ID: 976729175

View in Genome Browser
Species Human (GRCh38)
Location 4:88245008-88245030
Sequence TGTCACATGGGACAGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976729175_976729181 -8 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729181 4:88245023-88245045 ATGTGACAGGAAGCAGTGGTGGG No data
976729175_976729184 -3 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729184 4:88245028-88245050 ACAGGAAGCAGTGGTGGGGTGGG No data
976729175_976729191 28 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729191 4:88245059-88245081 AGGAGCCCCGAGCTGAAGCAGGG No data
976729175_976729183 -4 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729183 4:88245027-88245049 GACAGGAAGCAGTGGTGGGGTGG No data
976729175_976729190 27 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729190 4:88245058-88245080 CAGGAGCCCCGAGCTGAAGCAGG No data
976729175_976729182 -7 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729182 4:88245024-88245046 TGTGACAGGAAGCAGTGGTGGGG No data
976729175_976729185 -2 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729185 4:88245029-88245051 CAGGAAGCAGTGGTGGGGTGGGG No data
976729175_976729186 8 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729186 4:88245039-88245061 TGGTGGGGTGGGGCCAGCCCAGG No data
976729175_976729180 -9 Left 976729175 4:88245008-88245030 CCAGGCAGCTGTCCCATGTGACA No data
Right 976729180 4:88245022-88245044 CATGTGACAGGAAGCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976729175 Original CRISPR TGTCACATGGGACAGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr