATAAAAATAAAGAGCTGGG - Intergenic
1176541546 21:8158329-8158351 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176560497 21:8341374-8341396 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176889829 21:14301623-14301645 ATTTATAAAAAGAAGAGGAAGGG + Intergenic
1177048310 21:16199959-16199981 AGTTTTAAAAATAAGAAAGATGG + Intergenic
1177346825 21:19884027-19884049 ATGAATAAATATAAGCATGAGGG - Intergenic
1177374193 21:20247937-20247959 ATTTTTAGCAAGAAGCAGGAAGG - Intergenic
1177495294 21:21881431-21881453 TTTTTTAAAAATTAGCATGAGGG - Intergenic
1177680805 21:24367633-24367655 CTTTATAAAAATAAATAGAAGGG + Intergenic
1178709319 21:34900814-34900836 ATTTTTAAATATAAGCATTATGG + Intronic
1179143692 21:38749521-38749543 ATTTAAAAACATAAGTAGGCTGG - Intergenic
1179472979 21:41624113-41624135 ATTTACAAAAATAGGCGGCAGGG - Intergenic
1181693372 22:24579182-24579204 ATTAATACAAATATCCAGGAAGG + Intronic
1181849361 22:25739066-25739088 ATTTAGAAAAATTAGCTGGGTGG + Intergenic
1182097848 22:27638097-27638119 GTTTATCAGAATAAGCATGAGGG - Intergenic
1183728588 22:39604231-39604253 ATTTATAAATATGAGCAGACAGG - Intronic
1184064634 22:42110825-42110847 TTTTAAATAAAAAAGCAGGAAGG - Intergenic
1184065540 22:42117517-42117539 ATTTACAGAAATTTGCAGGAAGG + Intergenic
1185408317 22:50670040-50670062 ATTTAGAAAAAGAATCAGGCTGG + Intergenic
1203246485 22_KI270733v1_random:74748-74770 ATTTATAAAAATAAAGAGCTGGG + Intergenic
949197620 3:1331857-1331879 AATAAGAAAAAAAAGCAGGAGGG + Intronic
949232072 3:1761992-1762014 CTTGATAAAAATAAGCAAGGGGG + Intergenic
949247617 3:1943527-1943549 ATTTAAAAAACTAAGAAAGAGGG - Intergenic
949291371 3:2470373-2470395 TTTTATAAAAATAAGCAACATGG - Intronic
949544097 3:5057531-5057553 ATTTATAGAAATACGGAAGATGG + Intergenic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
950070919 3:10151906-10151928 ATTTTTAAAAATTAGCATGGCGG + Exonic
950141323 3:10618018-10618040 ATATATAGATAAAAGCAGGAAGG + Intronic
951139192 3:19141722-19141744 ATTTATAAAAGAAAGAAGCAAGG - Intergenic
951495359 3:23319207-23319229 ATTTTATAAAATAAACAGGAAGG + Intronic
951858115 3:27220722-27220744 ATTTTGAAAAATAAGAACGAAGG + Intronic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
954020151 3:47733255-47733277 ATTTAAAAAAAGGAGCAGGGCGG + Intronic
954091845 3:48291208-48291230 TATTGGAAAAATAAGCAGGAAGG + Intronic
955024733 3:55156499-55156521 AATTATTAAAATTAGGAGGAAGG + Intergenic
955520994 3:59775503-59775525 ATTTATAAAATCAAAAAGGAAGG - Intronic
955572716 3:60325194-60325216 AATTATAAAAATATGTAGCATGG - Intronic
955751420 3:62188641-62188663 ATTTCAAAAAATAAGAAGAATGG + Intronic
956067394 3:65411721-65411743 ATTACTAAAAATAAGCAGTTGGG - Intronic
956236328 3:67075820-67075842 ATTTAAAAAAATAAAAAGGTTGG + Intergenic
956459886 3:69461413-69461435 ATAAATAAAAATAACCAGGCTGG + Intronic
956554429 3:70502665-70502687 ATTGACAAAAATAAGCAAGGGGG + Intergenic
956871013 3:73418201-73418223 ATTTTTAAAAATAAGAATGGTGG + Intronic
957531785 3:81450044-81450066 ATCTATAACAATAGGCAGAAAGG + Intergenic
957541109 3:81570108-81570130 CTTTATAAAAATAAGTAAGCAGG - Intronic
957543231 3:81603473-81603495 ATTTATAAAAATATATAAGATGG - Intronic
957628732 3:82690267-82690289 TTTTATAAAAGTAATCAAGAGGG - Intergenic
957797494 3:85030642-85030664 ATATATAAATATAAGTAAGATGG - Intronic
957845439 3:85727852-85727874 ATTTAAAAAAATAATTAGAAAGG + Intronic
957971816 3:87391437-87391459 ACTTATTAAACTAATCAGGAAGG + Intergenic
958140312 3:89554080-89554102 ATTTTGAAAAATACGCATGAAGG - Intergenic
958483087 3:94669346-94669368 ATTTAAAAAAAAAAACATGAAGG - Intergenic
