ID: 976758703

View in Genome Browser
Species Human (GRCh38)
Location 4:88525239-88525261
Sequence TAGAGAATAGGGCAGTTATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976758699_976758703 1 Left 976758699 4:88525215-88525237 CCGTTATTAGAGTTACTAACGGA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 976758703 4:88525239-88525261 TAGAGAATAGGGCAGTTATCGGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976758703 Original CRISPR TAGAGAATAGGGCAGTTATC GGG Intronic
904845829 1:33414528-33414550 TAGACAGTAGGGCAGTTAAAGGG + Intronic
907175149 1:52513897-52513919 TAGCGCATAGGGCTGTTATGAGG + Intronic
908486576 1:64600157-64600179 AAGAGAATAGGGTAGTTCTGAGG - Intronic
915138346 1:153749909-153749931 TAGAAAACAGGGCAGTTATCTGG - Intronic
915266300 1:154720377-154720399 TAATCAATAGGGCAGTTATCAGG - Intronic
916621905 1:166507430-166507452 TACAGAAAAGTGCAATTATCTGG + Intergenic
917254763 1:173102849-173102871 TCGAGAATATGGCAGTCCTCTGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919657424 1:200211309-200211331 TATAGCATAGGGCACTTATCAGG + Intergenic
920014039 1:202891497-202891519 AAAAGAATGGGGCAGTAATCAGG + Exonic
921672467 1:217941503-217941525 TAGAGAGTAAGGAAGTTGTCAGG + Intergenic
921774333 1:219079629-219079651 TAGAAAATGGGGCAGGGATCAGG - Intergenic
1065370704 10:24982272-24982294 GAAAGAAAAGGGCAGTTTTCTGG + Exonic
1066511355 10:36100572-36100594 TTCAGAACAGGGAAGTTATCAGG + Intergenic
1067157840 10:43797258-43797280 GAAAGAATAGAGCATTTATCTGG - Intergenic
1069307607 10:66990648-66990670 TAGAGAAAAGGACACTTATCTGG - Intronic
1071178778 10:82958745-82958767 TAGAGAATATGGATGATATCAGG + Intronic
1075237977 10:120748913-120748935 TAGAGAAAAGGGCAGGCAACTGG + Intergenic
1085833916 11:79931954-79931976 TAGAGAAGAGGGCAATAATAAGG + Intergenic
1086915300 11:92523260-92523282 TATAGAATATGGCTGATATCTGG - Intronic
1089393276 11:118116493-118116515 TAGTGAAAAGTGCACTTATCTGG - Intronic
1095612482 12:44146309-44146331 TAGAAAAAAGTGAAGTTATCAGG - Intronic
1100289104 12:93197099-93197121 AAGAGTTTAGGGCAGTTGTCTGG + Intergenic
1100359772 12:93865465-93865487 TAGAGTATAGTGGAGTGATCTGG + Intronic
1101808490 12:108086917-108086939 CAGAGGACAGGGCATTTATCTGG - Intergenic
1102320962 12:111933837-111933859 CAGTGAAGAGGGCAGTTATTAGG - Intronic
1106543083 13:30707321-30707343 TAGAAAATAGGGCAGGGATAGGG + Intergenic
1108534985 13:51366717-51366739 TAGAGCATAGGCCAGTTTGCAGG - Intronic
1108852623 13:54752415-54752437 TACTGAATAAGGCAGTTAGCAGG - Intergenic
1110277208 13:73653496-73653518 TAGAAAATAGGGCATGTGTCTGG + Intergenic
1110720869 13:78760060-78760082 TAGATAATCGGGCTGTTTTCTGG - Intergenic
1111807307 13:93053638-93053660 TAGAGTATAAGGCAGCTCTCTGG - Intergenic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1112557932 13:100486113-100486135 CAGAGAATGAGGCAGTTTTCAGG - Intronic
1115032166 14:28809696-28809718 TAGAGATTAGGGCACTTCTGTGG + Intronic
1116508486 14:45714810-45714832 TAGAGAAGAGGGCAATTTACAGG + Intergenic
1117622256 14:57599469-57599491 TAGAGGGTAGGGCAGTATTCAGG + Intronic
1125655532 15:41353796-41353818 TTGAGAATAGGACAGGTAGCGGG - Intronic
1128013218 15:64318389-64318411 ATGAGATTAGGGCAGTTACCTGG + Intronic
1131956359 15:97740355-97740377 TAGAGAATAGGGAAGATAAGGGG - Intergenic
1134536904 16:15033650-15033672 TAGAGAAGAGGGCGGGTAGCTGG + Intronic
