ID: 976757809

View in Genome Browser
Species Human (GRCh38)
Location 4:88516897-88516919
Sequence CTGTGAACAGATATGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976757804_976757809 20 Left 976757804 4:88516854-88516876 CCATGGCGTGCAGCATGAGGTAC No data
Right 976757809 4:88516897-88516919 CTGTGAACAGATATGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976757809 Original CRISPR CTGTGAACAGATATGAAGCC AGG Intergenic
No off target data available for this crispr