958872414 3:99576406-99576428 ATTTATATAAATTATCAGGCAGG + Intergenic
959316415 3:104813504-104813526 ATTGACAAAAATAAGCAGTGGGG + Intergenic
959486230 3:106929879-106929901 ATTTTTAAAAAATAGCAAGAAGG - Intergenic
959536351 3:107490068-107490090 TTTAATAAAATAAAGCAGGAGGG + Intergenic
959787438 3:110317342-110317364 ATTTATACTCATATGCAGGAAGG + Intergenic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
959970512 3:112404098-112404120 AGTTATAAAAATAAAGAGGTAGG - Intergenic
960786692 3:121380586-121380608 ACTTAAAAAAAAAAACAGGATGG - Intronic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
960917118 3:122707094-122707116 ATATGTAAAAAAAAGCAGGCTGG - Intronic
960981585 3:123232975-123232997 ATTTTTAAAAATTAGCGTGATGG + Intronic
961095830 3:124155872-124155894 AGTAATTAAAATAAGCAAGAAGG - Intronic
961271528 3:125693055-125693077 ATTTTTCCTAATAAGCAGGACGG - Intergenic
961912046 3:130327823-130327845 ATGTTTATAAATAAGCAGAATGG + Intergenic
962107354 3:132405187-132405209 ATTTCTAAACAAAAGAAGGAGGG - Intergenic
962233779 3:133691042-133691064 ATTTATAAGAAAAAGTGGGATGG + Intergenic
962297516 3:134205118-134205140 AAAGATAAAAATAAGCAGGTTGG + Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962679598 3:137784592-137784614 ATTTAAAAAAATACTCAGGTAGG - Intergenic
963059466 3:141213090-141213112 TTTTACAAAAACAAGCAGTAGGG - Intergenic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963127161 3:141826927-141826949 ATTTACAAAAACAGGCAGTAGGG + Intergenic
963621013 3:147606537-147606559 TTTAATAAAAATATGCAAGAAGG - Intergenic
964592536 3:158380656-158380678 TTTTATAAAAATCAACATGATGG + Intronic
964859041 3:161180199-161180221 ATTTATTAAAATATACAGCAGGG - Intronic
965361146 3:167739961-167739983 ATTTATATAAATCAACATGAAGG - Intronic
965608982 3:170525351-170525373 ATTTTTAAAAATAAGGTGCAAGG - Intronic
965627008 3:170691486-170691508 ATTTATGAAAAGTAGGAGGACGG - Intronic
965657524 3:171004354-171004376 ATTAATAAAAATAAACATCAAGG + Intronic
965771216 3:172183044-172183066 ATTTCTAAAAATAAGAAATAAGG + Intronic
965940752 3:174178131-174178153 ATTTAGAAGAATAAGTGGGAAGG + Intronic
966031948 3:175360453-175360475 ATTTAGGAAAAGAAGCAAGAGGG - Intronic
966140321 3:176749645-176749667 ATTCAAAAAGACAAGCAGGAAGG - Intergenic
966265230 3:178032708-178032730 ATTTATACAAACAAGCAAGTAGG - Intergenic
966345550 3:178974935-178974957 ATTTAAAAAAAAAGGAAGGAAGG + Intergenic
966363306 3:179152917-179152939 ATATATAATAATATGCAGGAGGG + Intronic
966672267 3:182540423-182540445 AACTACAAAAATTAGCAGGACGG + Intergenic
966780778 3:183582230-183582252 ATATATATACATAAGCAGAAAGG + Intergenic
967047706 3:185752908-185752930 TTTTAAAAAAATAAGTAAGAGGG + Intronic
967695917 3:192530120-192530142 AATTAAAAAAAAAAACAGGATGG - Intronic
968177066 3:196559884-196559906 ATTAAAAAAAATAACTAGGAGGG + Intronic
969098827 4:4753818-4753840 ATTTACAAAAATAAGCAGGCAGG + Intergenic
970389260 4:15591088-15591110 ATTCATAAAAATATGCATGTTGG - Intronic
970746526 4:19304284-19304306 ATTTATAAAAATAAGTGGCATGG + Intergenic
971054193 4:22894447-22894469 ATTTATGAAAGTAATAAGGAAGG - Intergenic
971096149 4:23406000-23406022 ATTTCAAAAAATAAGGAGGTAGG - Intergenic
971256310 4:25016870-25016892 ATTTATAAAAATAAACATTCAGG - Intronic
971496337 4:27269700-27269722 GCTTATAAAAATAAGAAGGTGGG - Intergenic
971588445 4:28435332-28435354 ATTGAAAAAAATCAGAAGGATGG - Intergenic
971787250 4:31120312-31120334 ATTTAAAAAACCAAGAAGGAAGG - Intronic
971788748 4:31139787-31139809 ATTTAGAAAAATAATCAAGAAGG - Intronic
971813490 4:31458716-31458738 TTTTTTAAAAAAAAACAGGAAGG - Intergenic
