ID: 976756628

View in Genome Browser
Species Human (GRCh38)
Location 4:88505336-88505358
Sequence GAGAATAAGGAGAGAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 603}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976756628_976756632 26 Left 976756628 4:88505336-88505358 CCTGGCTCTCTCTCCTTATTCTC 0: 1
1: 0
2: 3
3: 61
4: 603
Right 976756632 4:88505385-88505407 TTAACTCCATGACACCTCTTCGG 0: 1
1: 0
2: 0
3: 10
4: 128
976756628_976756633 27 Left 976756628 4:88505336-88505358 CCTGGCTCTCTCTCCTTATTCTC 0: 1
1: 0
2: 3
3: 61
4: 603
Right 976756633 4:88505386-88505408 TAACTCCATGACACCTCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
976756628_976756630 -3 Left 976756628 4:88505336-88505358 CCTGGCTCTCTCTCCTTATTCTC 0: 1
1: 0
2: 3
3: 61
4: 603
Right 976756630 4:88505356-88505378 CTCAAGCATAGCATTGACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 82
976756628_976756631 0 Left 976756628 4:88505336-88505358 CCTGGCTCTCTCTCCTTATTCTC 0: 1
1: 0
2: 3
3: 61
4: 603
Right 976756631 4:88505359-88505381 AAGCATAGCATTGACTCAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976756628 Original CRISPR GAGAATAAGGAGAGAGAGCC AGG (reversed) Intronic
900485903 1:2922662-2922684 GAGACTCAGGAGCCAGAGCCCGG + Intergenic
901612445 1:10509547-10509569 GAGAGGAAGGGGAGAGAACCAGG - Intronic
901653069 1:10754197-10754219 TAGAATAGGGAGTGAGAGGCAGG - Intronic
901749345 1:11396385-11396407 GAGAAAGAGGAGAGGGAGCTGGG + Intergenic
902112502 1:14094148-14094170 GAGAATGAGGAGTGAGAAACGGG + Intergenic
902541523 1:17158969-17158991 GGGAAGCAGCAGAGAGAGCCAGG - Intergenic
902733550 1:18385411-18385433 GACAGTAAGGAGAAAGAGACTGG + Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
904630125 1:31834763-31834785 GAGAATGAGAATCGAGAGCCTGG - Intergenic
905143021 1:35863940-35863962 GAGATTAAGGAACTAGAGCCGGG - Intergenic
907657524 1:56359480-56359502 GAGCAGGAGGAGAGAGAGACAGG - Intergenic
907716626 1:56932416-56932438 GAGAATATGGAGCCAGAGACTGG - Intronic
907816508 1:57923048-57923070 TAGAAAATGGAGAGAGAGACTGG + Intronic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908576951 1:65470049-65470071 GAGGATAAGGAAAGCAAGCCAGG - Intronic
908578981 1:65493459-65493481 GAGAAAAAAGAGGGAAAGCCTGG - Intronic
909273495 1:73654701-73654723 GAGGAGAGGGAGAGAGAGCAGGG - Intergenic
910178288 1:84454511-84454533 CAGAAAAAAGAGAGACAGCCTGG + Intergenic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
911092601 1:94029734-94029756 GAGAATAAGAAGAAAGGGCCTGG - Intronic
911550642 1:99275564-99275586 GAATATAGGGAGACAGAGCCTGG + Intronic
911758539 1:101589209-101589231 GAGAATGAGGAGTGAGAAACAGG - Intergenic
912253284 1:108032876-108032898 GACAATAGGGAGTGAGAGGCAGG - Intergenic
912500649 1:110119961-110119983 GAGCACAGGGAGAGTGAGCCAGG - Intergenic
914360226 1:146928913-146928935 GAGTTTCAGGGGAGAGAGCCAGG + Intergenic
914493522 1:148170984-148171006 GAGTTTCAGGGGAGAGAGCCAGG - Intergenic
914796916 1:150927560-150927582 GAGAATAGGGAGGGAGAACATGG + Intronic
914916318 1:151821407-151821429 GAGAAAAAGGAGAGAGAAAGAGG - Intronic
915148410 1:153809458-153809480 AAGAATGAGGGGAAAGAGCCTGG - Exonic
915535240 1:156531361-156531383 GGATATAAGGAGAGAGAGCGAGG + Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915901005 1:159846802-159846824 GAGGACAAGGAGAGAGAGGTAGG + Intronic
915962523 1:160279079-160279101 GAGAATGGGGAGAAACAGCCTGG - Exonic
917063525 1:171066758-171066780 GAGAAAGAGGAGAGAGAACCAGG - Intergenic
917067439 1:171112153-171112175 GAGAATGAGGGGAGAATGCCAGG + Intronic
919035436 1:192301837-192301859 GACAATAAGAAGAGAGAAACTGG + Intergenic
920076791 1:203342979-203343001 GAAATTAAAGAGAGAAAGCCTGG + Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920281077 1:204844101-204844123 TAGAATATGGAGCAAGAGCCAGG + Intronic
920400828 1:205675388-205675410 GAGAATAAGGGGTAAGAGACAGG + Intronic
920969998 1:210734986-210735008 GAGAATGAGGCTAGAGAGTCAGG - Intronic
921508347 1:216002352-216002374 GAGAACAATGAGAGAGAGAAAGG - Intronic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
923942819 1:238846978-238847000 GAGAGAAAGGAGAGAGATCATGG + Intergenic
924224506 1:241909781-241909803 GAGAGAAAGAAGAGAGAGACAGG - Intergenic
924312714 1:242761854-242761876 GAAAATAAGCAAAGTGAGCCAGG + Intergenic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924732926 1:246728644-246728666 AAGAACAAGGAAAGAGAGACGGG - Intronic
924758861 1:246966094-246966116 AAGAATAAGGGCAAAGAGCCTGG + Intronic
1063154752 10:3368934-3368956 GAGAGTAGGGAGCGAGAGACAGG + Intergenic
1063417112 10:5882678-5882700 CAGTATAAGAACAGAGAGCCAGG + Intronic
1064306763 10:14174280-14174302 GAGAGGGAGGAGAGAGAGCGCGG - Intronic
1064587817 10:16856431-16856453 CATAATAAGGAGTGAGATCCAGG + Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1064911748 10:20409599-20409621 GAGAAAAATGAGGGAGAGCTTGG - Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1067385412 10:45813925-45813947 GAGAAGAAAGAGAGAGGGCCAGG + Intergenic
1067449734 10:46375021-46375043 GAGAAGAAAGAGAGAGGGCCAGG - Intergenic
1067634763 10:47993843-47993865 GAGAAGAAAGAGAGAGGGTCAGG + Intergenic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1069100035 10:64308875-64308897 GAGAAGAATGAGACAGAACCTGG + Intergenic
1069837683 10:71319462-71319484 GAGAGCAAGGAGAGAGAGGAGGG - Intronic
1070131690 10:73660281-73660303 GAGAAGAAAGAGAGAGGGCCAGG + Intronic
1070223513 10:74475809-74475831 GAGAAAAAGGAGGGAGAGGGAGG + Intronic
1071423687 10:85527359-85527381 GAGAAAAGGGTGAGAGAGACAGG + Intergenic
1071610352 10:87026187-87026209 GAGAAGAAAGAGAGAAGGCCAGG - Intergenic
1072204642 10:93192376-93192398 GAGGAGAAAGAGAGAGGGCCAGG + Intergenic