1135763822 16:25159560-25159582 TAAAGAATATGGCATGTATCTGG - Intronic
1141038466 16:80650939-80650961 TACAGAAGAGGACAGTTACCAGG + Intronic
1141110294 16:81266179-81266201 TGGAGAACAGGGCAGGGATCTGG - Intronic
1141266187 16:82499353-82499375 TAGGGAATAGGGCATATTTCAGG + Intergenic
1141285164 16:82664622-82664644 TAGAGAATAAGGCTGTTTTAAGG - Intronic
1141473919 16:84259102-84259124 GAGAAAATATGGAAGTTATCTGG - Intergenic
1141537132 16:84689896-84689918 TGGAGAATTGGGCAGTGGTCTGG - Intergenic
1148426581 17:47603120-47603142 TAGAGAATAATGCAGTTGCCAGG + Intronic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1153593020 18:6694574-6694596 TAGAGAAGAAAGCACTTATCAGG - Intergenic
1155185205 18:23381729-23381751 TAGAGATGAGGGCAGATGTCTGG - Intronic
1155752581 18:29445829-29445851 TAAAGAAGAGGGCACTTAGCAGG - Intergenic
1156900100 18:42290500-42290522 AGGAGAATTGGGCAGTTATTAGG - Intergenic
1159039238 18:63307695-63307717 TGGAGAACAGGCCAATTATCTGG + Intronic
1167189512 19:47974736-47974758 TAGATAATAGTGCAGTATTCAGG - Intronic
927063964 2:19450971-19450993 TAGAGAAGTTGGCAGTTTTCTGG - Intergenic
930674845 2:54189342-54189364 TAGAGAATAAGGCAGTGGTTAGG - Intronic
932091330 2:68808824-68808846 TAGAGCCTAAGGCAGTTATTTGG - Intronic
933232607 2:79826448-79826470 TGGAGTAGAGGGCAGTTATAGGG + Intronic
934046718 2:88178749-88178771 GAGAGAAGAGGGCAGCTGTCAGG - Intronic
938977800 2:136495832-136495854 TGGAGAAAAGGGAAGTTCTCAGG + Intergenic
939488109 2:142842614-142842636 TAGAAAATAGGGCAGGTAGCAGG - Intergenic
940241111 2:151564071-151564093 CCTAGAATAGGGCAGTTATTTGG + Intronic
947467930 2:230370768-230370790 TAGAGAAGAGGGCAGCAACCAGG + Intronic
947862018 2:233367197-233367219 AAGAGACAAGGGCAGTTGTCTGG + Intronic
948009772 2:234642236-234642258 TAGAGAAGAGGAGAGTGATCAGG - Intergenic
1168992613 20:2107569-2107591 TAGAAAATAGTACAGTTGTCTGG + Intronic
1171106063 20:22433893-22433915 TAGAGAATAGGTCAGAAATATGG - Intergenic
1171522327 20:25785442-25785464 TGGAGAAAAGGGCAGTGACCAGG + Intronic
1171530075 20:25847387-25847409 TGGAGAAAAGGGCAGTGACCAGG + Intronic
1171554500 20:26070441-26070463 TGGAGAAAAGGGCAGTGACCAGG - Intergenic
1176656132 21:9590440-9590462 TGGAGAAAAGGGCAGTGACCAGG + Intergenic
1177615857 21:23518541-23518563 TAAAGGATAAGGCAGTTATTAGG + Intergenic
1179109541 21:38434374-38434396 AGGTGAATAGGGCAGGTATCAGG - Intronic
1181088066 22:20452836-20452858 AAAAGAATGGGGCAGTAATCAGG - Intronic
949603325 3:5625726-5625748 CAGAGAAAATGGCAGTTACCAGG - Intergenic
951960055 3:28308074-28308096 TTGAAAATAGGGAGGTTATCTGG - Intronic
953290558 3:41657008-41657030 GAGAGAAAAGGGCAGTGCTCAGG + Intronic
955104650 3:55885456-55885478 TAGTGAATAGGGCCCATATCAGG + Intronic
957051166 3:75413459-75413481 TAGAGAACAGGTCAGTTGACCGG + Intergenic
958653779 3:96975153-96975175 TCGATCATAGGGCAGGTATCTGG - Intronic
961638017 3:128345443-128345465 AAGAGCATAGGGCACTTCTCTGG - Intronic
962403713 3:135082639-135082661 TAGAGAATAGGACACATTTCAGG + Intronic
964533699 3:157696306-157696328 TTGAGAATAGGCCAGTTAGGAGG - Intergenic
965604137 3:170482934-170482956 TGGAGAGTGGGGCAGTTACCAGG + Intronic
967091159 3:186135965-186135987 TAGAGGCTATGGCAGTTAGCTGG - Intronic
968263115 3:197340700-197340722 CAAAGAATAGTGCAGTTAACTGG + Intergenic
975363909 4:73505523-73505545 TAGAGTATAAGGAACTTATCTGG - Intergenic