972062844 4:34900809-34900831 ATTTATAAAAATGAGAAAAATGG + Intergenic
972191069 4:36591708-36591730 ATATATAATAAGAAGCAAGAAGG + Intergenic
972437328 4:39045889-39045911 ATTTTTCAAAGCAAGCAGGAGGG - Intronic
972514096 4:39796380-39796402 AGTTTTAAAAATTAGCTGGATGG - Intergenic
973262922 4:48182849-48182871 ATGTATACAAATAACCAGGCTGG + Intronic
974280648 4:59787241-59787263 ATTTATAAATAAAAGCATAACGG + Intergenic
974400670 4:61402163-61402185 ATTTACAAAAACAAGCAGTGTGG + Intronic
974816405 4:67010503-67010525 AATTATGAAAATTAGTAGGAGGG + Intergenic
975168820 4:71209689-71209711 ATTTCTCACAATAATCAGGAAGG - Intronic
975229948 4:71921313-71921335 TTTTTTAAAAATAAACAAGATGG + Intergenic
975471993 4:74780653-74780675 ATCTATTAAAATAAGGATGACGG - Intronic
975558533 4:75688161-75688183 ATTAAAAAAAAAAAGAAGGAAGG - Intronic
975989444 4:80242226-80242248 ATTTTTCATAGTAAGCAGGATGG - Intergenic
976303231 4:83535353-83535375 ATTTTTAAGAATGAGCAGAAGGG - Intergenic
976483713 4:85575262-85575284 TTTTATAAAAACAAACAGGAAGG + Intronic
976727086 4:88225312-88225334 ATTTATAAAAATAAGCAGGAAGG + Intronic
976983210 4:91258740-91258762 GTCTATAAAAATAAGCATAATGG - Intronic
977000371 4:91490965-91490987 ATTAAAAAAAATAAGCAAAAAGG + Intronic
977057204 4:92207657-92207679 ATATAAAAAAATAAGTAGAATGG - Intergenic
977076802 4:92463623-92463645 ATTTACAAAAATAAACTGAAGGG + Intronic
977801608 4:101240732-101240754 ATTTAAAAAAATAATAAGGATGG + Intronic
978242078 4:106527500-106527522 ATTTATATAAATAAACACCAAGG + Intergenic
978293109 4:107169838-107169860 ATTTATAAAAATTAGTATGTAGG - Intronic
978881864 4:113714364-113714386 ATTTTTAAAAAGAAGAAGAATGG - Intronic
979166331 4:117536549-117536571 ATTAATAAAAATAATCATCAGGG + Intergenic
979294891 4:119020728-119020750 ATTTATAAAAAAAATTAGGTAGG - Intronic
979538256 4:121849495-121849517 CTTTATAAAAATAAACTGGCGGG - Intronic
979831216 4:125306533-125306555 ATTTATAAAAACAAGAAGCAAGG - Intergenic
979834710 4:125350430-125350452 ATTTAAAAAAATCAGCATTAAGG - Intronic
979933460 4:126662215-126662237 AATTATAAAAATAACCACAAAGG + Intergenic
980216676 4:129860937-129860959 ATTTATAAAAATTATCATGTTGG - Intergenic
980223819 4:129955111-129955133 ATTTATAAAAATAAATTGAATGG + Intergenic
980254130 4:130354543-130354565 ATTTACAAAAATAAGCTGCAGGG - Intergenic
980693493 4:136327540-136327562 ATTTGTAGCAATAAGCAAGATGG + Intergenic
982738996 4:159038488-159038510 ATTTTTAAAAAAATGTAGGATGG - Intronic
983856145 4:172647757-172647779 AATTATAAAAATAAGAATTAGGG - Intronic
984367554 4:178818527-178818549 AATTAGATAAATAACCAGGAAGG + Intergenic
984446431 4:179842485-179842507 ATTTATGATAATGAGCAGTAGGG + Intergenic
984627416 4:182022944-182022966 TTTGAAAAAAATAAGCTGGAAGG - Intergenic
984863710 4:184262667-184262689 ATATATAGAAAAAAGCTGGAGGG + Intergenic
985372962 4:189306763-189306785 ATTTTTAAAAGGAAGCAGGAAGG + Intergenic
985937005 5:3105062-3105084 ATTTATAAAATGCACCAGGATGG - Intergenic
986709165 5:10475389-10475411 TTTTATATAAATAATCAGTAAGG - Intergenic
987286587 5:16464040-16464062 GTTTATAAAAATATCCAGGCAGG - Intronic
987330236 5:16850569-16850591 ATTTAAAAAAATAAGCAGCCAGG - Intronic
987539766 5:19239236-19239258 ATTTTTAAAAATCACCAGGAAGG + Intergenic
987570268 5:19648116-19648138 AGTTATAAAGAGAAGCAGGCTGG + Intronic
987587472 5:19874860-19874882 ATTTAGAAAAATGCTCAGGATGG + Intronic
988215883 5:28272211-28272233 TTTTATAAATATTACCAGGAGGG - Intergenic
988306243 5:29498314-29498336 AACTATAGAACTAAGCAGGAGGG - Intergenic
988645992 5:33095751-33095773 ATTTGAAAAAATAAACAAGATGG - Intergenic