1073427882 10:103467110-103467132 GAGAATGAGGGGCGAGAGACAGG - Intergenic
1073972941 10:109065106-109065128 CATAGTAAGGAAAGAGAGCCAGG - Intergenic
1075490735 10:122866756-122866778 GAGAATAGGGAGAGAGATGAGGG - Intronic
1075557600 10:123444704-123444726 GAGGAAAAAGAGAGAGAGACAGG + Intergenic
1076138251 10:128059527-128059549 GAGACTAAGCAGAGAAAGCAGGG + Intronic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1076265363 10:129105537-129105559 GAGAAAAATAAGATAGAGCCAGG + Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076849441 10:133085949-133085971 TAGGTGAAGGAGAGAGAGCCAGG - Intronic
1077404136 11:2375256-2375278 GGGAAGCAGGAGACAGAGCCAGG - Intergenic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1077842566 11:5991419-5991441 GAGATTAAAGAGAGAGGGACAGG + Intergenic
1078459436 11:11502467-11502489 GAAAACAGGTAGAGAGAGCCAGG + Intronic
1078667975 11:13341723-13341745 CAGAATAAGAGGAGAGAGCCTGG - Intronic
1079735545 11:23993479-23993501 GAGAGAAAGGAGAGAGAGAGTGG + Intergenic
1079936833 11:26627279-26627301 GAGAAGAAGAAGAGAGAACAGGG - Intronic
1080042517 11:27774108-27774130 GAGAGGAAGGAGAGAGAGAAAGG + Intergenic
1080140103 11:28907239-28907261 TAGAGAAATGAGAGAGAGCCTGG - Intergenic
1080466054 11:32498341-32498363 GAGAGACAGGAGAGAGAGACAGG + Intergenic
1081472579 11:43389685-43389707 GAGAATGAGGACAGAGACACAGG + Exonic
1081526984 11:43934111-43934133 GAGGAGAGGGAGAGAGAGACAGG - Intronic
1081877866 11:46422571-46422593 GAAAAGAATGAGAGGGAGCCAGG + Intronic
1082048936 11:47754216-47754238 AAAAAAAAGGAGAGACAGCCAGG + Intronic
1083605453 11:63975968-63975990 GAGAGGAAGGAGAGACAGCTGGG - Intronic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1085286853 11:75368351-75368373 GAGAAAAAAGAGCCAGAGCCGGG + Intergenic
1085722964 11:78929466-78929488 GACAAGAAGGAGAGAGGGCTAGG + Intronic
1085823195 11:79815086-79815108 GAGAAGGAGGAGAGAGAGAAAGG + Intergenic
1086070431 11:82793356-82793378 TAGAAGGAGGAGAGAGAGCATGG - Intergenic
1086187978 11:84042350-84042372 AACAATAATGAGAGAGATCCAGG - Intronic
1086407727 11:86513170-86513192 GATAAGAAGGAGAGAGAGGAGGG + Intronic
1086886456 11:92211552-92211574 GAGGATGAGGGGAGAGAGGCTGG + Intergenic
1087069786 11:94066560-94066582 GAAAAAAAAGAGAGAGAGACTGG + Intronic
1087313739 11:96581297-96581319 CAGAAAAGGGAGTGAGAGCCAGG + Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088694463 11:112355033-112355055 GAGAGTCAGGGGAGAGAGGCTGG + Intergenic
1089016998 11:115173452-115173474 GCGGAGAAGGAGAGAGAGCGCGG + Exonic
1089391471 11:118104829-118104851 GGGAAAAAGGAGAGAGGCCCAGG - Intronic
1089506989 11:118970187-118970209 GATTATAAAGACAGAGAGCCCGG + Intergenic
1089579915 11:119475197-119475219 GAGAAGCAGAATAGAGAGCCAGG - Intergenic
1089702327 11:120252970-120252992 GGGAAAAAGGAGGGGGAGCCTGG + Intronic
1089779675 11:120864669-120864691 GAGAATGAGGAAATAGAGCCTGG - Intronic
1089834735 11:121360017-121360039 GAGAAAATGGAGAGAAAGCTAGG - Intergenic
1090626846 11:128615569-128615591 GAGAAGCAGGAGGGAGAGCCAGG + Intergenic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1093166595 12:15810929-15810951 AAAAATAAGGAGAAATAGCCAGG - Intronic
1093245857 12:16735629-16735651 GAGAACAAGCTGAGAGAGCTGGG - Intergenic
1093400610 12:18742140-18742162 GAGAGAAAAGAGAGAGAGCGAGG - Intergenic
1093921350 12:24863272-24863294 GATAATATGTAGAGAGCGCCAGG + Intronic
1094283644 12:28768255-28768277 GAGAAAAAGGAGAAAGACACTGG + Intergenic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1095292649 12:40493184-40493206 AAGAATAAGGTGAGGGTGCCAGG + Intronic
1095550645 12:43434883-43434905 GGGAAAAAGGAAAGAGAGCTGGG - Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1096001792 12:48136180-48136202 AAGAATGAGGAGGGAGGGCCAGG - Intronic
1096419088 12:51440851-51440873 GAGAGTTAGGACACAGAGCCAGG - Intronic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1097180632 12:57169775-57169797 GAGACAGAGGAGAGAGGGCCTGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1098188585 12:67924303-67924325 GAGATTAAGGACCAAGAGCCAGG - Intergenic
1098220551 12:68265717-68265739 GAGAAGAAGGAGAGAGAAAAGGG - Intergenic
1098302176 12:69065890-69065912 GTAAATAAACAGAGAGAGCCTGG - Intergenic
1098460794 12:70731024-70731046 GAGAGGAAGGAGAGAGAGGAAGG + Intronic
1099464827 12:82970814-82970836 GAGAAAAAGGGAAGTGAGCCTGG - Intronic
1099690240 12:85942952-85942974 GAAAATAAGTAAAGATAGCCAGG + Intergenic
1099976616 12:89552114-89552136 GAGAACAAGGTGAGAGCCCCAGG + Intergenic
1101438293 12:104682927-104682949 GAGAAGAAGGACAGAGAGTCAGG - Intronic
1102517879 12:113462610-113462632 GAGAAGACGGAGAGCGAGCGAGG - Exonic
1102727318 12:115077197-115077219 GAGAACAAGGAGGGAGTGCATGG - Intergenic
1102774290 12:115505300-115505322 GAGAAAATGGAGAGAGAGCTGGG - Intergenic
1102776719 12:115526123-115526145 GAGAAAAAGAAGATAGAGACAGG - Intergenic
1103034680 12:117646954-117646976 GAGGAGAGGGAGAAAGAGCCAGG + Intronic
1104383958 12:128332755-128332777 GAGGAAAAGAAGGGAGAGCCAGG - Intronic
1104872196 12:132007899-132007921 TAGCTTAAGGAGAGAGAGGCAGG + Intronic
1105320841 13:19320095-19320117 GAAATTAAGGAGAGAGACCTGGG + Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1105717860 13:23085053-23085075 GAGAATGAGGAGCCAGAGACAGG - Intergenic
1106017793 13:25885449-25885471 CAAAAGAAGGAGAGAGGGCCAGG - Intronic
1106590418 13:31093732-31093754 GAGAAGAAGGAGAGAGGGCATGG - Intergenic
1106815372 13:33401669-33401691 GAGAAAATGGAGAGGGAGCTGGG - Intergenic
1106864645 13:33950019-33950041 GAGAGAAAGCAGAGAGAGACAGG - Intronic
1106948233 13:34852998-34853020 GAGATTCAGGAGAAACAGCCAGG - Intergenic
1107379941 13:39845813-39845835 AAGAAGAAGGGGAGAGGGCCAGG - Intergenic
