ID: 976749492

View in Genome Browser
Species Human (GRCh38)
Location 4:88439718-88439740
Sequence GTTGTATTGTGACCAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976749492 Original CRISPR GTTGTATTGTGACCAAAACC TGG (reversed) Intronic
904872887 1:33632603-33632625 GTTTTATTCTCACAAAAACCAGG - Intronic
905199074 1:36304225-36304247 GTTGTATTCTGCTCAAAAGCTGG - Exonic
905491610 1:38348663-38348685 CTTGGATTATCACCAAAACCAGG - Intergenic
907779493 1:57552862-57552884 GTTGTTTTGTGATAAAAATCTGG + Intronic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
909291661 1:73890666-73890688 GGTGTATTGTTACAAAAAACAGG - Intergenic
909291665 1:73890724-73890746 GGTGTATTGTTACAAAAAACAGG - Intergenic
911082232 1:93944542-93944564 GTTGTATAGTGATCAAATCAGGG + Intergenic
912672115 1:111639779-111639801 GTTGAATTGTCACCACAGCCAGG + Intronic
919486389 1:198153205-198153227 TTTGTATAGTGACCACAGCCAGG + Intergenic
921847387 1:219898536-219898558 CGTGTTTTGTGACCAAAACAGGG - Intronic
924051296 1:240082032-240082054 GTTGTATTGTTACCAGAAAGGGG + Intronic
1065846824 10:29751389-29751411 ATAGTACTATGACCAAAACCAGG - Intergenic
1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG + Intergenic
1071247235 10:83778312-83778334 GTTGTATTGTGATGAAATCAGGG - Intergenic
1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG + Intronic
1074848831 10:117422264-117422286 GTTGCATTGTGACCAACAGGAGG - Intergenic
1075290198 10:121222827-121222849 GTGGTAAACTGACCAAAACCAGG - Intergenic
1079547194 11:21646823-21646845 GTTGTAATGTGACAAAAAGTGGG - Intergenic
1079711897 11:23694366-23694388 TTAGTATTGTGACTAAGACCAGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1085953527 11:81362989-81363011 GTTTTAGTGTGACCATCACCTGG + Intergenic
1086273114 11:85092268-85092290 TTGGGATTATGACCAAAACCTGG - Intronic
1086566942 11:88238124-88238146 GTTTTCTTGTGACTAAAACACGG + Intergenic
1087424677 11:97971505-97971527 ATGGTATTGAGACCAAAATCTGG + Intergenic
1088526650 11:110763066-110763088 TTCTTATTGTGATCAAAACCTGG - Intergenic
1088770263 11:113028238-113028260 GTTGTATAATGACCAAATCAGGG - Intronic
1091922259 12:4314761-4314783 ATTACATTGTGACCAAAAGCTGG - Intergenic
1093722796 12:22463922-22463944 GTTTTATTATGATCAAAACTGGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1108373104 13:49790630-49790652 GTAATGTTGTGACCAATACCAGG + Intronic
1113758197 13:112828700-112828722 GTTCTGTCCTGACCAAAACCAGG + Intronic
1117918911 14:60707251-60707273 GTTGTAATGTGGCCAAAATCAGG + Intergenic
1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG + Intergenic
1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG + Intergenic
1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG + Intronic
1121102138 14:91257030-91257052 GTTGTTTTGTAAATAAAACCTGG + Intergenic
1121697582 14:95926361-95926383 GTTGTATTGTGATCAATACAGGG - Intergenic
1125362016 15:38874398-38874420 GGTGTATTTTGACTAAAACAGGG + Intergenic
1127596928 15:60494249-60494271 TTTGCATTGTGACCAAGGCCAGG + Intronic
1134368284 16:13599568-13599590 GTTGTTATGTGACAATAACCCGG + Intergenic
1137624024 16:49896131-49896153 GTTGCATTGTGAGAGAAACCAGG - Intergenic
1137811766 16:51359363-51359385 GCTGAATTGTGGCCATAACCTGG + Intergenic
1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG + Intronic
1150254529 17:63733332-63733354 ATTGTATTCTGACAAATACCAGG - Intronic
1152842390 17:82578520-82578542 GTTGTAATTTGATCAAACCCAGG - Intronic
1154072803 18:11168479-11168501 GTTGTATGATGACCAAATCTGGG + Intergenic
1159664505 18:71141799-71141821 GTTGGATTGTGACAAAGTCCAGG + Intergenic
1168630792 19:57954542-57954564 TTTGAATTGTGGGCAAAACCAGG + Intergenic
925819849 2:7789529-7789551 GTTGTATTCTCTCCAAAGCCAGG - Intergenic