988701884 5:33683745-33683767 ATTTATAAAAATAAGTTAAAAGG + Intronic
988836889 5:35042161-35042183 ATTTATGAAAGTAGGCTGGAGGG + Intronic
988845258 5:35120976-35120998 ATTTATATAAATAAACAGGCTGG + Intronic
988949946 5:36246031-36246053 ATTTCTAAAAATTAGCAGGGTGG - Intergenic
989139410 5:38188570-38188592 AGTTATGAAAATATGCAGAAAGG - Intergenic
989205034 5:38801686-38801708 TTTTATAAAAATGACCAGCATGG - Intergenic
989953465 5:50329417-50329439 ATAAATAAAAATAAGGATGATGG - Intergenic
989989042 5:50739519-50739541 ATTAATCCAAATAAGCAGAAAGG + Intronic
990406214 5:55493585-55493607 ATTTTTAAAAATTAGCTGGGTGG + Intronic
991075134 5:62527421-62527443 ATTTATAGAAATAAGTACGTGGG + Intronic
991111785 5:62908537-62908559 ATTTACAAAAAAAACCAGGCTGG + Intergenic
991558403 5:67922382-67922404 TTTTATAAAGATACCCAGGAAGG - Intergenic
992091232 5:73319108-73319130 CTTTATCAAAATAAGGAGTATGG + Intergenic
992988854 5:82262691-82262713 ATTTGTAAAAATTAGAAAGAGGG - Intronic
994018613 5:94998186-94998208 ATTTAAAAAAATAAGCAAACAGG + Intronic
994102603 5:95910251-95910273 ATTGAAAAAAATAATAAGGAGGG + Intronic
994271925 5:97787803-97787825 TTTTTTTAAAATAAGGAGGAAGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994474895 5:100254495-100254517 ATTTATTAAAATGTACAGGAAGG + Intergenic
994629297 5:102263412-102263434 ATTTTTAAAAATAAGTATGTAGG - Intronic
995151895 5:108857711-108857733 AATTTAAAAAATAAACAGGAGGG - Intronic
995232302 5:109781244-109781266 TTTTATAAAAATCAGAAGCAGGG - Intronic
995796590 5:115947521-115947543 AATAATAAAAATATGCATGATGG - Intergenic
995904777 5:117110401-117110423 GTTTATAAAACTAATCAGGGAGG - Intergenic
996433148 5:123402723-123402745 ATTGATAAATATAAGCAAAATGG + Intronic
996773264 5:127107829-127107851 ATGAATAAAATGAAGCAGGAAGG - Intergenic
996805074 5:127445597-127445619 ATTTATAGACACAAGCAGAAGGG + Exonic
996943871 5:129043320-129043342 ATTTCTAAATGTCAGCAGGATGG + Intergenic
998009058 5:138678668-138678690 ATTTAAAAAAAAAAAAAGGAAGG - Intronic
998012317 5:138705137-138705159 ATTTCTAACAGTAAACAGGAGGG - Intronic
999363283 5:151004180-151004202 ATTTAAAAAAAGAAGAAGGCTGG + Intergenic
999536583 5:152523957-152523979 ATTTACAAAGATATGCAAGATGG + Intergenic
999705842 5:154271887-154271909 CTTTAAAAAATTATGCAGGAAGG - Intronic
1000445359 5:161312428-161312450 ATTTAGAAAGGTAAGAAGGAAGG + Intronic
1000704582 5:164494756-164494778 ACTTATGAAAATATTCAGGACGG - Intergenic
1000809164 5:165839192-165839214 ATTTAAAAAATTATGCGGGAGGG + Intergenic
1001092932 5:168754763-168754785 ATTTAAAAAAACAGGCTGGATGG + Intronic
1001626002 5:173132954-173132976 ATTAAGAAAAATAAAAAGGATGG - Intronic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1002023291 5:176379554-176379576 ATTAAGAAATATAACCAGGATGG - Exonic
1002595616 5:180320291-180320313 AGTTATAAAAATAAACACAATGG - Intronic
1003108374 6:3232303-3232325 ATTTTAAAAAAGAAGCAGGCTGG - Intronic
1003418079 6:5930864-5930886 CTTTACATAAATTAGCAGGAAGG + Intergenic
1004895360 6:20142744-20142766 TTTTTTAACAATATGCAGGATGG - Intronic
1005410194 6:25537031-25537053 ACTTATACAAAAAAGCATGAAGG - Intronic
1005502226 6:26438914-26438936 ATTTAAATAAATAAGTATGATGG + Intergenic
1005524614 6:26633703-26633725 AGTTAGAAAAATAAGCATGAAGG + Intergenic
1006720965 6:36150690-36150712 ATTTTTAAAAATAGGTGGGATGG + Intergenic
1007268160 6:40612664-40612686 ATTTTTTTAAAAAAGCAGGAAGG - Intergenic
1007832228 6:44647346-44647368 ATTTATAAAACTAATAGGGAGGG + Intergenic
1007931268 6:45693388-45693410 ACTTATAAAAATAAAAAGTATGG + Intergenic
1008097849 6:47358269-47358291 ATTTAAAAAAAAAACCTGGAAGG + Intergenic
1008150412 6:47943613-47943635 GTTTACAAAAACAAGCAGCAGGG - Intronic
1008886398 6:56435769-56435791 ATTTTCAAACATAAGCATGAAGG + Intergenic
1008930987 6:56939727-56939749 AATTATATAAATAAGCAGCCGGG + Intronic
1009560068 6:65228662-65228684 TTTTATAGAAATAGGCAAGATGG + Intronic
1009646293 6:66406970-66406992 AGTTATTAAAAGAAGCAGAAAGG - Intergenic
1009867026 6:69409923-69409945 ATTTATTAAACTAATCAGGGAGG + Intergenic
1010065630 6:71679629-71679651 ATCTACAAAAAGAAGCAGGCCGG - Intergenic
1010078916 6:71834613-71834635 AGATATAAAAATAAGAAGGAAGG - Intergenic
1010326984 6:74575780-74575802 CTTTTAAAAAATAAGTAGGATGG + Intergenic
1010328747 6:74596165-74596187 AATTTTAAAAATAATTAGGATGG + Intergenic
1010611680 6:77961432-77961454 ATTGACAAAAATAAGCAAAAAGG - Intergenic
1010860531 6:80904299-80904321 ATATATAAAAACAAGAAAGAAGG + Intergenic
1011530451 6:88315445-88315467 ATTTATACAAATAAAAAAGAAGG - Intergenic
1011729071 6:90241738-90241760 AGTTAAAAAAATAAGCAGTTTGG - Intronic
1011834127 6:91408889-91408911 ATTTATAAAGAAAAAGAGGATGG - Intergenic
1012138618 6:95591996-95592018 ATTTGAAAAAATAATCAGGCTGG - Intronic
1013085139 6:106850502-106850524 ATTTTTAAAAATAACCAGTCTGG + Intergenic
1013144522 6:107374814-107374836 ATAAGTAAAAATAAGCAGGAAGG - Intronic
1013147528 6:107409272-107409294 AGTTATAAAAATCAAGAGGATGG - Intronic
1013247813 6:108303569-108303591 AATAAGAAAGATAAGCAGGATGG - Intronic
1013322093 6:109003464-109003486 CTTTTAAAAATTAAGCAGGAAGG + Intronic
1013600625 6:111701099-111701121 CTTTATAAAAAAAAGAAGAAAGG + Intronic
1013879807 6:114883414-114883436 GTTGATAAAAATAAGCAGTGAGG + Intergenic
1014044689 6:116872038-116872060 ATTTTTAAAAATAATCTGGTTGG + Intergenic
1014496756 6:122134417-122134439 ATTTATAAAATTAATAGGGAGGG - Intergenic
1014575533 6:123065892-123065914 ATATATAAAAATAACTAGAAAGG + Exonic
1014858652 6:126435021-126435043 ATTTTTAAACCTTAGCAGGAGGG - Intergenic
1015168601 6:130226523-130226545 CTTTATAAAAATAATTATGAGGG + Intronic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015641717 6:135340754-135340776 AGTTATAAAAATAAGTTGGTGGG + Intronic
1015843251 6:137494647-137494669 AGTTAAAAAAAAAATCAGGAAGG - Intergenic
1016094981 6:140024709-140024731 AAATACAAAAATAAGCAGAAGGG - Intergenic
1016284281 6:142455175-142455197 ATTTTTAAAAAATAACAGGAAGG + Intergenic
1016501157 6:144722313-144722335 ATTTAAAAAAAAAAACCGGAGGG - Intronic
1016521891 6:144955085-144955107 ATTAAAAAAAAAAAGAAGGAGGG - Intergenic
1016612302 6:146004546-146004568 ATTTTGAAAAATAGGGAGGAAGG + Intergenic
1016644221 6:146386051-146386073 ATTTATCATAATAATCAGTATGG - Intronic
1017139981 6:151181625-151181647 TTATATAAAAATTAGCAGGCCGG - Intergenic
1017649382 6:156567004-156567026 ATTTAGAATACAAAGCAGGATGG - Intergenic
1017689896 6:156953641-156953663 AATTATAAAAATATCCAGGAAGG - Intronic
1018884656 6:167924224-167924246 AATTAAATATATAAGCAGGAAGG - Intronic
1018885524 6:167932463-167932485 ACTTAGAAAAATAAAAAGGAGGG - Intronic
1018963796 6:168467607-168467629 ATTTTTAAAAATTAGCAGGTTGG - Intronic
1019593282 7:1846395-1846417 GTTTATAAACACCAGCAGGATGG + Intronic
1021030842 7:15732980-15733002 ATTTAAAAAAATAAAAATGAAGG - Intergenic
1021341265 7:19465211-19465233 ATTTACAAAAACAAGCAGGTGGG + Intergenic
1021499324 7:21312288-21312310 AGTCATAAAAAGAAACAGGAGGG + Intergenic
1021644242 7:22772324-22772346 ATATATAAAAACAAGCAAGTTGG - Intergenic
1022026855 7:26456088-26456110 ATTTATTATAATTAGCAGCAAGG - Intergenic
1022050336 7:26662316-26662338 ATTTTTAAAAATAAACGGGGAGG - Intergenic
1022248021 7:28579963-28579985 ATTTAAAGAGATAAGCAGTAAGG + Intronic