1107908251 13:45081992-45082014 AAAAAAAAGGAGAGACAGCCGGG + Intergenic
1107977321 13:45702943-45702965 TAGAATAAGCAGAGATAGTCAGG + Intronic
1108579571 13:51817213-51817235 GAGAAAGAGGAGAGAGAGGAAGG + Intergenic
1109062055 13:57632374-57632396 CAGAATAAGGAGAGACCACCGGG + Exonic
1109149412 13:58825593-58825615 GTGCATTAGGAAAGAGAGCCAGG + Intergenic
1109189865 13:59311083-59311105 AAAAAAAAGGAGAGAGAGCATGG - Intergenic
1110464606 13:75786679-75786701 GAAAATAAGTAGAGAGAGGCCGG - Intronic
1110564146 13:76941008-76941030 GAGAATGAGGGGCGAGAGACAGG + Intergenic
1110627264 13:77665261-77665283 GAGAAAAAGAAGAGAAGGCCAGG - Intergenic
1110752196 13:79127797-79127819 GAGAAGAAGGGGAGAGAGATGGG + Intergenic
1111149803 13:84235417-84235439 GGGAAGAAGGAGGGAGAGCAAGG + Intergenic
1112019005 13:95355419-95355441 GAAAAAAAGGAAAGAGGGCCAGG - Intergenic
1112552438 13:100434273-100434295 GAGAATGAGGGGTGAGAGACAGG + Intronic
1114318151 14:21525662-21525684 GAAGACAAGGAGAGAGAGCGTGG + Intronic
1114515576 14:23297807-23297829 GAGATTGGGGAGAGTGAGCCAGG + Exonic
1115145241 14:30218739-30218761 GAGAATGAGGTGAGAGAGGTAGG - Intergenic
1115556094 14:34546235-34546257 GAGAAGAGAGAGAGAGAGACAGG - Intergenic
1115557814 14:34556846-34556868 GAGAAGAGAGAGAGAGAGACAGG + Intergenic
1116095784 14:40365035-40365057 GAGGATGAGGAGTGAGAGACAGG + Intergenic
1117389245 14:55247442-55247464 GAGATTAAAGAGAGAGAGAGAGG + Intergenic
1117450839 14:55848277-55848299 GAGAGGAAGGAGATAGAGACTGG - Intergenic
1118225023 14:63890560-63890582 GAGAATGAGGGGAGGGAGACAGG + Intronic
1119104298 14:71909603-71909625 GAGAGAAAGGAGAGAGAGGGGGG + Intergenic
1120095692 14:80385334-80385356 GAGAATGAGGAAAGAGGGTCAGG - Intronic
1120219407 14:81715278-81715300 AGGAGTAAGGAGTGAGAGCCTGG - Intergenic
1120306813 14:82781139-82781161 TAGAATAAGGAAGGAGAGGCCGG - Intergenic
1121347604 14:93147644-93147666 GCGAATAAAGAGAGAGAGAAGGG - Intergenic
1121432021 14:93894247-93894269 GAGAAAGAGGAGAGAGAGAAAGG - Intergenic
1121946369 14:98126614-98126636 GAGATAGAGGAGAGAGAGCAAGG + Intergenic
1122006211 14:98705950-98705972 GAGAATAAGCAGAAATGGCCGGG + Intergenic
1123142672 14:106095887-106095909 GAGAAAAAGAAGAGAGTGACAGG - Intergenic
1124387310 15:29220995-29221017 GTGAAGAGGGAGAGAGAGACAGG + Intronic
1124470371 15:29978930-29978952 GAGAAGAAAGAGAGAGAGAGAGG + Intergenic
1125349039 15:38748403-38748425 GAAAATTAGGGGAGAAAGCCAGG - Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125708934 15:41767757-41767779 AAGAATAGGGAGAGAGAGGATGG + Exonic
1126351592 15:47750225-47750247 GATATTGAGGAGAAAGAGCCTGG + Intronic
1126675453 15:51156366-51156388 GAGAACAGGGAGAGAGCCCCAGG - Intergenic
1126780419 15:52134830-52134852 GAGAATAAGGACAGAGAGCTGGG - Intronic
1127681338 15:61301674-61301696 GAAAATAAGGAGAGAAATCCTGG + Intergenic
1127800785 15:62475767-62475789 GGGATTAAGGAGAGAGAACTGGG + Intronic
1128825591 15:70713047-70713069 AAGAATAGGGAAGGAGAGCCGGG + Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129184800 15:73899536-73899558 GAGAGTAAGGAAGGAGATCCAGG + Intergenic
1129262799 15:74378181-74378203 AAGGGTAAGGAGAGAGTGCCAGG + Intergenic
1129444894 15:75610100-75610122 AAGAATGAGGGCAGAGAGCCGGG + Intronic
1129519769 15:76178287-76178309 GAGAAGAAGGTGAGAGAAGCTGG + Intronic
1130078374 15:80709691-80709713 GAGAACAATGAGGGAGAGGCCGG - Intronic
1130894957 15:88162830-88162852 GAGAATGAGGAGGGAAAGGCTGG - Intronic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131553098 15:93374740-93374762 GAGGATAAGGAGGCAGAGGCAGG + Intergenic
1131656037 15:94460262-94460284 GAGAATAGGAAGAGATAGCTGGG + Intronic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133076462 16:3284167-3284189 GAGGATATGCAGAGAGAGCTTGG + Exonic
1133258918 16:4536012-4536034 GAGGATGGAGAGAGAGAGCCAGG - Intronic
1133470344 16:6069100-6069122 GAGAAAAAGAAGGGAGAGGCCGG + Intronic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133743194 16:8667089-8667111 GAAAATCAGGAGACAGAGCCGGG - Intergenic
1133937638 16:10282082-10282104 GAAAATGAGGGGAGAGAGACAGG - Intergenic
1134228744 16:12412937-12412959 CAGGAAAGGGAGAGAGAGCCAGG - Intronic
1134475533 16:14570352-14570374 AAGAAAAAGGAAAGAGGGCCGGG + Intronic
1135001967 16:18784246-18784268 GAGAAAAAAGAGAGAGAGACAGG - Intronic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135912493 16:26574107-26574129 GGGAGGCAGGAGAGAGAGCCAGG + Intergenic
1135917732 16:26621255-26621277 GAGAAGAAGGAAAGAGGGACAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137767417 16:50988637-50988659 GTGAATAATGAGAGAGACGCAGG - Intergenic
1139204639 16:65015487-65015509 GAGAAAAAGCAGAGAGGGCAGGG + Intronic
1139365980 16:66433907-66433929 GTGGCTAAGGGGAGAGAGCCTGG - Intronic
1140155956 16:72426972-72426994 GAGAAAAAGGAGGGAGAGAGAGG + Intergenic
1140724446 16:77799368-77799390 GAGAAAGAGGAGAGAGAGGGAGG - Intronic
1142592171 17:1011042-1011064 GGGAACAGGGAGAGATAGCCTGG + Intronic
1142792039 17:2274484-2274506 GAGCAAAAGGAGAGAGAACAAGG + Intronic
1143198061 17:5091763-5091785 GAGAATAATGAGAGTGAGAGAGG + Exonic
1143406278 17:6679129-6679151 GAGGAATAGGAGAGATAGCCAGG + Intergenic
1143661513 17:8327237-8327259 GAGAACCAGGAGACACAGCCAGG - Intergenic
1143924786 17:10359970-10359992 AAGAAGAAGGAGACACAGCCAGG - Exonic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1145262192 17:21361064-21361086 GAGGATAAGGAGGGAGCCCCCGG + Intergenic
1145709120 17:26952574-26952596 GAGAAAAAGGAAAGAAAGCAAGG + Intergenic
1146278945 17:31532667-31532689 GAGAATGAAGACAGGGAGCCAGG - Exonic
1146682426 17:34817679-34817701 GGGAATAAGGAGAGGGTACCTGG + Intergenic
1147167054 17:38599132-38599154 GAGAGGAGGTAGAGAGAGCCTGG + Intronic
1147465931 17:40610877-40610899 GAGAAGAGGCAGAGAGAGCAGGG + Intergenic
1147609468 17:41793169-41793191 GTGAATAAGGAGGGGCAGCCTGG - Intergenic
1147801154 17:43089329-43089351 AAAAATTAGGAGAAAGAGCCTGG + Intronic
1148112776 17:45155748-45155770 GAGTTTTAGGAGAGAGAGCCAGG + Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148686404 17:49503491-49503513 GGGAATAAGGGGATAGAGCTGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148851673 17:50558682-50558704 GAAAATGAGGACAGAGAGGCTGG - Intergenic
1149493607 17:57102623-57102645 AAAAAAAAAGAGAGAGAGCCGGG - Intronic
1150143739 17:62751022-62751044 GAAAGAAAGGAGAGAGATCCCGG + Intronic
1150432768 17:65131681-65131703 GGGCAGGAGGAGAGAGAGCCAGG + Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151410819 17:73927221-73927243 AAGAAGAAGGAGAGAGGGACGGG + Intergenic
1151949350 17:77341348-77341370 GAGCAGAGGGAGAGAGAGCGGGG + Intronic
1152743448 17:82028632-82028654 GAGAAGATGCAGACAGAGCCTGG + Exonic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1154041381 18:10859526-10859548 GTGATGCAGGAGAGAGAGCCAGG - Intronic
1154099486 18:11456878-11456900 GAGATTAAGGGAAGAGACCCTGG - Intergenic
1154208715 18:12360614-12360636 GAGAATAAAGAGGGAGTGCCTGG - Intronic
1155381062 18:25223322-25223344 GAGAAGACTGAGACAGAGCCTGG - Intronic
1156286835 18:35705038-35705060 ACGAAGAAGGAGAGAGAGCCAGG - Intronic
1156472869 18:37388431-37388453 GAGAAGAAGGAGAGAGAAGGAGG - Intronic
1156487919 18:37478314-37478336 GATAATAAGCAGAGGGAACCTGG - Intronic
1156549291 18:37998633-37998655 AAGAATAAGGAGACATAGTCTGG + Intergenic
1157298582 18:46463267-46463289 GAGAAAAAGGAGAGAGAACAAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157470405 18:47983925-47983947 GAGAAAAAGGAGAGAGGGGGAGG - Intergenic
1157688542 18:49662410-49662432 GAAAAGAAGGTGAGAGAGGCTGG + Intergenic
1158123069 18:54071508-54071530 GAAAATAAGTAGAGTGAGCATGG + Intergenic
1158960240 18:62582203-62582225 GTGGTTAAGGAAAGAGAGCCTGG + Intronic
1158989763 18:62856373-62856395 GATAATAAGGAGACAGTGACTGG - Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1163359558 19:16837212-16837234 GAGAAGGGGGAGAGGGAGCCAGG + Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164518321 19:28955913-28955935 GAAAAAAAGGAGAGAGAGAACGG - Intergenic
1164788753 19:30958678-30958700 GGGAACAAGGAGAGAGACCGAGG + Intergenic
1164794294 19:31014024-31014046 GAGAAAGAGGAGGGAGAGTCTGG + Intergenic
1165044213 19:33091904-33091926 AAGACTGAGAAGAGAGAGCCTGG - Intronic
1165927762 19:39337559-39337581 GAGGCTAAGGAGAAAGATCCAGG - Intronic
1165940817 19:39413888-39413910 GGGGACAAGGAGAGAGAACCTGG - Intronic
1166184777 19:41132845-41132867 GAGAGAAAGGAGAGAGAGATGGG + Intergenic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166799628 19:45448549-45448571 GAAAAAAAGAAGAGAGAGGCTGG + Intronic
1166834381 19:45658264-45658286 AAAAAAAAGGAGAGAGAGACAGG - Intergenic
1166864864 19:45829691-45829713 CAGAATCAGGACAGAGAACCAGG + Intronic
1167129241 19:47573382-47573404 GAGAGTGAGAAGAGTGAGCCGGG + Intergenic
1167529179 19:50004299-50004321 GAGATTGAGGTGAGAGAGCAGGG - Intronic
1167995198 19:53396061-53396083 GAGATGAAGGACAGAGAGCAAGG + Intronic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
925904774 2:8534042-8534064 GAGGATGAGGAGGGAGACCCAGG + Intergenic
926042747 2:9687807-9687829 AAGTATAAAGATAGAGAGCCAGG + Intergenic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
927333187 2:21890355-21890377 GAGAGAAAGGAAAGTGAGCCAGG - Intergenic
927537044 2:23871532-23871554 AAGAAAAAGGAGACAGAGTCAGG - Intronic
927715287 2:25347966-25347988 GGGAAGAAAGAGAGAGAGCAGGG - Intergenic
928179506 2:29058081-29058103 GAGAACGGGGAGAGAGAGACGGG + Exonic
928275861 2:29899433-29899455 GAGTAGAAAGACAGAGAGCCTGG + Intronic
930511111 2:52346616-52346638 GAGAAAACGGGGAGGGAGCCAGG - Intergenic
931086316 2:58834691-58834713 GAGATTCAGGTGAGAGAGTCTGG + Intergenic
931205232 2:60140085-60140107 GAGAAAATGGAGGCAGAGCCAGG - Intergenic
931508875 2:62965878-62965900 GGAAATAGGGAAAGAGAGCCAGG - Intronic
931668366 2:64625903-64625925 GAGAGGAAGGAGAGAGAGGATGG + Intergenic
932600697 2:73123225-73123247 GGGTAGAAGGATAGAGAGCCAGG - Intronic
932781614 2:74562077-74562099 GAGAGTAAGAAGAGAAAGCAAGG - Intronic
934005679 2:87760910-87760932 GAGAAGAAAAAGAGAAAGCCAGG - Intronic
935639350 2:105276081-105276103 GAGAAGATGGAAACAGAGCCTGG - Intronic
936639740 2:114298609-114298631 GAGAATACAGAGAGAAAGCAGGG + Intergenic
937485239 2:122308704-122308726 GAGAATACAGAGAGAAAGGCAGG + Intergenic
937667370 2:124502266-124502288 GAGACTGAGGAAAGAGAGCCAGG + Intronic
939121461 2:138122807-138122829 GACAATATGGGAAGAGAGCCAGG + Intergenic
939467909 2:142581841-142581863 GTAAAAAAGGAGAGAGAGCCTGG - Intergenic
939708263 2:145481760-145481782 GAGAGGAAGGAGAGAAAGACAGG - Intergenic
939835127 2:147120602-147120624 AAGTATGTGGAGAGAGAGCCAGG + Intergenic
939984621 2:148817138-148817160 GTGGGAAAGGAGAGAGAGCCAGG - Intergenic
940169558 2:150813392-150813414 GAGGCTGAGGAGAGAAAGCCAGG + Intergenic
941736523 2:168982796-168982818 GAGAAGAGAGAGAGAGAGCAAGG + Intronic
941751325 2:169137847-169137869 AAGAATAAGGAGAGAGGGGAAGG + Intronic
942497301 2:176553239-176553261 GAGAAAATGGAGAGAGAGAGAGG - Intergenic
942778320 2:179611921-179611943 GAGAATAAGAAGGGAGAGAAAGG - Intronic
943158306 2:184213693-184213715 GAGAGAAAGGAGAGAGAGAGGGG + Intergenic
943733973 2:191333524-191333546 AAGAAAAGGAAGAGAGAGCCTGG - Intronic
944128562 2:196320817-196320839 GTGTAAAAGGGGAGAGAGCCTGG + Intronic
944813050 2:203346748-203346770 GAGAAATAGGAGAAAGAGCAGGG + Intronic
944896016 2:204165645-204165667 TAGAATCAGGAGAGTGGGCCTGG + Intergenic