926844666 2:17123237-17123259 GTAGTGTTGTAACCAAAAGCAGG + Intergenic
928586676 2:32766234-32766256 GTTGTATTATGATCAAATCAGGG + Intronic
941058669 2:160819159-160819181 GATTTATAATGACCAAAACCTGG - Intergenic
943820860 2:192319073-192319095 GTTGTATTTTGGTCAAAACAAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
1176519004 21:7811119-7811141 GATGTTTTGTGACCAGAAACAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178653032 21:34441132-34441154 GATGTTTTGTGACCAGAAACAGG + Intergenic
1183507137 22:38215446-38215468 GTTGTGTTGGGACCAAAACCTGG + Exonic
1183664289 22:39238440-39238462 GTGGTATTATTACCAAATCCGGG - Intronic
1183767241 22:39889750-39889772 GTTGTATTTTTACCAAAAAGAGG - Intronic
1185172587 22:49302431-49302453 GTTGTTTTGAGAATAAAACCAGG + Intergenic
953313075 3:41899275-41899297 GTAGTATAGTTAGCAAAACCTGG - Intronic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
967825303 3:193872794-193872816 TTTGTATTGTTCCAAAAACCAGG + Intergenic
968284088 3:197498142-197498164 GATGGAATGTGACCAAAGCCAGG + Intergenic
971615320 4:28781914-28781936 GTAGCATTGTGTCCAAAACAAGG - Intergenic
972666554 4:41170752-41170774 ATTGTACAGTTACCAAAACCAGG - Intronic
972831636 4:42820664-42820686 ATTGTTATGTGACCAAATCCTGG + Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
978683423 4:111411269-111411291 ATTGTCTTGATACCAAAACCTGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983136604 4:164091723-164091745 GTTGTATTGTGACTAAATACTGG + Intronic
984237432 4:177177183-177177205 GTTAAATTGTTAACAAAACCTGG + Intergenic
985829892 5:2220571-2220593 CTTGTATGGTGACCAAGCCCTGG + Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
991705148 5:69350411-69350433 GGTATATTGTGACCAGACCCCGG + Intergenic
1005127891 6:22469946-22469968 GTTGTCTTGATACCAAAACTTGG - Intergenic
1006035888 6:31211822-31211844 GATGTATTATAACCAAAATCTGG - Intergenic
1009588220 6:65634126-65634148 CCTGTATTGTGAACAACACCTGG + Intronic
1010292732 6:74157347-74157369 ACTGTATAGTGACCAAAAGCAGG + Intergenic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1011946491 6:92911023-92911045 GTAGGCTTGTGCCCAAAACCAGG + Intergenic
1013987697 6:116215587-116215609 GTTATATTTTGAATAAAACCAGG + Intronic
1015504682 6:133970879-133970901 GTTGTATAGTGATCAAATCAGGG + Intronic
1018545325 6:164929367-164929389 GTAGCATTGTGACTAAATCCTGG - Intergenic
1020845765 7:13280773-13280795 GTAGTATAGCGAGCAAAACCTGG + Intergenic
1023412286 7:39900167-39900189 GTTTTCTTGTGAACAAAATCTGG - Intergenic
1025743904 7:64226284-64226306 GTTGTATTGTGCCATATACCTGG - Intronic
1025751117 7:64294697-64294719 GTTGTATTGTGCCATATACCTGG - Intergenic
1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG + Intergenic
1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1038218090 8:25581453-25581475 GTTGTATTTTCACCAAATACGGG + Intergenic
1043781364 8:84339790-84339812 GTTGTCTTGTGAGCAGAACTAGG - Intronic
1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG + Exonic
1052025770 9:23571685-23571707 TTTGTCTCCTGACCAAAACCTGG - Intergenic
1052207708 9:25863423-25863445 GTTGTATAGTGAGGAAAACTTGG + Intergenic
1056481830 9:87013552-87013574 TTGGTATTGAGCCCAAAACCAGG + Intergenic
1186093724 X:6077785-6077807 TTTGGCTTATGACCAAAACCAGG + Intronic
1188891633 X:35618489-35618511 GTTGTATAATGATCAAAATCAGG - Intergenic
1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG + Intronic
1195434244 X:104824370-104824392 ATCATATTGTTACCAAAACCTGG - Intronic
1195548743 X:106142276-106142298 GTTATACTGATACCAAAACCTGG + Intergenic
1197553222 X:127920742-127920764 TATGTATTGATACCAAAACCTGG + Intergenic
1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG + Intronic