ID: 976751078

View in Genome Browser
Species Human (GRCh38)
Location 4:88451875-88451897
Sequence GGCGTCCACCAACAACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976751078_976751080 -2 Left 976751078 4:88451875-88451897 CCAGGTGGTTGTTGGTGGACGCC No data
Right 976751080 4:88451896-88451918 CCAAGAGCAGCTACCTCCACTGG No data
976751078_976751084 15 Left 976751078 4:88451875-88451897 CCAGGTGGTTGTTGGTGGACGCC No data
Right 976751084 4:88451913-88451935 CACTGGGAAAATAAAACCACTGG No data
976751078_976751085 16 Left 976751078 4:88451875-88451897 CCAGGTGGTTGTTGGTGGACGCC No data
Right 976751085 4:88451914-88451936 ACTGGGAAAATAAAACCACTGGG No data
976751078_976751081 -1 Left 976751078 4:88451875-88451897 CCAGGTGGTTGTTGGTGGACGCC No data
Right 976751081 4:88451897-88451919 CAAGAGCAGCTACCTCCACTGGG No data
976751078_976751086 17 Left 976751078 4:88451875-88451897 CCAGGTGGTTGTTGGTGGACGCC No data
Right 976751086 4:88451915-88451937 CTGGGAAAATAAAACCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976751078 Original CRISPR GGCGTCCACCAACAACCACC TGG (reversed) Intergenic
No off target data available for this crispr