1022402313 7:30051455-30051477 TCTAATAAAAATAAGAAGGAAGG - Intronic
1022836872 7:34126241-34126263 ATTTTTAAGGAAAAGCAGGAAGG + Intronic
1023360764 7:39413102-39413124 TCTTTTAAAAATAAGCAAGAAGG - Intronic
1023637189 7:42224264-42224286 ATGTAGAAAAATAAGCAAGATGG - Intronic
1024750579 7:52460757-52460779 ATATATTAAAATTAGCAGGCTGG + Intergenic
1024770734 7:52719741-52719763 AATGATAATAATAAACAGGAAGG + Intergenic
1025272107 7:57532184-57532206 ATTTAAAAAAATTAGAAGCATGG - Intergenic
1025550882 7:62247253-62247275 CTAGATAAAAATTAGCAGGAAGG + Intergenic
1026180821 7:68038999-68039021 GTTTATACAAATAGGAAGGAGGG + Intergenic
1026465919 7:70654481-70654503 ATTAAAAAAAATAAGCAGTATGG - Intronic
1026606317 7:71819006-71819028 TTTTTTAAAAATAAGCTGGTCGG - Intronic
1027218707 7:76201032-76201054 ATTTAAAAAAAAAAAAAGGAGGG - Intergenic
1027268742 7:76508735-76508757 ATTTTTAAAAATTAGCAGCTGGG + Intergenic
1027300792 7:76832077-76832099 ATTAATGAAAATAAGCCAGATGG + Intergenic
1027449160 7:78310027-78310049 GATTAAGAAAATAAGCAGGAAGG - Intronic
1027518294 7:79169819-79169841 TTTAATAAAAATTTGCAGGAGGG + Intronic
1027694302 7:81389522-81389544 ATTTATAATAAAAAGCAAAAAGG + Intergenic
1027920970 7:84394109-84394131 ATTTATCACAATATGCAAGAAGG + Intronic
1028006148 7:85570906-85570928 ATATATAAAAATTAACAAGATGG + Intergenic
1028014176 7:85686241-85686263 ATTTAAAAAAATACCCAGGCTGG - Intergenic
1028266222 7:88729367-88729389 ATTCATAAAAGAAAGGAGGAGGG - Intergenic
1028295658 7:89127744-89127766 ATTTTTCAAAATAAACATGACGG + Intronic
1028453909 7:91017860-91017882 AGTTATGAAAATAATCTGGAAGG - Intronic
1028557391 7:92138410-92138432 AAATAAAAAAATAAGCAAGATGG + Intronic
1029241844 7:99168654-99168676 ATTTAAAAAAATTAGCTGGATGG - Intergenic
1030060997 7:105621219-105621241 ATTGACAAAAAGAAGAAGGAAGG - Intronic
1030564570 7:111137273-111137295 ATTTATAATAATAAGCATGCTGG + Intronic
1030980459 7:116180102-116180124 ATATATAGAAATAAGTAGCAAGG + Intergenic
1031337658 7:120555926-120555948 ATTTTTAAATATAAGCAATATGG - Intronic
1031541650 7:123002468-123002490 ATTTAAAAAAAGAATCAGGTGGG - Intergenic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1033182976 7:139198973-139198995 TATTGGAAAAATAAGCAGGAAGG + Intergenic
1033398900 7:141002647-141002669 ATTTATAAATACAAGCATTATGG + Intergenic
1033770354 7:144544506-144544528 ATTTATAAAGAAGAGCAGGCCGG + Intronic
1033988199 7:147251959-147251981 ATTAATAAAAAAAAACAGCAAGG + Intronic
1034123782 7:148652735-148652757 ATTTATAAAAATCAGCGAGAGGG - Intergenic
1034670625 7:152854935-152854957 ATTTACAAAAATAGGCTGGGAGG - Exonic
1034751551 7:153573353-153573375 AATTATAAAAAAAGGCAGGCCGG - Intergenic
1034751666 7:153574691-153574713 ATTTCAAAAAATAAGTAGTAGGG + Intergenic
1034906786 7:154955901-154955923 ATTAAAAAAATTAATCAGGAGGG - Intronic
1035435383 7:158855854-158855876 TTTGATAAAAACAAGCAGTAAGG - Intergenic
1036126456 8:6067431-6067453 TTTAGTAAAAATAAACAGGAGGG - Intergenic
1036411035 8:8501500-8501522 ATTTAAAAAAATTAGTAGGATGG + Intergenic
1037016562 8:13914791-13914813 AATAATAATAATAATCAGGAGGG + Intergenic
1037653273 8:20860189-20860211 ATTTATAAAGATAGGCATGGAGG + Intergenic
1037714845 8:21388571-21388593 ATTTAGAAAACTAAGCAGCTTGG + Intergenic
1037934651 8:22907300-22907322 AAATATAAAAATTAGCAGCATGG + Intronic
1038166972 8:25094907-25094929 ATTTCTAAGACTGAGCAGGATGG - Intergenic
1038890031 8:31711131-31711153 ATTTTTAAAAATGCGAAGGAGGG - Intronic
1038896093 8:31783944-31783966 ATTTATAAAACTAATTCGGATGG + Intronic
1039516120 8:38135145-38135167 ATTTATAAAAGTAAGCTGGGAGG - Intronic