975866982 4:78733988-78734010 TAGAGACTAGGGCAGATAAGTGG + Intergenic
976758703 4:88525239-88525261 TAGAGAATAGGGCAGTTATCGGG + Intronic
977940851 4:102856918-102856940 TGGAGCATAGGGCACTTATAGGG + Intronic
977959499 4:103070004-103070026 TGGAGAATAGGGAACTTTTCTGG - Intronic
979602626 4:122603293-122603315 TGGAACATAGGGCAGTTGTCAGG - Intergenic
982561769 4:156936765-156936787 TAGAGATTACTGCAGTAATCAGG + Intronic
982892483 4:160872900-160872922 TAAAGAGTAGGGCACATATCAGG + Intergenic
983236146 4:165181448-165181470 TGGACAACAGGTCAGTTATCTGG + Intronic
984000559 4:174236320-174236342 TAGAGAACAGTGTAGTTATATGG - Intergenic
984546897 4:181115614-181115636 TAGAGTTTAGTGCAGTTCTCAGG - Intergenic
986080473 5:4386709-4386731 TAGAGAATAAGACCTTTATCTGG + Intergenic
992554692 5:77891887-77891909 AAGAGAATAGAGCATTTATTTGG - Intergenic
992723003 5:79578902-79578924 TGGAGAATAGGGGACTTATTTGG + Intergenic
992962321 5:81968492-81968514 TGGAGAATAGGGCATTTTTTAGG - Intergenic
993690262 5:90991033-90991055 TAGAGAATATGCCTTTTATCTGG + Intronic
994540659 5:101091844-101091866 GAGAGTCTAGAGCAGTTATCCGG - Intergenic
998649354 5:144100474-144100496 TAGAGCAGAGGTCAGTTATACGG - Intergenic
998659885 5:144224522-144224544 TACAGAATAGGGCTGGTATGAGG - Intronic
1001277726 5:170362690-170362712 CAGAGAATTGGGCAGGAATCAGG + Intronic
1001609885 5:172991943-172991965 GAAAGAAAAGGGCAGTTATTTGG - Intronic
1005578157 6:27209179-27209201 CAGAGAAGAGGGATGTTATCTGG + Intergenic
1009310705 6:62149005-62149027 AAGGAAATAGGGCAGTTATTGGG - Intronic
1013331340 6:109104373-109104395 TAGAGAAAATGGCACATATCTGG - Intronic
1015022944 6:128498547-128498569 TAGAGGATCAGACAGTTATCTGG - Intronic
1020689643 7:11338668-11338690 GAGAGAACATGGCTGTTATCAGG + Intergenic
1021853378 7:24830362-24830384 TTGAGAATAACGCATTTATCTGG + Intronic
1023913025 7:44568797-44568819 CAGAGAACTGGGCAGTTTTCTGG - Intronic
1024189439 7:46990862-46990884 CAAAGAATAAGGCAGTGATCAGG + Intergenic
1025282816 7:57640619-57640641 TGGAGAAAAGGGCAGTGACCAGG + Intergenic
1025301898 7:57824801-57824823 TAGAGAAAAGGGCAGTGACCAGG - Intergenic
1026529611 7:71185484-71185506 TAGAGAATGGGGCAGGTATGGGG - Intronic
1027962039 7:84958142-84958164 TAGAGAGTAGGGCCTATATCAGG + Intergenic
1028855450 7:95587125-95587147 TAGAGAAGAGAGACGTTATCAGG + Intronic
1029148762 7:98465487-98465509 GAGAGAAGAGGGCAGTTCTGGGG - Intergenic
1039091284 8:33832338-33832360 TAGAGGATAGGCCATTTATTTGG + Intergenic
1041497866 8:58506974-58506996 TAGAGAAGAGGGCAGTCAGGGGG + Intergenic
1046238199 8:111455058-111455080 TAGAGATTCTGGCAGTTATAGGG + Intergenic
1046286570 8:112100632-112100654 TAGAGAATAGATTATTTATCTGG + Intergenic
1046390195 8:113561864-113561886 GAGTGAATAGGGGAGTTAGCTGG + Intergenic
1055183936 9:73427318-73427340 TAGAGAATATTGTATTTATCAGG - Intergenic
1055664179 9:78536740-78536762 TAGAGGATGGAGCTGTTATCGGG + Intergenic
1056976572 9:91261812-91261834 TAGAGAATTGGGCAAATATATGG - Intronic
1059065465 9:111079046-111079068 TAGAGCAGAGGGTAGTTAACAGG - Intergenic
1060456109 9:123799642-123799664 TAGTGAATAGGTCTGTTATGAGG + Intronic
1187474987 X:19602627-19602649 TAAAAAATAGGGAAATTATCGGG + Intronic
1198193244 X:134332379-134332401 TAGAGAATAGAGTAGTAAGCCGG + Intergenic
1200955619 Y:8941657-8941679 TAGAGAAAACGACAGTTTTCAGG - Intergenic
1201115767 Y:10834235-10834257 TGGAGAAGAGTGCAGTTCTCTGG - Intergenic