ID: 976732507

View in Genome Browser
Species Human (GRCh38)
Location 4:88278409-88278431
Sequence CTGGACTCCCACTACCATCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976732498_976732507 4 Left 976732498 4:88278382-88278404 CCCAGATCCCAAAATTGTCCCAG 0: 1
1: 0
2: 1
3: 18
4: 244
Right 976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 133
976732501_976732507 -3 Left 976732501 4:88278389-88278411 CCCAAAATTGTCCCAGGTAGCTG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 133
976732499_976732507 3 Left 976732499 4:88278383-88278405 CCAGATCCCAAAATTGTCCCAGG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 133
976732502_976732507 -4 Left 976732502 4:88278390-88278412 CCAAAATTGTCCCAGGTAGCTGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976732507 Original CRISPR CTGGACTCCCACTACCATCT GGG Exonic
903582300 1:24380698-24380720 ATGGACCCCCACTAGCATTTGGG + Intronic
905887960 1:41501869-41501891 CTGGACTGGCACTCCCAGCTGGG + Intergenic
905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG + Intergenic
911263718 1:95718346-95718368 CTGGACTCCCCTTCCCAGCTGGG - Intergenic
912443280 1:109714687-109714709 CTGGCCTCCCAATAGCCTCTGGG - Intronic
915474704 1:156146880-156146902 CTGGCCTCCCCCTGCCTTCTGGG + Intergenic
916918767 1:169439567-169439589 CAGGACTCACAGTAGCATCTCGG + Intronic
920741896 1:208588683-208588705 GTGGTCTCCCACTTCCATCCTGG + Intergenic
921989558 1:221349813-221349835 CTGGGCTCAGACTACCATCTGGG + Intergenic
922474892 1:225899898-225899920 CTGGGCTCCCACTGCCAGCCTGG + Intronic
1063526373 10:6790140-6790162 CTGGACTTCCAGGACCATGTAGG - Intergenic
1066706565 10:38185817-38185839 CTTGACTCCATCTACCCTCTTGG - Intergenic
1066982735 10:42434185-42434207 CTTGACTCCATCTACCCTCTTGG + Intergenic
1067371765 10:45690576-45690598 CTCGACTCCATCTACCCTCTTGG - Intergenic
1067388016 10:45835573-45835595 CTCGACTCCATCTACCCTCTTGG + Intronic
1067418105 10:46121707-46121729 CTCGACTCCATCTACCCTCTTGG - Intergenic
1067446249 10:46349028-46349050 CTCGACTCCATCTACCCTCTTGG - Intergenic
1067503464 10:46828270-46828292 CTCGACTCCATCTACCCTCTTGG - Intergenic
1067591129 10:47511743-47511765 CTCGACTCCATCTACCCTCTTGG + Intronic
1067638248 10:48019835-48019857 CTCGACTCCATCTACCCTCTTGG + Intergenic
1067875247 10:50000526-50000548 CTCGACTCCATCTACCCTCTTGG - Intronic
1068367447 10:56068795-56068817 AGGGATTCACACTACCATCTGGG + Intergenic
1069263270 10:66427337-66427359 ATGGACTCACAGTACTATCTTGG + Intronic
1070134852 10:73684261-73684283 CTCGACTCCATCTACCCTCTTGG + Intronic
1072799772 10:98384915-98384937 CTGGAGTCCCACTACCCTGTGGG - Intronic
1073911945 10:108356189-108356211 CTGGACTCCAACTGAAATCTCGG + Intergenic
1074619919 10:115107949-115107971 CTGGGCTGCCCCTCCCATCTAGG - Intronic
1075946597 10:126438836-126438858 CGGCACTCCCACTGCCATGTTGG - Intronic
1078087619 11:8243667-8243689 CTGGAGTACAAGTACCATCTGGG + Intronic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1084363182 11:68682557-68682579 CAGGGCTCCCACTACCACCGGGG + Intergenic
1085315341 11:75541484-75541506 CTGGGCTCCAGCTGCCATCTTGG + Intergenic
1089500383 11:118928545-118928567 CTGGACTCCTCCCACCTTCTCGG - Intronic
1091783208 12:3226955-3226977 CTGGCCTCTCTCTACCATCAAGG - Intronic
1092433589 12:8428351-8428373 CTGGATCTCCACTATCATCTTGG + Intergenic
1094308826 12:29054383-29054405 TGGAACTGCCACTACCATCTTGG + Intergenic