1039715648 8:40105802-40105824 ATTTTTATAAATATGCAAGAAGG + Intergenic
1039719623 8:40149418-40149440 ATTTATGAATATAAGCAAAAGGG - Intergenic
1039906861 8:41792641-41792663 ATATATATAAATAAGCGGGGAGG + Intronic
1041169420 8:55126108-55126130 ATTAATAAAAGAAAGAAGGAAGG + Intronic
1041346057 8:56899187-56899209 ATTTATAAAATAAAGCAGAGAGG - Intergenic
1041368272 8:57131995-57132017 ATTTGTAAAAAAAAACAGGCCGG - Intergenic
1041594210 8:59627658-59627680 ATTTGTAAAATTAAACAAGAAGG + Intergenic
1041750684 8:61257718-61257740 ATTTAAAAAAATAAGTAGGCTGG + Intronic
1042279140 8:67036385-67036407 CCTTAGAAATATAAGCAGGAGGG + Intronic
1042600603 8:70495650-70495672 GTTTATAAAAATGAGAATGATGG - Intergenic
1042804910 8:72760594-72760616 TTGTATCAAAATAAGCTGGAGGG - Intronic
1042990707 8:74636416-74636438 ATATATAAATTTATGCAGGAAGG + Intronic
1043331645 8:79124070-79124092 AATTATAAAAATCAAAAGGAGGG + Intergenic
1043466044 8:80507898-80507920 ATTTTTAAAAATAAGCATCAGGG - Intronic
1043958304 8:86388189-86388211 AAATATAAAAGTAAGTAGGAAGG - Intronic
1043987487 8:86710766-86710788 ACTTATGAAAATAAGCTGGAAGG + Intronic
1043999032 8:86855540-86855562 ATTAATAAAAATATTCAGGCCGG + Intergenic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1044475477 8:92620226-92620248 ACTTATAATAATAAACATGATGG - Intergenic
1044793821 8:95875719-95875741 ATTTCAAAAAATGAGGAGGAGGG + Intergenic
1045133077 8:99179450-99179472 ATTTTTAAAAGCAAGAAGGAGGG - Intronic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1045608226 8:103803044-103803066 ATCTATAGTAACAAGCAGGAAGG - Intronic
1046076188 8:109314940-109314962 GTTTAAAAAAATAAGCAAGTGGG + Intronic
1046406150 8:113775291-113775313 ATTTACAAAAATAAGGAAAAAGG + Intergenic
1046594340 8:116243161-116243183 ATTTATAAAAATAGGTGGGAAGG - Intergenic
1046796222 8:118375692-118375714 ATTTTTAAAAAGAAACAAGAAGG - Intronic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1047212606 8:122852000-122852022 ATTTAAAAAATTAAACAGGAAGG - Intronic
1047635587 8:126758587-126758609 ATTTATATAAATTATCAGAATGG + Intergenic
1047822566 8:128537637-128537659 GTTTATAAAAATAAGGTGGTTGG - Intergenic
1047936900 8:129790570-129790592 ATTTGAAAAAAAAATCAGGAGGG + Intergenic
1048339610 8:133528592-133528614 ATTTACAAAAATAGGTGGGAAGG - Intronic
1048412816 8:134193240-134193262 AATTCTAAAAAGCAGCAGGATGG + Intergenic
1049010892 8:139886690-139886712 ATTTATGAAAGGAAGAAGGAAGG - Intronic
1050022700 9:1301549-1301571 TTTAATAAAAATATTCAGGATGG + Intergenic
1050224326 9:3433931-3433953 ATTTACAAAAATAGGCAGCCAGG + Intronic
1050519725 9:6484708-6484730 ATTAATAGAAATAAGAAGGTAGG - Intronic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1050596234 9:7207019-7207041 ATTTATAAAAACAAGCCCAAAGG - Intergenic
1050755193 9:8993852-8993874 ATTTATAAAACCTAGCAGGAGGG + Intronic
1050876836 9:10650437-10650459 ATTTTTAAAAAGAAAAAGGAGGG + Intergenic
1051117074 9:13708020-13708042 ATTAAAAAAATTAAGCAGAATGG + Intergenic
1051302146 9:15663455-15663477 AAGAATAAAAATAAGCAGGCAGG - Intronic
1052691684 9:31823078-31823100 AATTATAAGAATCATCAGGAAGG - Intergenic
1052763292 9:32614520-32614542 AATTATAAAATTAAGCTGGAAGG + Intergenic
1052907407 9:33848349-33848371 ATTTAAAAAATTAAGAAGTATGG - Intronic
1054791203 9:69258604-69258626 ATTTAAAATAAAAAGCAGGATGG - Intergenic
1054858878 9:69929641-69929663 CTTTAAATAAAAAAGCAGGAAGG - Intergenic
1056805880 9:89728620-89728642 TTTTATAAAATTAAACAGGAAGG + Intergenic
1056878717 9:90366773-90366795 TTTTATAAAAGTAATCAAGAAGG - Intergenic
1057725724 9:97566696-97566718 ATTTAAAAAAATAAAAATGATGG + Intronic