945012887 2:205483590-205483612 GAGAAAAAGGAGAGAGGGGAGGG - Intronic
946090687 2:217220294-217220316 GAGAAAAAGGACACAGACCCAGG - Intergenic
946669672 2:222089362-222089384 CAGAGGATGGAGAGAGAGCCCGG - Intergenic
946743199 2:222820151-222820173 AAGAATAAGGACAGAGGGTCTGG - Intergenic
946770591 2:223084875-223084897 CTGAATAATGAGAGAGAGCCAGG - Intronic
947737204 2:232461933-232461955 AAAAATAAGGAGGGAGGGCCAGG + Intergenic
947747616 2:232517085-232517107 GAGAAGAAAGAGGGAGAGCCTGG + Intergenic
947830271 2:233134657-233134679 GAGAATAAGGAACCAGAGACTGG + Intronic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948147256 2:235716944-235716966 GAGAAAAAGGGGACAGTGCCAGG - Intronic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
948913051 2:241014956-241014978 GAGAAGCAGGAGGGAGAGCCCGG - Intronic
1168747925 20:259988-260010 GAGTATAAGGAGGGAGAGAAAGG + Exonic
1168756643 20:323168-323190 GAGAATAAAGAGTGAAATCCTGG + Intergenic
1169017139 20:2301184-2301206 GAGAGAAAGGAGAGAGAGATGGG + Intronic
1169293506 20:4372732-4372754 GAGAATGAGGGGTGAGAGACAGG - Intergenic
1170530024 20:17281818-17281840 GAGAATCAGGTGAGAGTGGCAGG - Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170873403 20:20229179-20229201 GAGCACATGGAGAGAGAGACTGG - Intronic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1172011113 20:31846468-31846490 GAGAGAGAGGAGAGAGAGGCAGG + Intergenic
1172161409 20:32871145-32871167 AAGAAGAAGTAGAGAGGGCCGGG - Intronic
1172288501 20:33758211-33758233 GAGAATAACTAGGGAGAGGCTGG + Intronic
1172418448 20:34791815-34791837 AAGAAGAAGGAGAGAGGGCAGGG + Intronic
1172605162 20:36209066-36209088 GAAACTAAGGAGGGAGATCCAGG - Intronic
1172657148 20:36544175-36544197 GAGAACAAGGAGTGGGACCCAGG + Intronic
1172798095 20:37557125-37557147 GAGATTTAGGAGAGAGGGACTGG + Intergenic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172972257 20:38882188-38882210 GAGAATGAGGAGTGGGATCCTGG + Intronic
1173497449 20:43529816-43529838 GTGAATAAGGAGGGAGCTCCAGG + Intronic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1174717719 20:52777685-52777707 TAGAAAATGGAGATAGAGCCAGG - Intergenic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1175692502 20:61075716-61075738 GAAAAAAAGCTGAGAGAGCCAGG + Intergenic
1176326775 21:5508299-5508321 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176400982 21:6312652-6312674 GAGACTAAGGAGAGAGAGTGGGG - Intergenic
1176436175 21:6676452-6676474 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176460437 21:7003522-7003544 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176483998 21:7385300-7385322 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1177342170 21:19817528-19817550 AAGAATAATGAGAGAGAAACAGG + Intergenic
1178473940 21:32919985-32920007 ATGAATAAGGAAACAGAGCCAGG - Intergenic
1178884411 21:36474033-36474055 GAGAATAGGGACAGAGGGACAGG + Intronic
1179071546 21:38076054-38076076 GAGAGAAAGGAGAGAGAGAGAGG + Intronic
1180683951 22:17650163-17650185 GAAAATAAGAAGAGTCAGCCGGG - Intronic
1180691083 22:17716406-17716428 GTGAATAAGGAGACAGCGCTTGG + Intronic
1181376864 22:22465625-22465647 GAGAGTCAGGAGAGAGACACAGG - Intergenic
1181879068 22:25963138-25963160 GAGAAAGAGGAGAGAGAGAGAGG - Intronic
1181964985 22:26650196-26650218 GAGAAGAGGGAGAGACACCCGGG + Intergenic
1182182122 22:28361033-28361055 GAGAAGAAGGAGAGAGACAAGGG - Intronic
1182436051 22:30330650-30330672 GAGAATAAGAAAATAAAGCCAGG + Intergenic
1183102692 22:35593593-35593615 GAGAAAAGGGAGAGAGAGGTGGG + Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1183728006 22:39600145-39600167 GAGAATTAGGAGAGAGAATGGGG + Intronic
1184010678 22:41745693-41745715 AAGAATCTGGAGAGATAGCCAGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949815059 3:8049397-8049419 GAGACTAGGGAGAGAGAGACAGG - Intergenic
950080809 3:10220733-10220755 AAAAATTAGGGGAGAGAGCCGGG - Intronic
950089757 3:10287231-10287253 GAGAGAAAGGAGAAAGAGCTGGG - Intronic
950211969 3:11130267-11130289 GAGAACACGTAGAGGGAGCCTGG + Intergenic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
951398863 3:22204910-22204932 GAGGATAGAGAGAGAGAGCCTGG + Intronic
951599741 3:24360476-24360498 GAGAAGCAGGATAGAGAGCAGGG - Intronic
953191401 3:40691179-40691201 GAGAACAAGGGGGGTGAGCCAGG - Intergenic
953229607 3:41052937-41052959 GAGGAAATGCAGAGAGAGCCTGG + Intergenic
953537237 3:43785805-43785827 GGGAATAAGGAGGGAGTGACAGG - Intergenic
953932837 3:47014558-47014580 AAGAATCAGGAGAGAAAGCAGGG + Intergenic
954148055 3:48644001-48644023 GAGGACAAGGAGAGACAGCAGGG + Intronic
954805662 3:53218520-53218542 GAGAATGAGCAGGGAGAGCAGGG + Intergenic
955446852 3:59021007-59021029 AAGCAAAAGAAGAGAGAGCCTGG - Intronic
956042399 3:65158253-65158275 GATAATCAGTAGAGAGAACCAGG + Intergenic
956096827 3:65725251-65725273 GGCTATAAGGAGATAGAGCCTGG - Intronic
956794915 3:72709140-72709162 GAGAATAAGGACAGACACCAGGG + Intergenic
957047332 3:75386151-75386173 AAGAATAAAGAAAGAGAGACAGG + Intergenic
958002254 3:87764884-87764906 GAGTGTAAGGGGAGAGAGCTAGG - Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959765773 3:110025903-110025925 GATAATATGAGGAGAGAGCCAGG + Intergenic
959970613 3:112405424-112405446 GAGTGTAAGAAGAGAAAGCCTGG + Intergenic
961008694 3:123422176-123422198 GAGAGAAAGGGGAGAAAGCCTGG - Intronic
961202747 3:125057227-125057249 GAGAAATAGGATGGAGAGCCAGG - Intergenic
961306142 3:125959902-125959924 CAGGACAAGGAGTGAGAGCCGGG - Intergenic
961745827 3:129062887-129062909 GAGAAAAAGGAGAGAGAAGACGG - Intergenic
962792521 3:138824497-138824519 GAAAATAAGGAGATATGGCCGGG + Intronic
963060402 3:141220682-141220704 CGGAATAAGGAGAGAGAACAGGG + Intergenic
