ID: 976749373

View in Genome Browser
Species Human (GRCh38)
Location 4:88438829-88438851
Sequence GATATTTACCAGCACACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 14, 3: 61, 4: 242}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976749371_976749373 5 Left 976749371 4:88438801-88438823 CCACTCCTTTTCAGAGAGCTGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749365_976749373 14 Left 976749365 4:88438792-88438814 CCTCCCCTCCCACTCCTTTTCAG 0: 1
1: 0
2: 2
3: 74
4: 771
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749369_976749373 6 Left 976749369 4:88438800-88438822 CCCACTCCTTTTCAGAGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 189
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749364_976749373 15 Left 976749364 4:88438791-88438813 CCCTCCCCTCCCACTCCTTTTCA 0: 1
1: 0
2: 9
3: 182
4: 2556
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749363_976749373 16 Left 976749363 4:88438790-88438812 CCCCTCCCCTCCCACTCCTTTTC 0: 1
1: 1
2: 36
3: 455
4: 2997
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749372_976749373 0 Left 976749372 4:88438806-88438828 CCTTTTCAGAGAGCTGGTTGTTA 0: 2
1: 0
2: 8
3: 51
4: 2457
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749366_976749373 11 Left 976749366 4:88438795-88438817 CCCCTCCCACTCCTTTTCAGAGA 0: 1
1: 1
2: 1
3: 41
4: 369
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749368_976749373 9 Left 976749368 4:88438797-88438819 CCTCCCACTCCTTTTCAGAGAGC 0: 1
1: 1
2: 0
3: 21
4: 237
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242
976749367_976749373 10 Left 976749367 4:88438796-88438818 CCCTCCCACTCCTTTTCAGAGAG 0: 1
1: 0
2: 1
3: 42
4: 276
Right 976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG 0: 1
1: 1
2: 14
3: 61
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976749373 Original CRISPR GATATTTACCAGCACACCAA TGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902195410 1:14794480-14794502 AACACTTACCAGCACACCACTGG - Intronic
902405125 1:16178559-16178581 AACATTTACCAGCTCACCACTGG + Intergenic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
902992532 1:20199129-20199151 GATATTGACTAGCACAACAGTGG + Intergenic
903198304 1:21711063-21711085 GATGTGAACCACCACACCAAAGG + Intronic
904830407 1:33302838-33302860 GACTTATACCAGCACACCACCGG + Intergenic
905187251 1:36205337-36205359 AACATTCACCAGCACACCACTGG - Intergenic
907134159 1:52123277-52123299 AACATTTACCAGCACGCCACTGG - Intergenic
907289635 1:53405030-53405052 GGTCCTCACCAGCACACCAAAGG - Intergenic
907543250 1:55235752-55235774 AACATTCACCAGCACACCACTGG + Intergenic
907777439 1:57531717-57531739 AAATTTTACCAGCACACCATTGG - Intronic
908858284 1:68453736-68453758 GATCTTTAACTTCACACCAATGG - Intergenic
908987736 1:70045243-70045265 GAAAGTTACCAGCACTCCACTGG - Intronic
909555694 1:76951314-76951336 AATATTTACCAGCACAACACTGG - Intronic
910649242 1:89547266-89547288 AATATTTACCAGCATGCCACTGG + Intronic