1058520907 9:105813154-105813176 ATTTTTCCAAATAAGCAGGGGGG - Intergenic
1058738072 9:107914558-107914580 ATTTTTAAAAATAAGGAACACGG - Intergenic
1058840104 9:108898386-108898408 ATTTTTAAAAATGAACAGTAAGG + Intronic
1059049339 9:110905647-110905669 ATTTATAAAACATAGCAGGCTGG - Intronic
1059142020 9:111862326-111862348 ATTTTTAAAAATAAATAGGCTGG + Intergenic
1059300254 9:113306936-113306958 ACTTAAAAAGATAAGCAGGTAGG + Intergenic
1059516984 9:114905218-114905240 AATTTTTAAAATGAGCAGGATGG + Intronic
1061310750 9:129760660-129760682 ATAAATAAAAATAAACAGGCCGG + Intergenic
1062739108 9:138157622-138157644 ATTTTTAAAAATCAACAGGCTGG - Intergenic
1203462820 Un_GL000220v1:57820-57842 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1185610385 X:1390916-1390938 ATTTTTAAAACTTAGCAGGCGGG - Intronic
1186089629 X:6031514-6031536 ATTTATGAAGATAAGCAAGGAGG + Intronic
1186661779 X:11675189-11675211 GTTTATAAAAATAAACTGGCCGG - Intergenic
1186928310 X:14359308-14359330 ATTTACAAAACTGATCAGGAAGG - Intergenic
1186992844 X:15088145-15088167 ATATAAACAAATAAGCATGATGG - Intergenic
1187526904 X:20062478-20062500 CTTTAAAAAAAAAAGAAGGAAGG + Intronic
1187908707 X:24090599-24090621 ATTTAAAAAATTAGGCATGATGG - Intergenic
1188090563 X:25959368-25959390 ATTTATAAAAATAAGGAAAAAGG - Intergenic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188485393 X:30676089-30676111 ATTTTTAAAAATTAGCCAGATGG - Intronic
1189769375 X:44408331-44408353 ATTTTTAAAAAATAGCTGGATGG + Intergenic
1190103351 X:47540286-47540308 ATTTAAAAAAAAAAACAGGCTGG + Intergenic
1190114412 X:47617045-47617067 ATTTAGAAAAAAAAGAAGGAAGG + Intronic
1190770747 X:53512186-53512208 AATTAAAAAAAAAAGCAGGCTGG + Intergenic
1191006659 X:55717411-55717433 ATTAACAATAAAAAGCAGGAAGG + Intergenic
1192121137 X:68457099-68457121 AAGTAAAAAAAGAAGCAGGATGG + Intergenic
1193558974 X:82994051-82994073 ATTCCCAAAAATAAGGAGGAGGG - Intergenic
1193599167 X:83488149-83488171 ATTTATAAAAAAAATCAAGGAGG - Intergenic
1194064360 X:89243131-89243153 ATATATAAAAATAATTAAGAGGG - Intergenic
1194304287 X:92223222-92223244 ATATATACAAATAAGTAGGGAGG - Intronic
1194350728 X:92822677-92822699 ATTTATAAAACAATGCAGTAAGG - Intergenic
1196200009 X:112875561-112875583 CTTTAAAAAAATTAGTAGGAAGG + Intergenic
1196524632 X:116718047-116718069 ATTGACAAAAACAAGCAAGAGGG + Intergenic
1197137963 X:123084776-123084798 ATATACAAACATAATCAGGAGGG - Intergenic
1197185466 X:123580952-123580974 ATTTTTAAAAATCATTAGGATGG + Intergenic
1197452564 X:126638217-126638239 ATTAATAAAAAAAACCAGAAAGG - Intergenic
1197632753 X:128881042-128881064 ATCTATCAAAATAAGGAGGTTGG + Intergenic
1197969243 X:132097593-132097615 ATTTATACAAATAAACTCGAAGG - Intronic
1198265248 X:135002909-135002931 ATTTATTTAAAAAAGCAGGCTGG + Intergenic
1198398387 X:136245787-136245809 ATTTGTAAAAACAATCAGAATGG - Intronic
1200718534 Y:6577206-6577228 ATATATAAAAATAATTAAGAGGG - Intergenic
1200957433 Y:8965294-8965316 CCTTATAAAGAAAAGCAGGAAGG - Intergenic
1201350263 Y:13032339-13032361 ATTTAGAGAAACAAGCAGCAAGG + Intergenic
1201507597 Y:14720689-14720711 ATTTATGAAGATAAGCAAGGAGG - Intronic
1201514051 Y:14797595-14797617 ATTTATAAAAACAACTGGGAAGG - Intronic
1201629829 Y:16058808-16058830 ATTTGTAAAAAGAACAAGGAAGG + Intergenic
1202104893 Y:21353499-21353521 ACTTGTAAAGAAAAGCAGGAAGG + Intergenic
1202193337 Y:22268540-22268562 CCTTATAAAGAAAAGCAGGAAGG + Intergenic
1202231807 Y:22666344-22666366 ATACAGAAAAATAAGAAGGAAGG - Intergenic
1202311351 Y:23529821-23529843 ATACAGAAAAATAAGAAGGAAGG + Intergenic
1202559451 Y:26140773-26140795 ATACAGAAAAATAAGAAGGAAGG - Intergenic