963521069 3:146360574-146360596 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
964755127 3:160085631-160085653 GAGGATAAGGCCAGAGAGCAAGG - Intergenic
964842371 3:161008020-161008042 GAGAATGAGAAGCCAGAGCCAGG - Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
964922142 3:161910093-161910115 GAGTATGAGGAGAAAAAGCCTGG + Intergenic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
965993965 3:174856010-174856032 GAGAAGTAAGAGAGAGAGACAGG + Intronic
966209846 3:177442023-177442045 CTGAAGATGGAGAGAGAGCCTGG + Intergenic
966289640 3:178341060-178341082 GAGAATAAAAACAGAGAGACAGG - Intergenic
967216310 3:187213387-187213409 GATAATAAGGAAAAAGAACCAGG - Intergenic
967260520 3:187637252-187637274 GAGTATTAAGAGAGAGAGTCAGG - Intergenic
967404140 3:189098155-189098177 AAGAAGAAGAAAAGAGAGCCGGG + Intronic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
967833954 3:193945275-193945297 GAGGATGAAGGGAGAGAGCCTGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968256466 3:197277836-197277858 TAAAATTAAGAGAGAGAGCCGGG + Intronic
969070451 4:4533966-4533988 GAGAATAACAGGAGAGAACCTGG + Intronic
969231310 4:5833557-5833579 GAGAAAATGGAGAGAGAGAGAGG - Intronic
970728506 4:19075477-19075499 GAGGAAAAGGAGAGAGAGATGGG + Intergenic
971149229 4:24013424-24013446 GAGAAGAAGGAGAGAGGACGAGG - Intergenic
971375620 4:26053518-26053540 GGGGATAAGGAGAGAGAGAGAGG + Intergenic
971420276 4:26468032-26468054 GAGAAGGAGGAGAGAGAGAAGGG + Intergenic
971439495 4:26664962-26664984 GAGAGTGAGGACTGAGAGCCAGG - Intronic
971888493 4:32484286-32484308 GAGAATAACTAGAGTGGGCCAGG - Intergenic
972521510 4:39861462-39861484 AAAAATAAAGAGAGAGAGACTGG + Intronic
972708656 4:41571491-41571513 GAGAATATGAAGAGAGAAGCAGG + Intronic
973008063 4:45037949-45037971 GAGAATAAGGAAAAAGAGATGGG - Intergenic
973051622 4:45606248-45606270 GTGCAAAAGGAGAGAGAACCTGG - Intergenic
973546937 4:51991536-51991558 GAGAGTAAGAAGAGAAAGGCTGG + Intergenic
973743184 4:53938007-53938029 GAGGATGAGGAGAGAGATACTGG - Intronic
974156699 4:58082720-58082742 GAGAAAAAAAAGACAGAGCCTGG - Intergenic
975282231 4:72574178-72574200 GAGAAAAAGGAGAAAGATCAAGG - Intergenic
976402511 4:84623432-84623454 GAAACTAAGGAGAAAGGGCCCGG - Intronic
976602041 4:86946677-86946699 AAGAATAAAGAGAGTGGGCCGGG - Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977396128 4:96472918-96472940 GAGAATAAGAAGTGAGAGACAGG + Intergenic
977556889 4:98495929-98495951 GATAAGAAAGAGAGAGAGACAGG + Intronic
977597603 4:98900902-98900924 GAGAATGAGAAACGAGAGCCAGG - Intronic
978421972 4:108542664-108542686 GTGAAAAAGGAGAGAGAGTGGGG - Intergenic
979258149 4:118625448-118625470 GAGAATTGGGGGAGGGAGCCAGG + Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
980309666 4:131109685-131109707 GAGGAGAGGGAGAGAGAGGCTGG + Intergenic
980474323 4:133291991-133292013 TAGAACAGGGAGATAGAGCCTGG + Intergenic
981224004 4:142270177-142270199 GAGATTGAGGAGAGAGAAGCAGG - Intronic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981492539 4:145355149-145355171 GAGAAGAAGGCTAGAGACCCAGG + Intergenic
981526866 4:145715409-145715431 GAGAATAGTGAGTGAGTGCCTGG - Intronic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
982164925 4:152605523-152605545 GAGAGGAAGGACAGAGAGCCCGG + Intergenic
982940266 4:161542645-161542667 GAGAGTCAGGCTAGAGAGCCTGG - Exonic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984556916 4:181225612-181225634 GAGAAGAAAAAGAGAGAGACAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985174999 4:187191387-187191409 GAGACTAATGAGAAAGACCCAGG + Intergenic
985421256 4:189787163-189787185 GAGAGTAAGGAGAGTAAGGCAGG + Intergenic
986954134 5:13129654-13129676 GAGAATAGTGGGAGAAAGCCTGG - Intergenic
987827782 5:23055847-23055869 GAGAATAAGGAGAGTGAAGGAGG + Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988174960 5:27710953-27710975 GAGGATAAGGAGAGAGATGAGGG - Intergenic
989285952 5:39700099-39700121 GAGAAAAGAGAGAGAGAGGCTGG + Intergenic
989433352 5:41381486-41381508 GAGAAAAAGGAGACAGAGACTGG + Intronic
989952916 5:50322244-50322266 GAGGAGAAGGAGAGAGATGCAGG - Intergenic
990109990 5:52310792-52310814 GAGAGAGAGGAGAGAGAGCAGGG - Intergenic
990124773 5:52500805-52500827 GAGAATGAGGATAGAGGACCAGG + Intergenic
991522287 5:67514543-67514565 GAGAAGGAAGAGAGAAAGCCAGG + Intergenic
991734027 5:69615302-69615324 GAGGCTTAGGAGATAGAGCCAGG + Intergenic
991810461 5:70470443-70470465 GAGGCTTAGGAGATAGAGCCAGG + Intergenic
991860240 5:71006840-71006862 GAGGCTTAGGAGATAGAGCCAGG - Intronic
992530048 5:77644947-77644969 GAGAAAAAGGGGAGAGAGAAAGG - Intergenic
993373398 5:87119483-87119505 GAGAAAAAAGAGAGAGAGCGAGG + Intergenic
993900804 5:93583324-93583346 GAGAAAGAGGAGAGAGAGAGAGG - Exonic
994634272 5:102324646-102324668 TATAATAAGGAGAAAAAGCCTGG + Intergenic
995073795 5:107957230-107957252 GATAATAGGGACAGAGACCCAGG + Intronic
995766405 5:115624639-115624661 GGGAATAAGGAGCCAGAGCAAGG - Intronic
996339856 5:122424653-122424675 GAGAATTAGGGGGAAGAGCCAGG - Intronic
996588393 5:125117731-125117753 AACCATAAGGAGAGAGAGCATGG + Intergenic
997195315 5:131975360-131975382 GGGAGGAAGGGGAGAGAGCCGGG - Intronic
998542884 5:142999448-142999470 GAGAAAGAGGAGAGTGAGGCGGG + Intronic
998769856 5:145530580-145530602 AAGAATAAGGAGGGAGAGACAGG + Intronic
998785834 5:145707864-145707886 GACAAGAAGGAGAGAGAGCCTGG + Intronic
999195692 5:149780062-149780084 GAGTGTAAGGAGAGAAAGCTGGG + Intronic
1000875389 5:166631564-166631586 TAGCATAAAGAGAGAGAACCCGG - Intergenic
1001618916 5:173065600-173065622 GGGAATAAAGAGAGAGAGGGAGG - Intronic
1001667620 5:173446485-173446507 GAGAATGAGAGGGGAGAGCCTGG + Intergenic
1001763802 5:174228928-174228950 AAGGATATGGAGAAAGAGCCAGG + Intronic