911062969 1:93763731-93763753 AATATTTACTGGCACACCAGTGG - Intronic
911512066 1:98819128-98819150 GAAATTTGCCAGTTCACCAAAGG + Intergenic
911792812 1:102040031-102040053 GAAATTTACCAGGACTCAAAAGG + Intergenic
913182685 1:116337258-116337280 GATCCTAAACAGCACACCAAAGG + Intergenic
913190917 1:116412351-116412373 AACATTAACCAGCACACCACTGG + Intergenic
914689876 1:150016358-150016380 AATATTTACTAGCACACCACTGG - Intergenic
916341970 1:163746128-163746150 AATATTTACCAGCACACCACTGG - Intergenic
916521140 1:165564453-165564475 AATATTTAGCAGCACAACCAAGG + Intergenic
916769735 1:167896462-167896484 GGTCCTTACCAGCACACAAAGGG - Intronic
917301564 1:173580018-173580040 AACATTTACCAGCACATCACTGG - Intronic
917308874 1:173656492-173656514 TACATTTACCAGCACACTACTGG - Intronic
917479320 1:175397423-175397445 GGTATTTAACAGCACACCACTGG + Intronic
917602464 1:176590446-176590468 AATATTTACTAGCATACCACTGG + Intronic
917960128 1:180135822-180135844 AACATTTTCCAGCACACCATTGG + Intergenic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
918423817 1:184388069-184388091 GACATTAACCAGCAGACCAAAGG - Intronic
920700045 1:208210977-208210999 AATATTTACCAGCACGTCACTGG + Intronic
920700260 1:208212692-208212714 AATATTTACCAGCACACCACTGG + Intronic
921081727 1:211744759-211744781 AACATTTACCAGCACACCACTGG + Exonic
921245036 1:213229364-213229386 AACATTTACCAGCCCACCACTGG - Intronic
921975468 1:221198203-221198225 AATATTTACCAGCCCAACACTGG + Intergenic
922058182 1:222062123-222062145 AATATTTACCAGCACACCACTGG - Intergenic
1063992280 10:11579022-11579044 AACATTTACCAGCACAACACTGG + Intronic
1064104456 10:12489522-12489544 AACATTTACCAGCACACCACTGG - Intronic
1064270396 10:13859988-13860010 AATATTCACCAGCACCCCACTGG - Intronic
1065763770 10:29007877-29007899 AACATTTACCAGCACCCCACTGG - Intergenic
1066813680 10:39373763-39373785 GATATTTATTTGCACACCATAGG + Intergenic
1067773184 10:49142106-49142128 AATATTTACCATCACACTACTGG + Intergenic
1068101981 10:52566705-52566727 AACATTTACCAGCACTCCACTGG + Intergenic
1068729859 10:60345006-60345028 GACATTTACTAGCAAACCCATGG - Intronic
1068915689 10:62428828-62428850 AATATTTACTAGCATACCACTGG - Intronic
1069295271 10:66836027-66836049 AACATTCACCAGCACACCAGTGG - Intronic
1069396681 10:67997215-67997237 GGTATTTATCAGTAAACCAAGGG - Intronic
1070766587 10:79060137-79060159 AACATTTACCAGCACACCACTGG + Intergenic
1071007515 10:80899896-80899918 TTTATTTGCCAGCACACCACTGG - Intergenic
1071407124 10:85347497-85347519 GATACTTAGCAGCAAAACAAGGG + Intergenic
1073636903 10:105208378-105208400 AATATTTACAAGTACACCACTGG - Intronic
1073644132 10:105282246-105282268 AAGATTTACCAGCACATCACGGG - Intergenic
1074613968 10:115047909-115047931 AAAATTTACCAACACACCACTGG + Intergenic
1075042885 10:119122617-119122639 GATATTTAGCAGGGCACCAGGGG + Intronic
1075113656 10:119608289-119608311 GAAATTAAGAAGCACACCAAAGG + Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1078120617 11:8505103-8505125 AATATTTACCAACACACCACTGG + Intronic
