ID: 976734572

View in Genome Browser
Species Human (GRCh38)
Location 4:88296771-88296793
Sequence CCTGGGTCCACAGCCCGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976734565_976734572 -4 Left 976734565 4:88296752-88296774 CCCCAAGAGTGCAGGGATGCCTG 0: 30
1: 96
2: 142
3: 192
4: 410
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data
976734564_976734572 -3 Left 976734564 4:88296751-88296773 CCCCCAAGAGTGCAGGGATGCCT 0: 28
1: 66
2: 123
3: 210
4: 1026
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data
976734560_976734572 7 Left 976734560 4:88296741-88296763 CCTTCCAGGGCCCCCAAGAGTGC No data
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data
976734568_976734572 -6 Left 976734568 4:88296754-88296776 CCAAGAGTGCAGGGATGCCTGGG 0: 24
1: 92
2: 139
3: 195
4: 1227
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data
976734566_976734572 -5 Left 976734566 4:88296753-88296775 CCCAAGAGTGCAGGGATGCCTGG No data
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data
976734557_976734572 26 Left 976734557 4:88296722-88296744 CCTGTGAGGGCAAGGGTGGCCTT No data
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data
976734562_976734572 3 Left 976734562 4:88296745-88296767 CCAGGGCCCCCAAGAGTGCAGGG 0: 19
1: 62
2: 128
3: 678
4: 15236
Right 976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976734572 Original CRISPR CCTGGGTCCACAGCCCGTTT GGG Intergenic
No off target data available for this crispr