1096971554 12:55670487-55670509 CTGGCCTACCACTTCCATCTAGG + Intergenic
1102446787 12:113009209-113009231 CTGGAAACCCAATACCACCTTGG + Exonic
1104892584 12:132147628-132147650 CAGGCCTCCCACCACCAACTAGG - Exonic
1105930403 13:25047165-25047187 CTGTCCTACCACTTCCATCTCGG - Intergenic
1106257612 13:28035967-28035989 ATGGATACCCATTACCATCTTGG - Exonic
1107993764 13:45841178-45841200 CTGGACTCCCTGTCACATCTTGG + Intronic
1119028559 14:71173864-71173886 CTGGCCTCCCTCTCCCACCTGGG + Intergenic
1120233934 14:81869140-81869162 ATGGCCTCTCACTACCTTCTTGG - Intergenic
1121994668 14:98592998-98593020 CTGGCCTCCCACGCCCATCCCGG + Intergenic
1122310103 14:100788954-100788976 CTGGTCTCCCAGCACCATCACGG - Intergenic
1123016994 14:105380427-105380449 CTGGACTCCCCCCACCCTCAGGG + Intronic
1123017006 14:105380459-105380481 CTGGACTCCCCCCACCCTCAGGG + Intronic
1125452409 15:39823281-39823303 TTGGACTCTCACAATCATCTTGG + Intronic
1133843393 16:9430417-9430439 CTGGCCTTCCAGTACCTTCTGGG - Intergenic
1133923150 16:10172584-10172606 CTGCCCTCCCACTGCCATCCTGG - Intronic
1135907880 16:26530060-26530082 GTGCACTCCCAATGCCATCTTGG + Intergenic
1137744643 16:50811902-50811924 CTGGACTACCATTAGCATCAAGG + Intergenic
1140040178 16:71402271-71402293 CTGGGCTCCCAGCATCATCTGGG + Intergenic
1143010162 17:3861845-3861867 CTGGCCTCCACCTGCCATCTTGG + Intronic
1145097400 17:20042464-20042486 CTGGACTTCCACTCCCACCCAGG - Intronic
1146277385 17:31524259-31524281 GTGGATCCCCACTCCCATCTTGG - Intronic
1146453234 17:32991100-32991122 CTGCACACCCACCACCATCCTGG + Intronic
1147824831 17:43263734-43263756 CTGGTCTCCAACTCCCTTCTTGG + Intergenic
1149366515 17:55950856-55950878 CAGGACTTCCACTTCCAACTAGG - Intergenic
1150223187 17:63508602-63508624 CCTGTCTCTCACTACCATCTGGG + Intronic
1156182935 18:34626968-34626990 CTGGAGTCACATTACCAGCTGGG + Intronic
1157081007 18:44525168-44525190 CTGGATTCCCAGTTCCTTCTAGG - Intergenic
1160137379 18:76283960-76283982 CTGGACTCCAAATAGCATCAGGG - Intergenic
1162225111 19:9214580-9214602 CTGGATGCTCACTAGCATCTTGG + Exonic
1163539790 19:17901060-17901082 CTGTACTTCCATTTCCATCTAGG + Intergenic
1165760558 19:38319027-38319049 CTGGACTCCCAGGGCCCTCTAGG + Intergenic
1165785005 19:38456316-38456338 CTGCACTCCCACTCCAGTCTGGG - Intronic
1167138979 19:47636467-47636489 CTGTAATCCCAGTACCACCTTGG - Intronic
925214333 2:2081360-2081382 CTGGACTCCTACTTCCCTCTTGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927518821 2:23687319-23687341 CTAGACTCCCACCACCAGCCTGG + Intronic
928134037 2:28674709-28674731 CTGGCCCCCAACTACAATCTCGG - Intergenic
928249660 2:29664420-29664442 TTGTACTCCCACTTCCATTTGGG + Intronic
932290247 2:70570980-70571002 CTTGATTCCCACTTCCACCTAGG - Intergenic
937425048 2:121791749-121791771 CTGAACTCCCACTACAAAATGGG - Intergenic
937619310 2:123967337-123967359 GTGGACTCCCACAACCAGCCTGG - Intergenic
938193610 2:129304703-129304725 CTGGAATTCCACTCCCACCTGGG + Intergenic
938370677 2:130766531-130766553 CTGCACTCCCATTCCCACCTGGG - Exonic
940018967 2:149136473-149136495 CTGGTGACCCACTGCCATCTGGG - Intronic
940086976 2:149871162-149871184 CTGGAGTCCCACTAACACATGGG + Intergenic
941043761 2:160649936-160649958 CTTGGCTCCCTCTACCAGCTTGG - Intergenic
943020695 2:182569788-182569810 CTAGATTCCCATTAACATCTTGG + Intergenic
943884701 2:193201255-193201277 CTGGACTCCCAAAACTCTCTCGG - Intergenic