1080357197 11:31463298-31463320 GAAATTTACCATCAGGCCAATGG - Exonic
1081909840 11:46693912-46693934 GCCATTTACCAGCACACCACTGG + Intronic
1082796019 11:57378344-57378366 AACATTTACCAGCATACCACTGG - Intronic
1083224787 11:61278052-61278074 AATATTTGCCAGCACAATAAAGG - Intronic
1085206431 11:74735635-74735657 AACATTTACCAGCACACCACTGG - Intergenic
1085410871 11:76289595-76289617 TACATTTACCAGCACACCACTGG - Intergenic
1085667098 11:78423670-78423692 AATATTTGCCAGCACATCATTGG - Intergenic
1085746156 11:79116013-79116035 CAAATTTATCAGCACCCCAATGG + Intronic
1087180388 11:95136058-95136080 AACATTTACCAGCATACCACTGG - Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1087546146 11:99586276-99586298 GAGATTTATCATCTCACCAATGG - Intronic
1090823476 11:130366156-130366178 GTTATTTACCAACACACCACTGG + Intergenic
1092027204 12:5251631-5251653 AATATTTACCAGCCCACCACTGG + Intergenic
1093393313 12:18650116-18650138 GATATTTATCAGCAATTCAAGGG - Intergenic
1093552222 12:20427319-20427341 GATTTGTACCAGTACACTAAGGG + Intronic
1094031636 12:26018709-26018731 GATAATTACCTGCCCACCACAGG + Intronic
1094050516 12:26215631-26215653 GACATTTACCATCACACCACTGG + Intronic
1095076237 12:37930128-37930150 GATATTTAGGAGCACACAGAGGG - Intergenic
1097857589 12:64481752-64481774 AGTATTTACCAGCAAATCAAAGG - Intronic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1097987402 12:65798459-65798481 GATATTTGCAAGCACACCATGGG - Intergenic
1098802824 12:74984173-74984195 AACATTAACCAGCACACCATTGG + Intergenic
1099418771 12:82426564-82426586 ACTATTTACCACCACAACAAAGG - Intronic
1099452106 12:82820323-82820345 AATATTAACCATCACACTAAGGG + Intronic
1100163468 12:91889478-91889500 GAATATTAACAGCACACCAAGGG + Intergenic
1100212529 12:92412119-92412141 TACATTTACAAGAACACCAAGGG - Intergenic
1101510425 12:105388042-105388064 AACATTTACCTGCACACCACCGG + Intronic
1103236255 12:119375226-119375248 AACATTTACCAGCACATCAATGG - Intronic
1103243288 12:119433170-119433192 AACATTCACCAGCACACCACGGG + Intronic
1103594810 12:122018182-122018204 AACATTTACCAGCATACCATTGG - Intergenic
1104564874 12:129871758-129871780 AACATGTACCAGCACACCATGGG + Intronic
1107331718 13:39308502-39308524 AACATTTACCAGCACTCCACTGG + Intergenic
1109367443 13:61373947-61373969 AACATTTACCAGCACACCATTGG + Intergenic
1109773916 13:67014790-67014812 GTTATTTACAAGCACAGAAATGG - Intronic
1111880097 13:93945100-93945122 AACATTTACCAGCACACCACTGG - Intronic
1112588554 13:100742547-100742569 AACATTTACTAGCACACCACTGG + Intergenic
1114184539 14:20390517-20390539 GATATTCAGCAGCACACCACTGG + Intronic
1114974812 14:28082215-28082237 GGTGTTTTCCAGCACACCGATGG - Intergenic
1116303933 14:43224266-43224288 GATATTTACCAAAACAAAAACGG + Intergenic
1118732724 14:68679885-68679907 AACATTTACCAGCACACTACTGG - Intronic
1121054878 14:90844357-90844379 GATATTTACTAAAACACCCAGGG + Intergenic
1122983103 14:105200364-105200386 AGTATTTCCCAGCCCACCAAGGG - Intergenic
1125877053 15:43158307-43158329 AATATTTACCAGCACATCAGTGG - Intronic
