ID: 976728849

View in Genome Browser
Species Human (GRCh38)
Location 4:88242843-88242865
Sequence CTTGTCTTTCTGGTATAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976728849_976728853 1 Left 976728849 4:88242843-88242865 CCTCCTTATACCAGAAAGACAAG No data
Right 976728853 4:88242867-88242889 AATCCTTATCACCAGAGACTGGG No data
976728849_976728852 0 Left 976728849 4:88242843-88242865 CCTCCTTATACCAGAAAGACAAG No data
Right 976728852 4:88242866-88242888 AAATCCTTATCACCAGAGACTGG No data
976728849_976728856 18 Left 976728849 4:88242843-88242865 CCTCCTTATACCAGAAAGACAAG No data
Right 976728856 4:88242884-88242906 ACTGGGAATCGACATTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976728849 Original CRISPR CTTGTCTTTCTGGTATAAGG AGG (reversed) Intergenic
No off target data available for this crispr