948619473 2:239225483-239225505 CTGGACTCCCACCACCTGCAGGG + Intronic
1172610626 20:36248918-36248940 CTGGACTCTCACTGCCAACATGG - Intronic
1173596367 20:44261049-44261071 CTGGACTCCCAGTGCCTTCTAGG - Intronic
1176204650 20:63881700-63881722 ATGGGCTCCCAGGACCATCTTGG - Intronic
1177261171 21:18732267-18732289 CTTTACTCCCACCACCATATAGG + Intergenic
1177699305 21:24615504-24615526 CTGTACCCCCATTAGCATCTGGG + Intergenic
1183579668 22:38716410-38716432 CTTAACTCCCACTAGCTTCTGGG - Intronic
1183778540 22:39983789-39983811 CTTTACTCCCACTTCCTTCTCGG + Intergenic
957736335 3:84208510-84208532 CTGGACTCCAACCACTATATTGG - Intergenic
960203169 3:114862669-114862691 CTGAACCCTCACTACCATCCAGG - Intronic
960333990 3:116393533-116393555 CTTGACTCACACTACCAGCCTGG - Intronic
964269859 3:154944356-154944378 CTGGACTCCGAGTACCCACTGGG - Intergenic
967789735 3:193534180-193534202 CTGGACTTCCACCAACAACTGGG + Intronic
968890391 4:3365609-3365631 CTGGCCTCCCACTCACCTCTGGG + Intronic
969182890 4:5455625-5455647 CTGGGATCCCACTGCCACCTTGG - Intronic
970665395 4:18330655-18330677 CTGGGTTCCAACTGCCATCTGGG + Intergenic
976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG + Exonic
977691642 4:99918585-99918607 CTGGACTTCCACTCCCACTTAGG - Intronic
977912785 4:102557382-102557404 CTGGGCTCCCATGACCATCTGGG - Intronic
982107547 4:152024045-152024067 CTGTGCTCCCACTGCCATTTTGG - Intergenic
983059756 4:163144558-163144580 CTCTACTCCCACTACTATTTTGG + Intronic
997457831 5:134030638-134030660 CTGGACTCCAGCTTCCAGCTTGG - Intergenic
997656796 5:135561215-135561237 CTGGTTTCCAACCACCATCTGGG - Intergenic
997684206 5:135777362-135777384 CTGTACTCCCCCTACAATATTGG - Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1003173175 6:3736145-3736167 CTGGTCTCCCAATTCCTTCTGGG + Intronic
1007092569 6:39193388-39193410 GTGGCCTCCCACTGCCCTCTGGG + Intronic
1008517781 6:52334477-52334499 CTGGACCCCCACTACCACAAAGG + Intergenic
1009368669 6:62875902-62875924 CTGTACACCCTCTACGATCTAGG - Intergenic
1009435539 6:63614271-63614293 CTGCACTCCCACTCCCACCTGGG - Intergenic
1009584080 6:65574042-65574064 AGGGACTCCCACTGCCATGTTGG - Intronic
1012155379 6:95813210-95813232 CTGGACTTCCACTCCCATTGAGG - Intergenic
1013054526 6:106570658-106570680 TTTTACTCCCACTACCACCTGGG + Intergenic
1013978162 6:116100613-116100635 CTGGACCCCTACTGCCTTCTGGG + Intergenic
1014526982 6:122512538-122512560 CTGGACTCTCTGGACCATCTTGG + Intronic
1020094312 7:5359917-5359939 CTGAACTCCCCCTGCCATCCTGG - Intronic
1028953703 7:96665307-96665329 CTGAAATCCCACTAACATATAGG - Intronic
1030349608 7:108469128-108469150 CTGGGCTCTCTCTACCCTCTAGG + Intergenic
1033418063 7:141181909-141181931 CTGGAGTCCACCTACCAGCTTGG + Intronic
1039235882 8:35502385-35502407 CAGGACTGCCATTACCATCCTGG + Intronic
1039369309 8:36968665-36968687 ATGGACTCCCAGTTCCCTCTTGG - Intergenic
1042816445 8:72882617-72882639 CTGGAATCCCACGACCGACTGGG - Intronic
1049757095 8:144315577-144315599 CTGACCTCCCGCTACCATCAAGG + Exonic
1055212137 9:73808997-73809019 TTATACTCCCACTACCATATTGG - Intergenic
1056911594 9:90706140-90706162 CTGGACTCCCAGACCCCTCTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1187174502 X:16883890-16883912 CTGATCTCGCACAACCATCTCGG + Intergenic
1198086218 X:133285203-133285225 GTGGACTTCCACTGCCATTTCGG - Intergenic
1198224505 X:134632791-134632813 CTGGGCTCCCACAACCCCCTGGG - Intronic