1127967885 15:63937369-63937391 GATATTTATCAGCATACCACTGG + Intronic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1133724409 16:8524007-8524029 AACATTCACCAGCACACCACTGG + Intergenic
1133941497 16:10312876-10312898 AACATTTACTAGCACACCACAGG + Intergenic
1137708705 16:50551909-50551931 GATATTGAACAGGACAGCAATGG + Intronic
1138408302 16:56816899-56816921 AACATTTACCAGCACACTATTGG + Intronic
1138464326 16:57176810-57176832 GACATTTACTGGGACACCAATGG - Intronic
1139238869 16:65369862-65369884 GATATTTTCCACTAGACCAAAGG + Intergenic
1139296291 16:65904346-65904368 GAGATTTCCCAGCAGACAAAAGG - Intergenic
1139874070 16:70131068-70131090 GATATTTACCAGCTAGTCAAAGG - Intronic
1140361707 16:74350071-74350093 GATATTTACCAGCTAGTCAAAGG + Intergenic
1140651658 16:77094733-77094755 GCCATTTTCCAGCACACCACTGG - Intergenic
1140835011 16:78785423-78785445 ATCATTTACCAGCACACCACTGG - Intronic
1143850796 17:9810385-9810407 AACATTTGCCAGCACACCACTGG + Intronic
1143955039 17:10661545-10661567 TATATTTTCCAGCCCATCAAGGG - Intergenic
1145030518 17:19501519-19501541 TATCTCTACCACCACACCAAAGG - Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1145894111 17:28442258-28442280 AATGTTTATCAGCACACCATTGG + Intergenic
1147401877 17:40185180-40185202 AATATTTACCAGTACACCACTGG - Intronic
1147550412 17:41437884-41437906 GATATTTACCAGGTCTCCACCGG - Intronic
1148442393 17:47718166-47718188 AACATTTGCCAGCACACCACTGG - Intergenic
1149283667 17:55136708-55136730 AATATTTACCATCACACTACTGG + Intronic
1149596903 17:57869575-57869597 AACATTCACCAGCACACCAGGGG + Intronic
1155141093 18:23045020-23045042 AGCATTTACCAGCACACCAGTGG - Intergenic
1155418111 18:25623226-25623248 CAAATTTAACAGCACACTAAAGG - Intergenic
1156759292 18:40568171-40568193 TATATTTACCAGCTCCTCAAGGG + Intergenic
1157295645 18:46440477-46440499 GATATGTTCCAGGACACCAGTGG - Intronic
1160232984 18:77062596-77062618 GATTTTTACCAGAACATGAAGGG + Intronic
1161841923 19:6687118-6687140 AACTTTTACCAGCACACCACGGG - Intronic
1161909821 19:7184849-7184871 AACATTTACAAGCTCACCAATGG - Intronic
1165242229 19:34478050-34478072 GACATTTACCAGCACACCACTGG + Intergenic
925546211 2:5019664-5019686 AACATTTACCAGCAAACCAGTGG - Intergenic
926086161 2:10021623-10021645 AACATTTACCTGCACACCACAGG - Intergenic
926599878 2:14830828-14830850 GACAGTTATCAGCACACCACTGG - Intergenic
927584986 2:24294641-24294663 GAGAATTACCAGGACCCCAAGGG + Intronic
929394181 2:41503205-41503227 AACATTTACCAACACACCACTGG + Intergenic
932355324 2:71063716-71063738 AACACTTACCAGCACACCACTGG - Intergenic
935820483 2:106887664-106887686 AGTATTTACCAGCAAACAAAGGG - Intergenic
938945071 2:136204965-136204987 TACATGTACCAGCACACCACTGG - Intergenic
941184609 2:162306018-162306040 TACATTCACCAGCACACCACAGG + Intronic
941214409 2:162687679-162687701 GATATTTATTAGCACACCACTGG + Intronic
941494619 2:166184294-166184316 TACATTTACCAGTACACCATTGG + Intergenic
941594437 2:167457515-167457537 TATATTTACAAGCAGATCAAAGG + Intergenic
943925733 2:193776845-193776867 AATACTTATCAGCACACTAAAGG + Intergenic