1002286015 5:178163211-178163233 AAGAAAAAGAAGAGTGAGCCTGG + Intergenic
1003389653 6:5702821-5702843 GAGAATGAGGAGGGAGGCCCAGG + Intronic
1003598117 6:7493128-7493150 GAGAATAAGGGGAGAGATAGTGG + Intergenic
1003610168 6:7606178-7606200 GAGAAGAAGGAAAGAGAGGTGGG + Exonic
1003778313 6:9394604-9394626 GAGAAACAGGAGAGGGAGCATGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1005352962 6:24954442-24954464 AAAAAAAAGGAGAGAGAGACTGG - Intronic
1005624499 6:27650689-27650711 GAGCATAAGGGGAGGGAGCTGGG + Intergenic
1005817367 6:29565471-29565493 GAGAAGTAGGAGGCAGAGCCTGG - Intronic
1005857648 6:29874780-29874802 GAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1005968011 6:30741385-30741407 GAGAAAAAGCAGAGAGAGAAGGG + Intronic
1005977115 6:30808176-30808198 GAGAATGAGGGGCGAGAGACAGG + Intergenic
1005991241 6:30903785-30903807 GAGAGAAAGAACAGAGAGCCAGG - Intergenic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1006295137 6:33166895-33166917 GAGGACATGGAGAGGGAGCCGGG + Intronic
1006508467 6:34506880-34506902 GTGAAGAATGAGGGAGAGCCAGG - Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1007962624 6:45974204-45974226 GAGCATAAGGACAGAAACCCAGG - Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1009930676 6:70173906-70173928 GAGAGAAAGGAGAGAGTGCTGGG + Intronic
1010996166 6:82535662-82535684 GAGAATGAGAAGAAATAGCCAGG + Intergenic
1011410504 6:87061321-87061343 GAGAAGGAGGAGGGAGAGACTGG + Intergenic
1011656268 6:89554942-89554964 GAGAATTAGGAAAGAAAACCAGG - Intronic
1013489769 6:110634841-110634863 GAGAATAAGGGGAGAAATACTGG - Intronic
1013665055 6:112339282-112339304 GAGAAGAAGGAGTCAGAGCAAGG - Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015812113 6:137171270-137171292 GAGAATAAGGAGCTACAGCAGGG + Intronic
1016138431 6:140576776-140576798 GAGAAAAAAGAGAGAGAGGATGG - Intergenic
1016221601 6:141677909-141677931 GAGGAGACGGAGAGAGAGACAGG - Intergenic
1016293349 6:142547993-142548015 GGGAATAAGGGGAGAAAGCATGG + Intergenic
1016809527 6:148246131-148246153 GAGAGAGAGGAGAGAGAGACAGG - Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1018066937 6:160131137-160131159 GAGAGAAGGGACAGAGAGCCAGG + Intronic
1018691732 6:166350882-166350904 GAGGAGAGGGAGAGAGAGACAGG + Intergenic
1018724705 6:166602969-166602991 GAGAATCTGGAGAGAGAGAGAGG + Intronic
1018726297 6:166615705-166615727 GGGGATAAGGAGAGAGGTCCCGG - Intronic
1020899763 7:13990143-13990165 GGGAATGAGGATAGAGAGCGAGG - Intronic
1020929858 7:14379463-14379485 GAGAATAAGGAAAGAGAGTGGGG + Intronic
1021425147 7:20491086-20491108 GAGCAGAAGAAGAGAGAGACGGG - Intergenic
1021849512 7:24794299-24794321 GAGAAAAGGGAGAGAGAGAGAGG - Intergenic
1023006802 7:35878968-35878990 TAGAGTAAGAAGAGAAAGCCTGG + Intronic
1023083159 7:36544609-36544631 GAAAATAATGAGAGAGAAACTGG + Intronic
1023172422 7:37402580-37402602 GAGTAGAGGGAGAGAGAGTCTGG + Intronic
1023400134 7:39786741-39786763 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1023738867 7:43259860-43259882 TAGAATAATGAGAGAGAGAATGG + Intronic
1024650270 7:51397696-51397718 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1025132466 7:56383498-56383520 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1025622633 7:63188014-63188036 GTGCATATGGAGAGAGAGCGAGG - Intergenic
1025838778 7:65123820-65123842 GAGAGTAAGGATAGAGACCTAGG + Intergenic
1025884288 7:65572145-65572167 GAGAGTAAGGATAGAGACCTAGG - Intergenic
1025889154 7:65630461-65630483 GAGAGTAAGGATAGAGACCTAGG + Intergenic
1026615548 7:71899691-71899713 AAGAATAATGTGAGAGGGCCAGG + Intronic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027487853 7:78784353-78784375 GAGAATGAGGAGCAAGAGACAGG - Intronic
1027568030 7:79823354-79823376 GAGAATCAGAACACAGAGCCTGG + Intergenic
1027676126 7:81160983-81161005 AAGAATGAGGAGAGCCAGCCGGG + Intergenic
1027748994 7:82117148-82117170 GAGAAAAATGACAGTGAGCCAGG - Exonic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031084210 7:117286422-117286444 GAGAATAGGGAGAGAAGGGCGGG - Intronic
1031853290 7:126891513-126891535 GAGAGTAAGGATAGAGACCTAGG - Intronic
1032050449 7:128646186-128646208 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1032733616 7:134669412-134669434 GATAATAAGCAGAGATAGTCTGG - Intronic
1033040445 7:137912908-137912930 GGGAATATGGCGAGAGAGCTGGG - Intronic
1033241595 7:139684243-139684265 GAGAAGAAGGAGAGAGATGGGGG - Intronic
1033321175 7:140340939-140340961 AAAAATAGAGAGAGAGAGCCAGG + Intronic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1033662918 7:143415191-143415213 AAGAAAAAGGTAAGAGAGCCGGG + Intergenic
1034390975 7:150787503-150787525 GAGGTGAAGGAGGGAGAGCCTGG - Intergenic
1034455774 7:151168840-151168862 GAAGAGAAGGAGAGAGAGCGAGG - Intronic
1034978892 7:155463364-155463386 GAGGGTGAGGAGAGGGAGCCGGG - Exonic
1035603989 8:917015-917037 GAGAAGAAGGTGTGAGAGGCAGG + Intergenic
1035659039 8:1333142-1333164 GAGCACAAGGAGAGAGATCAGGG + Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1036049136 8:5176229-5176251 TAGAATAAGTACAGATAGCCGGG - Intergenic
1037225486 8:16584628-16584650 GAAAATAAGGAGAAACGGCCAGG + Intergenic
1037403719 8:18519627-18519649 GGGAATGAGGGGAGAGAGCCAGG + Intergenic
1037477334 8:19270496-19270518 GTGGATGAGCAGAGAGAGCCAGG + Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037730757 8:21521721-21521743 GAGAAGAGAGAGAGAGATCCTGG + Intergenic
1038135367 8:24780038-24780060 GAGACTAATGAGAGTGAGACAGG + Intergenic
1038481476 8:27904785-27904807 GAGAGAAAGGAGACAGAGCTGGG - Exonic
1039498275 8:37997570-37997592 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1041746153 8:61211331-61211353 GAGAAGAAGGAGGGAGAGGAAGG - Intronic