944492108 2:200268213-200268235 GATAATGACCAGGATACCAAGGG - Intergenic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
948778261 2:240301269-240301291 AACATTTACCAGCACACACAAGG + Intergenic
1170525783 20:17235820-17235842 GATGTTTACCATCTCACAAATGG - Intronic
1170592990 20:17785329-17785351 AATATTTACCAGCATACCACTGG + Intergenic
1170729198 20:18957639-18957661 AATATTTGCCAGCACACCACTGG - Intergenic
1173048378 20:39534955-39534977 AATGTTTACCAGAACACCACTGG + Intergenic
1173150643 20:40563802-40563824 GACATTTATCAGAACACCCAGGG + Intergenic
1174725197 20:52854267-52854289 TAAATGTACCAGCACACCACTGG + Intergenic
1174758809 20:53186299-53186321 AAGATTTACCAGCTCACCAGTGG + Intronic
1174770354 20:53293664-53293686 AAAATTTACCAGCACAGCACTGG - Intronic
1175088505 20:56482039-56482061 GAGACTGACCAGCAAACCAAAGG - Intronic
1179298298 21:40082730-40082752 AACATTTATCAGCACTCCAATGG - Intronic
1181025996 22:20128025-20128047 GATATTTTCCAGTACGCCATTGG + Intergenic
1183233100 22:36595478-36595500 AACATGTACCAGCACACCACTGG + Intronic
951053500 3:18121231-18121253 GATATTTACCACTAAACCACAGG - Intronic
951786813 3:26429647-26429669 AATATTTACCAGCCAAACAAGGG - Intergenic
952974927 3:38685708-38685730 AACACTTACCAGCACACCACTGG + Intergenic
953777994 3:45839628-45839650 AATATTTACCATCATACCACTGG - Intronic
955284818 3:57629924-57629946 AATATTTACCAGCACATTACTGG - Intronic
955367558 3:58324568-58324590 GATATTTTCCACCACATCACAGG - Intergenic
955532068 3:59884401-59884423 AATATTTACCAGCACACCACTGG + Intronic
955900733 3:63751224-63751246 GATATTTCCCAGCAAAGAAAAGG - Intergenic
956337981 3:68186151-68186173 GATATTCGCTAGCACACCAAAGG - Intronic
956446246 3:69329085-69329107 AACATTTACCAGCATACCAGTGG + Intronic
956691297 3:71880210-71880232 AACATTTACCAGCACACTATTGG + Intergenic
958468748 3:94492049-94492071 TTTCTTTAACAGCACACCAAAGG - Intergenic
959169464 3:102827772-102827794 AACATTTATCAGCACATCAAGGG + Intergenic
959867440 3:111287091-111287113 AACATTTACCAGCACAACACTGG + Intergenic
960594023 3:119391855-119391877 TATATTTTCCAGCACACAGATGG - Intronic
960722950 3:120642485-120642507 AATATTTACCAGCACACCACTGG - Intronic
960795029 3:121476436-121476458 TGTATTTACCTGAACACCAAAGG - Intronic
961411027 3:126720446-126720468 GAAATTTACCAGCACACGACTGG - Intronic
962146477 3:132845027-132845049 AATATTTACCGGCACACCACTGG + Intergenic
962457828 3:135581457-135581479 AACATTCACCAGCACACCACTGG + Intergenic
963273379 3:143307281-143307303 AACACTTACCAGCACACCACTGG + Intronic
963900583 3:150729020-150729042 AACATTTACCAGCACACCTCTGG - Intergenic
963989100 3:151632753-151632775 GATATTTTCCAGAACACAATTGG - Intergenic
964174432 3:153808747-153808769 CTTATTTACCAGCACACTACTGG + Intergenic
964941640 3:162164569-162164591 AACATTTACCAGCAGACCATTGG - Intergenic
965748362 3:171949700-171949722 AACATTTACCAGCACACCACTGG - Intergenic
966274389 3:178147268-178147290 AATGTTTACCAGCACATCATTGG + Intergenic
966515669 3:180818340-180818362 AATATTTACCAGCACACAACTGG + Intronic
967044059 3:185720220-185720242 AATATTTACCAGCATAGCACTGG - Intronic
967281453 3:187827772-187827794 AACATTTTCCAGCACACCAGTGG - Intergenic
967611851 3:191515632-191515654 TGTATTTTCCAGGACACCAAAGG - Intergenic
969179694 4:5428939-5428961 GACATTTACCAGCAAACCACTGG - Intronic
970035525 4:11730776-11730798 GACAGTCACCAGCACACCCATGG - Intergenic
970642257 4:18080155-18080177 AATATTGACCAGCATACCAATGG + Intergenic
972013865 4:34219472-34219494 TATATATACACGCACACCAATGG + Intergenic
973119840 4:46508591-46508613 AACATTTACCAGTACACCACTGG + Intergenic
974886414 4:67823462-67823484 GCTATTCACCAGCTTACCAAAGG - Intronic
976125086 4:81825743-81825765 AATATTTACCACCTCACCTAAGG + Intronic
976533574 4:86184961-86184983 AACATTTACCAGCACACCATTGG - Intronic
976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG + Intronic
977958411 4:103056569-103056591 AGCATTTACCAGCACACCATTGG - Intronic
978498178 4:109382380-109382402 AACATTTACCAGCACACCAGTGG + Intergenic
978798505 4:112732133-112732155 AACATCTACCAGCACACCACTGG + Intergenic
978819712 4:112951658-112951680 AATGTTTACTAGCACACCACTGG - Intronic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981015008 4:139964821-139964843 GCTATTTGCCAGCATACCACTGG - Intronic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982220483 4:153120969-153120991 AACATTTACCAGCACACCACTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
983253817 4:165376254-165376276 GACATTTACCAGCACACATCAGG + Intronic
983821688 4:172201775-172201797 GATAATTACCAGCACAATTAAGG - Intronic
987161946 5:15153929-15153951 GAGCTTTACCAGACCACCAAAGG - Intergenic
988268872 5:28988212-28988234 GATATTCCACAGTACACCAAGGG + Intergenic
989285398 5:39693141-39693163 GAGATTTACCATCACAATAAAGG - Intergenic
989452314 5:41601043-41601065 AGCATTTACCAGCACACCACTGG + Intergenic
989853818 5:46252642-46252664 GATATTTCCCTGCTCACCACAGG + Intergenic
989945199 5:50217312-50217334 GATATTTACTTTCACACCACAGG + Intergenic
990494826 5:56337043-56337065 AATATTTACCAGCACACCACTGG + Intergenic
990494849 5:56337198-56337220 AACATTTACCAGCACACCAATGG + Intergenic
990810665 5:59719166-59719188 AATATTTACCAGCATACCAATGG - Intronic
996205591 5:120731577-120731599 AAAATTTACCAGCACATCATTGG + Intergenic
996544673 5:124665326-124665348 AATACTTACTGGCACACCAATGG + Intronic
997093258 5:130881636-130881658 AATATTTGCCACCACACCACTGG + Intergenic
997131239 5:131278614-131278636 AATATTTATCAGCAGACCACTGG + Intronic
997595752 5:135106377-135106399 AACATTTACCAGCACGCCACTGG + Intronic
997890148 5:137668903-137668925 AACATTTACCAGCACACCACTGG + Intronic
997911159 5:137874930-137874952 GACATTTACCAGCACACCACTGG - Intronic
998414323 5:141934896-141934918 AACATTTACCAGCACACTACTGG + Intronic
1000304827 5:159985672-159985694 GCTATTTACCAGCACACCAAAGG + Intergenic
1002380764 5:178827827-178827849 AGCATTTACCAGCACACCACTGG + Intergenic
1003692965 6:8372908-8372930 GGTATTTACCAGCACACCACTGG - Intergenic
1004828927 6:19456047-19456069 AAAATTTACCAGCAAACCAAGGG + Intergenic
1006557517 6:34880859-34880881 GAAATTTACCAAAATACCAATGG + Intronic
1007120931 6:39380603-39380625 AACATTTGCCACCACACCAATGG - Intronic
1007483432 6:42164811-42164833 AACATTTACCAGCACACCACAGG + Intronic
1007611567 6:43152636-43152658 TATATTGACCAGCACAGAAATGG - Intronic
1009388706 6:63119346-63119368 GCTATTTGCCAGCACACTAATGG - Intergenic
1009860891 6:69330559-69330581 GATGTTTACCAGGACAACAGCGG - Exonic
1009948556 6:70368142-70368164 AACATTTGCCAGCACACCACTGG - Intergenic
1010072252 6:71757166-71757188 ATTATTTACCAGCACACCACTGG - Intergenic
1010840054 6:80638444-80638466 AACATTTACCAACACACCACTGG + Intergenic
1011026103 6:82871347-82871369 AACATTTACCAGCACACTACTGG - Intergenic
1011258356 6:85447027-85447049 AACATTTACCAGCACACCACTGG - Intergenic
1011361716 6:86532823-86532845 AATATATGCCAGCACACCACTGG - Intergenic
1011615687 6:89196358-89196380 AACATTTACTAGCATACCAATGG + Intronic
1014605545 6:123469579-123469601 GACATTTAGCAACACACAAATGG - Intronic
1015657292 6:135533138-135533160 GATACTACCCAGCACACCATAGG + Intergenic
1016209686 6:141515320-141515342 GATATTTACCAAAACACATATGG + Intergenic
1017330709 6:153195139-153195161 AACATTTACCAGCACACCACTGG - Intergenic
1017586454 6:155930788-155930810 AATATTTACCAGCATACCTCTGG - Intergenic
1020578284 7:9962430-9962452 CATTTTTTCCAGCACATCAAAGG + Intergenic
1020646011 7:10815167-10815189 GATATTTGCCAGCTCTCTAATGG + Intergenic
1020957924 7:14765844-14765866 AACATTTACCAGCACACTATTGG - Intronic
1020979235 7:15046908-15046930 GCTGCTTACCAGCAGACCAAAGG + Intergenic
1021606510 7:22414332-22414354 GATATTTACCAGTCCAGCACAGG - Intergenic
1023192886 7:37601747-37601769 GAAATTTCCCAGCATATCAAGGG - Intergenic
1024343310 7:48288669-48288691 AATATTTACCAGCCCAACACTGG + Intronic
1024819593 7:53311691-53311713 AATATTTACCAGCATAACAATGG + Intergenic
1025517849 7:61676415-61676437 GATATTTACTTTTACACCAAAGG + Intergenic
1025542174 7:62105063-62105085 GATATTTACTTTTACACCAAAGG + Intergenic
1028095345 7:86753787-86753809 AATATTTACCAGCACACCACTGG - Intronic
1029093012 7:98063230-98063252 AACATTTACCAGCACACCACTGG + Intergenic
1029336713 7:99906588-99906610 TAAATTTACCAGCAAACAAAGGG + Intronic
1029588499 7:101491341-101491363 AACACTTACCAGCACACCATTGG + Intronic
1030313934 7:108095007-108095029 AACATTTACCAGCTCACCACTGG - Intronic
1030979462 7:116169221-116169243 AATATTTACCACCACACTACTGG + Intergenic
1031028706 7:116711859-116711881 AACATTTACCAGCACATCACTGG - Intronic
1031084448 7:117288463-117288485 GATATTTACCAGTACAAAATAGG + Intronic
1031404259 7:121364950-121364972 AATAGTTAACAGCACACCACTGG - Intronic
1031772022 7:125855808-125855830 CATATCTACTAGCACACCAAAGG - Intergenic
1032088714 7:128898432-128898454 GACATTTTCCAGCACAGCTAGGG - Intronic
1036685435 8:10906274-10906296 AACATTTACCAGCACACCACCGG + Intronic
1037493136 8:19414189-19414211 AATATTTACCAGCACATCTCTGG + Intronic
1037552422 8:19987635-19987657 TGTATTTACCAGCACAACACTGG + Intergenic
1038376378 8:27044327-27044349 GATAGTGACCAGCAGACCTATGG + Intergenic
1038662960 8:29512960-29512982 AACATTTACCAGCATACCACTGG + Intergenic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1040580171 8:48691367-48691389 TACATTTACCAGCACACCACTGG - Intergenic
1041439600 8:57879961-57879983 GACATGTAGCAGCACAACAAAGG - Intergenic
1041849203 8:62369066-62369088 GAGATTTACCAGCACAGAAAAGG - Intronic
1042668351 8:71232435-71232457 GACATTTATCAGCACAACCAAGG + Intronic
1043885761 8:85598095-85598117 AACATTTACCAGCACACCACTGG - Intergenic
1044331415 8:90924327-90924349 GATATTTTCCACCAAAACAAAGG + Intronic
1044895624 8:96888448-96888470 GAAATTTATCATCACACTAATGG + Intronic
1044970791 8:97617377-97617399 AACATTTACCAGCACACCGCTGG - Intergenic
1045352321 8:101353058-101353080 AACATTTACCAGCACACAACTGG + Intergenic
1046969111 8:120201498-120201520 TACATTTACCAGCACACCCCTGG + Intronic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1047123538 8:121933191-121933213 AATATTTACCAGCACACCACTGG + Intergenic
1048372873 8:133794960-133794982 AACATTTACCATCACACCACTGG - Intergenic
1052749912 9:32479334-32479356 AATATTAACCAGCACAGCACTGG + Intronic
1055383092 9:75730525-75730547 GACATTTACCAGCACCCCGCCGG + Intergenic
1055492971 9:76825170-76825192 AACATTTACCAGCAGACCACTGG - Intronic
1055821427 9:80269224-80269246 AACATTTACCGGAACACCAATGG - Intergenic
1056721691 9:89077479-89077501 AACATTTACCAGCACACCACTGG + Intronic
1058754830 9:108074603-108074625 AATATTTACCAACAAACCATTGG + Intergenic
1059579205 9:115525409-115525431 AACATTTACCAGCATACCACTGG - Intergenic
1059661060 9:116400539-116400561 TATATTTACCAGTACAGCACTGG + Exonic
1059725109 9:117000758-117000780 AACATTTACCAGCACAACACTGG - Intronic
1059734176 9:117085301-117085323 AACAATTACCAGCACACCACTGG - Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1186100646 X:6152563-6152585 GATATTTATCAGGCCACAAAGGG + Intronic
1186777742 X:12882664-12882686 AACATTTACCATCACACCACTGG + Intronic
1187773925 X:22733400-22733422 AATATTTACCAGCACACCACTGG + Intergenic
1188589885 X:31820795-31820817 TACATCTACCAGCACACCACTGG - Intronic
1188912068 X:35861685-35861707 GAATGTTACTAGCACACCAAGGG - Intergenic
1189889545 X:45585044-45585066 AACATTTACCAGCATACCACTGG + Intergenic
1189969212 X:46400754-46400776 AACATTTACCAGCACACCACTGG - Intergenic
1190105560 X:47558611-47558633 AACATTTACCAGCACACCATTGG + Intergenic
1190479645 X:50863243-50863265 AATATTTACCAGCATACCATTGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1194872538 X:99150707-99150729 GATTTTTACCAGCAATGCAAAGG + Intergenic
1196114870 X:111988091-111988113 AACATTTACCAGAACACCACTGG + Intronic
1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG + Intergenic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1197714739 X:129698585-129698607 GACTTTTCCCAGCACATCAAAGG + Intergenic
1198119891 X:133581450-133581472 AATATTTACCAGCTCACCACTGG - Intronic
1199593042 X:149485760-149485782 GATCTTTCCCAGCAAACAAAGGG + Intronic