1042117838 8:65451362-65451384 GCAAACTAGGAGAGAGAGCCAGG - Intergenic
1042345195 8:67719828-67719850 GAGAATAAGGAAAGGGGGCAGGG + Intronic
1043259833 8:78182910-78182932 GGGAAGAAGTAGAGAGAACCAGG + Intergenic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1043647737 8:82542664-82542686 GTCAAAAAGGAGAGAGAGCTTGG - Intergenic
1044803192 8:95978042-95978064 GAGAATAGGGAGAGAGAAAAAGG + Intergenic
1046031407 8:108787370-108787392 GAGACGAAGGAGAGAGAGCGGGG + Intronic
1046571755 8:115974935-115974957 GAGAAGAAGGAGAGAGATGGAGG + Intergenic
1046720030 8:117608786-117608808 GAGAAAATGAAGAGAGAACCAGG - Intergenic
1047082458 8:121478435-121478457 GAAAATAAGAAGTGAGAGACTGG + Intergenic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1047851735 8:128864789-128864811 GAGAATAAGAGGCGAGAGACAGG - Intergenic
1048880558 8:138869099-138869121 GAGAGGAAGGAGACAGAGCTGGG + Intronic
1049097629 8:140558240-140558262 AGGAAGAGGGAGAGAGAGCCTGG + Intronic
1050052128 9:1613639-1613661 CAGAATAAAGAGAGATAGCCTGG + Intergenic
1050856350 9:10361850-10361872 GAGATTAAGGAGAAAGAGCATGG + Intronic
1051705655 9:19877271-19877293 GAGGAAAAGGAGAGACAGGCTGG + Intergenic
1051828776 9:21252250-21252272 GAGACAGAGGAGAGAGAACCAGG + Intergenic
1052416502 9:28184589-28184611 GAGAAAAAAGAGAGAGAGATGGG + Intronic
1052866953 9:33469733-33469755 GAAACCAAGGTGAGAGAGCCAGG + Intronic
1055158084 9:73089382-73089404 GAGAAAAAGTGGAGAGAGCAGGG + Intergenic
1056175456 9:84030547-84030569 GATAATTAGGAGTGAGAGACAGG + Intergenic
1056413443 9:86354418-86354440 GAAAACACGGAGAGGGAGCCCGG - Intronic
1057110445 9:92464987-92465009 GATAATAATGGGATAGAGCCAGG - Exonic
1057801789 9:98195501-98195523 AAGAATGAGGAGACAGTGCCTGG + Intergenic
1057897977 9:98924805-98924827 GAGCATCAGGAGAGGGTGCCAGG + Intergenic
1058048609 9:100383844-100383866 AAGAAGAAGAAGAGAGACCCGGG + Intergenic
1058262817 9:102857837-102857859 GAGAAAGAGGAGAGAGAGAATGG - Intergenic
1058526126 9:105859599-105859621 GAAAAGAAGGAGAGAGAGAAAGG + Intergenic
1059212204 9:112523885-112523907 GAGAGTAAGCAGGGAGAGTCAGG - Intronic
1059364087 9:113771868-113771890 GAGTATAATGATTGAGAGCCTGG + Intergenic
1059520200 9:114933676-114933698 GAGAATGAGCAGAGAGGGCCGGG - Intergenic
1059529784 9:115025314-115025336 GATAATAAAGAGAGACACCCAGG - Intronic
1059625402 9:116059232-116059254 GAGAAAAAGGACAGAGAGAAAGG + Intergenic
1061087976 9:128410269-128410291 GAGGACAGGGAGAGAAAGCCTGG + Intergenic
1061307484 9:129740427-129740449 GGGGAAAAGGAGACAGAGCCCGG - Intronic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1062066028 9:134526829-134526851 GAGAAGGAGAAGACAGAGCCGGG + Intergenic
1062480944 9:136751054-136751076 GGGAAGAAGGAGAGAGAGAGAGG + Intergenic
1062719188 9:138026322-138026344 GAGAATCAGGTGAGGGAGCTGGG - Intronic
1203431168 Un_GL000195v1:92414-92436 GGGACTAAGGAGAGAGAGTGGGG + Intergenic
1185573320 X:1151466-1151488 GAGAAAGAGGAGAGAGAGAGAGG + Intergenic
1185661636 X:1733203-1733225 GAAAAAAAGGAGAGGGGGCCGGG + Intergenic
1185787479 X:2903078-2903100 GAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1185989408 X:4876155-4876177 GAGAAAGAGGAGAGAGAGAGAGG - Intergenic
1186384407 X:9094361-9094383 GAGAAAAATGGGAGAGAGCAGGG + Intronic
1186875886 X:13817257-13817279 GAGAGCAAGGAGGAAGAGCCCGG - Exonic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1189110821 X:38286846-38286868 GAGCAAAAGGAGAGGGAGCAGGG - Exonic
1189285848 X:39852030-39852052 GAGGACATGGAGAGAGAGCCAGG + Intergenic
1189541299 X:41992991-41993013 GAGAAACAGGAGAGACAGCTGGG + Intergenic
1190172842 X:48125359-48125381 AAGAACCAGGAGTGAGAGCCAGG - Intergenic
1190233691 X:48600696-48600718 GAGTATAAGGAGGGACAGCCAGG + Intronic
1192030515 X:67507636-67507658 GAGAACAGAGAGAGAGAGCAGGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192618215 X:72650080-72650102 GAGAAAAAGCAGAGATAACCAGG + Intronic
1192917428 X:75667447-75667469 GGGAAAAAGGAGAGAGAGTTAGG - Intergenic
1193034286 X:76932731-76932753 GAGAAAAAAGAGAGAAGGCCGGG - Intergenic
1194093451 X:89604980-89605002 GAGAATGAGAAGAGCAAGCCAGG - Intergenic
1194167863 X:90542798-90542820 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1194626386 X:96230941-96230963 GAGAGAGAGGAGAGAGAGCTGGG + Intergenic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195110105 X:101639780-101639802 GTGAATAAGGGCAGAGAGCAGGG + Intergenic
1195678448 X:107525259-107525281 GAGATGGAGGAGAGAGGGCCAGG - Intronic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1195716663 X:107825518-107825540 GGTAATAAGAAGAGAGAGCCGGG - Intergenic
1197133288 X:123030935-123030957 GAGAAAGATGAGAGAGAGGCAGG - Intergenic
1198003213 X:132462223-132462245 GAGAAACAGGAGAGAGAGGGAGG - Intronic
1198486235 X:137090230-137090252 GAGAATAAGGCAGGAAAGCCTGG + Intergenic
1198534461 X:137573552-137573574 AAGAAGGGGGAGAGAGAGCCAGG - Intronic
1198551780 X:137752642-137752664 GAAGATAAGGAGAGAGGGTCAGG - Intergenic
1198807871 X:140507520-140507542 GAGAATTGGGAGAGTGTGCCTGG - Intergenic
1198837495 X:140820175-140820197 GAGAAAAAAAAGAGAGAGACTGG + Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1200019780 X:153192850-153192872 GAGATTAAGAAGAGTGAGTCAGG - Intergenic
1200022855 X:153226397-153226419 GAGGTGAAGGAGAGAGAGCAAGG + Intergenic
1200074204 X:153543290-153543312 GAGAATCAAAAGAGAGGGCCCGG - Intronic
1200205431 X:154312172-154312194 GAGAATAAGGCTGGAGAGACAGG - Intronic
1200446080 Y:3261083-3261105 GAGAATGAGAAGAGCAAGCCAGG - Intergenic
1200514120 Y:4120588-4120610 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1201014020 Y:9579787-9579809 GGAAATAAGGAGAGTGAGACAGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic