ID: 976762751

View in Genome Browser
Species Human (GRCh38)
Location 4:88568345-88568367
Sequence TTCTGTCCTTCTCTTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 14, 3: 107, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976762743_976762751 18 Left 976762743 4:88568304-88568326 CCAAGGGCTCTTCAGTTAGCAGG 0: 96
1: 235
2: 436
3: 749
4: 1261
Right 976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG 0: 1
1: 0
2: 14
3: 107
4: 442
976762742_976762751 19 Left 976762742 4:88568303-88568325 CCCAAGGGCTCTTCAGTTAGCAG 0: 98
1: 223
2: 389
3: 661
4: 1067
Right 976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG 0: 1
1: 0
2: 14
3: 107
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976762751 Original CRISPR TTCTGTCCTTCTCTTCATGG TGG Intronic
900386948 1:2414919-2414941 CTCTGTCCCTCTCTTCTTTGGGG + Intergenic
900935555 1:5764232-5764254 TCCTGCCCTCCTCTTCTTGGGGG - Intergenic
901782064 1:11600769-11600791 TTCTGCGCTTCTCTCCATTGTGG - Intergenic
902554621 1:17239682-17239704 TACTGTCTTTCTCTTCTTGCAGG + Exonic
903655672 1:24947639-24947661 TTCTGTCCTCTTCTTCCTGTGGG - Intronic
906352820 1:45078740-45078762 CTGTGTCCTTCTCTTCAGGATGG + Intronic
908958826 1:69670576-69670598 TTGTGTCTCTCCCTTCATGGTGG + Intronic
909270405 1:73617057-73617079 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
909579196 1:77214046-77214068 TTCTGGGCTTTTCTTCATTGAGG - Intronic
909615777 1:77606417-77606439 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
910180465 1:84477492-84477514 TTCTTTCCATCTCTTCATGCAGG + Intergenic
910384544 1:86666488-86666510 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
910515303 1:88053993-88054015 TTGTGTCCATCCCTTCAGGGTGG + Intergenic
911239306 1:95448467-95448489 TTGTGTGCTTCCCTTCAGGGTGG + Intergenic
911451937 1:98073908-98073930 TTCCTTCCTTCTCATTATGGTGG - Intergenic
912117039 1:106419404-106419426 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
912871663 1:113312019-113312041 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
913078082 1:115358341-115358363 TTCTGTCCTTTTTTCCATTGTGG + Intergenic
913334368 1:117695475-117695497 GTCTGCCCTAATCTTCATGGAGG + Intergenic
913595331 1:120370482-120370504 TTAAGTCCTTATCTTCATGGTGG - Intergenic
913706998 1:121434936-121434958 TCGTGTCCTTCCCTTCAGGGTGG - Intergenic
914072909 1:144312892-144312914 GCCTGTCCTTCTCTCCAAGGAGG - Intergenic
914091942 1:144508491-144508513 TTAAGTCCTTATCTTCATGGTGG + Intergenic
914106245 1:144653468-144653490 GCCTGTCCTTCTCTCCAAGGAGG + Intergenic
914302303 1:146387527-146387549 TTCTGTCATTTTCTCCAAGGTGG + Intergenic
914306594 1:146425373-146425395 TTAAGTCCTTATCTTCATGGTGG - Intergenic
914439469 1:147691157-147691179 TTCTATCCTTCTCATTATGGGGG - Intergenic
914595455 1:149147427-149147449 TTAAGTCCTTATCTTCATGGTGG + Intergenic
914830288 1:151166039-151166061 TTTTTTCCTTCTCTTCCTGTCGG - Exonic
916360646 1:163963350-163963372 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
917226335 1:172788045-172788067 CTGTGTCCTTCTCTTCAGAGTGG + Intergenic
918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG + Intronic
918553665 1:185773529-185773551 TTCTGCCCTCCTCTACATGTTGG - Intronic
919003209 1:191860911-191860933 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
919067843 1:192715113-192715135 TCATGTCCTTCCCTTCAGGGTGG - Intergenic
919088761 1:192952924-192952946 TTCTGTCCTTCTCCACATTTTGG + Intergenic
919455978 1:197819490-197819512 TTCTGTTCTTCCCTTAAGGGTGG - Intergenic
921561373 1:216662574-216662596 TTCTTTCTTACTCTTCCTGGGGG - Intronic
922705812 1:227789466-227789488 TTCTGTCCTGCTCCTCCTGATGG + Intergenic
923850956 1:237794142-237794164 TGCTGTCCAACTCTTAATGGTGG + Intronic
924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG + Intronic
1064268932 10:13848108-13848130 TTCTGTCTTTCTGCTAATGGGGG - Intronic
1064987428 10:21225453-21225475 TTATGTTCTTCTCTTGAGGGTGG + Intergenic
1066649637 10:37642426-37642448 TTATGTCCTTCCCTTCAAGGTGG + Intergenic
1067032528 10:42887975-42887997 TTGTGTCCTTCCCTTCAGGATGG + Intergenic
1067942562 10:50668957-50668979 TTCTGGCCTTATCTTCCTCGTGG - Intergenic
1068226770 10:54116376-54116398 TTCTGTGCTTCCCTTCACTGTGG - Intronic
1068411309 10:56659791-56659813 CTTTGTCCTTCTCTTCAGGGTGG + Intergenic
1069063608 10:63919748-63919770 TCTTCTCCTTCTCTTCATGGAGG - Intergenic
1069248884 10:66244323-66244345 TTATGTCCTTCCCTTCCGGGTGG - Intronic
1069343572 10:67440418-67440440 TTATGTCCTTCCCTTCAGAGTGG - Intronic
1069633466 10:69911599-69911621 TCCTTTCCTTCCATTCATGGAGG - Intronic
1070791319 10:79191177-79191199 TTCTGTCTAACTCTTCCTGGGGG + Intronic
1070863804 10:79693915-79693937 TTCTGGCCTTTTCTTCCTCGTGG - Intergenic
1071215197 10:83393216-83393238 CTTTGTCTTTCTCTTCAGGGTGG + Intergenic
1071489221 10:86124569-86124591 TACTGTATTTTTCTTCATGGGGG + Intronic
1071767899 10:88689557-88689579 TTGTGTCCTTCCTTTCAAGGTGG - Intergenic
1071896654 10:90075573-90075595 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1071905953 10:90173788-90173810 ATCTGGCCTTGTCCTCATGGTGG + Intergenic
1072989889 10:100182563-100182585 TTCTGGCTTTCTATTTATGGTGG - Intronic
1073197429 10:101704381-101704403 TCCTGCTTTTCTCTTCATGGTGG - Intergenic
1073616349 10:105000127-105000149 TTCTGTCCTTGTCTTTTTGTTGG - Intronic
1073823315 10:107290989-107291011 CTGTGTCCTTCTCTTCAGGAGGG + Intergenic
1074038121 10:109761506-109761528 TTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1075211169 10:120492488-120492510 TTCTGTGCTTCCCTTCCTGCAGG - Intronic
1075830507 10:125407142-125407164 TTGTGTCCTTTACTTCATTGTGG + Intergenic
1076307855 10:129477295-129477317 TTGTTTCCATCTCTTGATGGTGG + Intronic
1077240262 11:1507087-1507109 TTCAGTCCTTCTCTGCATGCTGG - Intergenic
1077427513 11:2490353-2490375 TTTTGTCCTTCACTTTAGGGTGG - Intronic
1077537903 11:3133288-3133310 TTCTCTCCCTCCCCTCATGGGGG - Intronic
1077759085 11:5071073-5071095 TTCTGCTATTCTCTTTATGGTGG - Intergenic
1077797872 11:5509887-5509909 TCCCGTCCTTCTCTTTATGCAGG + Exonic
1077845677 11:6021940-6021962 TTCTGTCTCTCTATTAATGGCGG - Intergenic
1078842995 11:15096489-15096511 TTGTGTCCTTTCATTCATGGTGG + Intergenic
1079183588 11:18215579-18215601 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
1080128661 11:28767168-28767190 TTGTGTCCTTCCCTTCAGTGTGG - Intergenic
1080869108 11:36221482-36221504 TCCTGTCCTTCTCTCCCTGTAGG - Intronic
1081947816 11:47014184-47014206 TTCTCTCTTTCTTTTCATGGGGG - Intronic
1082122670 11:48396268-48396290 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082251965 11:49992404-49992426 CTGTGTCCTTCTTTTCAGGGTGG - Intergenic
1082556374 11:54567544-54567566 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1083512695 11:63226711-63226733 TTGTGTCCTTCCTTTCAGGGTGG + Intronic
1084938664 11:72600823-72600845 ATCTGTCCTTATCTTCAGTGGGG - Intronic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1085178532 11:74511699-74511721 TTGTGTCCTCCCCTTCAGGGTGG - Intronic
1085559315 11:77455840-77455862 TTTTGTAAATCTCTTCATGGAGG - Intronic
1085651111 11:78269410-78269432 CTCTGTCTCTCTTTTCATGGTGG + Intronic
1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG + Intergenic
1087031937 11:93715064-93715086 TTATGTCCTTGCCTTCAGGGTGG + Intronic
1087499954 11:98937935-98937957 TTATGTCCTTCTGTTCCTGTAGG + Intergenic
1087720898 11:101664675-101664697 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
1087950738 11:104218309-104218331 TTATGTTCTTCCCTTCAGGGTGG + Intergenic
1088181906 11:107121965-107121987 TTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1088411436 11:109539148-109539170 TTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1088570014 11:111213657-111213679 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1089502205 11:118939391-118939413 TTCTCTCCTGCTCTTCACGAAGG - Intronic
1089617181 11:119701539-119701561 TTCTGTCCTTCTCTGCTCTGGGG + Intronic
1090083776 11:123633131-123633153 TCCTGTCCTTGTCTTCTTGGAGG + Exonic
1090625067 11:128600290-128600312 TTCTCTCCCTCACTTCATGAAGG + Intergenic
1091182722 11:133621358-133621380 TTTTGTCTGTTTCTTCATGGGGG - Intergenic
1091552531 12:1547424-1547446 TCATGTCCTTCTGTTCATGTTGG + Intronic
1091994389 12:4981857-4981879 TTCTGTCCTCCACTTTTTGGAGG - Intergenic
1092477006 12:8828172-8828194 TTGTGTCCTCCCCTTCAGGGTGG + Intronic
1093234923 12:16597493-16597515 TTCTTTCTTTCTGTTTATGGAGG + Intronic
1093259428 12:16917448-16917470 TTTTGTCCTTCCATTCAGGGTGG + Intergenic
1093713351 12:22353237-22353259 ATCTGTCCTTCTCATAATGCAGG - Intronic
1095169777 12:39020302-39020324 TTATGTTCTTCCCTTCAGGGTGG - Intergenic
1095229092 12:39715784-39715806 TTCTTCCCTTCTGATCATGGTGG + Intronic
1097425966 12:59445477-59445499 TTGTGTCCTTCCATTCAGGGTGG + Intergenic
1097473162 12:60021215-60021237 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1097738759 12:63213334-63213356 TTCTGTTCTTTGCTTCATGTTGG - Intergenic
1098207834 12:68132167-68132189 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098648996 12:72940969-72940991 TTCTGTCCTGCCTTTCATGGTGG + Intergenic
1098667258 12:73179956-73179978 TTGTGTCCTTCCTTTCATGGTGG + Intergenic
1099279086 12:80620240-80620262 GTCTTTCCTTCTGTACATGGAGG - Exonic
1099536166 12:83847698-83847720 TTCTTTCCTTCTGTTAATAGGGG + Intergenic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1100904991 12:99286978-99287000 TTATGCCCTTCCCTTCAGGGTGG - Intronic
1100909098 12:99338095-99338117 TTGTGTACTTCCCTTCAGGGAGG + Intronic
1101226750 12:102694963-102694985 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1102318034 12:111905547-111905569 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1105218434 13:18304122-18304144 TTCTCTCCTGCTCTTCTTGCTGG + Intergenic
1105220831 13:18324151-18324173 GCCTGTCCTTCTCTCCAAGGAGG + Intergenic
1106074861 13:26449152-26449174 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1106349903 13:28920623-28920645 TTGTGTCCCTTTCTTCAGGGTGG + Intronic
1106547772 13:30745202-30745224 TTCAGTCCTTCTCCTCATCTAGG + Intronic
1106919502 13:34548521-34548543 ATTTGTCCTTCTCTTCATCTTGG + Intergenic
1106963986 13:35037912-35037934 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
1107524127 13:41213603-41213625 TTGTGTCCGTCTCTTCAGGATGG + Intergenic
1107553353 13:41496881-41496903 CTCTGACCATCTCCTCATGGTGG + Intergenic
1107911914 13:45113315-45113337 TGGTGTCCTTGTCTGCATGGGGG - Intergenic
1108922617 13:55694051-55694073 CTGTGTCCTTCCCTTCATGGTGG - Intergenic
1108973319 13:56403419-56403441 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1109100632 13:58180436-58180458 TTCTCTCCTTCCCTTCAGGGTGG + Intergenic
1109567149 13:64132053-64132075 TTATTTCCTTCCCTTCATGGGGG - Intergenic
1109724107 13:66316613-66316635 TTCACTCCTTCACTTCATGTAGG + Intronic
1110901280 13:80828295-80828317 TACTGTCTATCTCTTCATGTAGG + Intergenic
1111085747 13:83373441-83373463 TCCTGTCTTTCCCTTAATGGTGG + Intergenic
1111888595 13:94053756-94053778 TTCTTTCCTTCTAATCATCGTGG - Intronic
1112053722 13:95670794-95670816 TTCTGTCTTTCTCTTCAGGATGG + Intergenic
1112493159 13:99884959-99884981 TTGTGTCCTTCTATTCAGGTAGG + Intronic
1112940534 13:104855668-104855690 TTGTGTCCTTCACTTTAGGGTGG - Intergenic
1113441621 13:110333505-110333527 TTCTTTAATTCTCTTCATGGGGG + Intronic
1114043844 14:18704272-18704294 TTCTTTCTTTCTCTTTCTGGGGG - Intergenic
1114048130 14:18894714-18894736 TTCTTTCTTTCTCTTTCTGGGGG - Intergenic
1114072585 14:19126571-19126593 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1114089671 14:19273401-19273423 CTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1114114388 14:19506930-19506952 TTCTTTCTTTCTCTTTCTGGGGG + Intergenic
1114116083 14:19624683-19624705 TTCTTTCTTTCTCTTTCTGGGGG + Intergenic
1115821078 14:37212645-37212667 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1115948733 14:38695125-38695147 TTATGTCCTTCCCTTTATGTTGG - Intergenic
1116021553 14:39468449-39468471 TTGTGTCCTTTCCTTCAGGGCGG + Intergenic
1116835027 14:49762100-49762122 TTTTGTCCTTCTCTTCACAGTGG + Intergenic
1116873667 14:50091093-50091115 TGCTGTTCTTGTCTTCAAGGAGG + Intronic
1117159296 14:52973229-52973251 CTGTGTCCTTCCCTTTATGGTGG + Intergenic
1117343551 14:54811592-54811614 ATCTGTACATCTCTTCATGCTGG - Intergenic
1118113827 14:62751907-62751929 GTCTGTCCTTCTCTTGAGGTAGG + Intronic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1118862663 14:69676835-69676857 TTCGGTTCTTCTCTTCAGGCAGG - Intronic
1120426258 14:84351529-84351551 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1120858693 14:89235155-89235177 TTCTGTTCTTCTCTTCCTGCAGG - Intronic
1121163785 14:91771896-91771918 TTCTGTTGTTCTCTTCTTTGTGG - Intronic
1121880516 14:97496621-97496643 TTCTGTCTTTCTTTTCTTGATGG - Intergenic
1122172470 14:99888694-99888716 TTCTGTCCTCAGCTCCATGGTGG - Intronic
1122619337 14:103045650-103045672 TTTCCTCCTTCTATTCATGGGGG + Intronic
1124597694 15:31104160-31104182 TGCAGTCCTTCTCCTCATGGGGG + Intronic
1125044409 15:35230087-35230109 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
1125272371 15:37953141-37953163 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1125910139 15:43430125-43430147 TTGTTTCCTTCCCTTAATGGTGG - Intronic
1126015749 15:44348588-44348610 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1126053235 15:44706821-44706843 TTATGTCCCTCTCTTTAGGGTGG + Intronic
1126058475 15:44755358-44755380 TGCTGTCCATTTCTTCACGGTGG + Exonic
1126334107 15:47567538-47567560 TTCTTTCCCTCTCTTCATTTAGG + Intronic
1126517543 15:49553495-49553517 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1127536333 15:59893271-59893293 TTCTGTCCCCCTCTTCATCCAGG - Intergenic
1128028825 15:64461369-64461391 TCCTGTCCTTTTCTTCAAGATGG + Intronic
1128120596 15:65143266-65143288 TTGTTTCCTTATCTTCAAGGAGG + Intergenic
1128443652 15:67737800-67737822 TTCTTTCCTTCTCCCCGTGGTGG - Intronic
1128900970 15:71422756-71422778 TTGTGTCCTTCCCTTTAGGGTGG + Intronic
1129501146 15:76038687-76038709 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
1129642483 15:77394205-77394227 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1129820975 15:78601789-78601811 TTCTGTCCTCCTCTCCCTGACGG - Exonic
1130441072 15:83955084-83955106 TTATGTTCTTCCCTTCAGGGAGG + Intronic
1131944990 15:97609634-97609656 TTGTGTTCTTCCTTTCATGGTGG - Intergenic
1132661817 16:1065022-1065044 TTCTGCTCTGCTCTTCATGGAGG + Intergenic
1132743936 16:1428981-1429003 CTCTGTCCCTGGCTTCATGGGGG - Intergenic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1133702550 16:8322600-8322622 TTCTCTCCATCCCTTCATTGTGG + Intergenic
1134370848 16:13622896-13622918 TGCTTTCCTTCTCTGCATTGGGG - Intergenic
1134510839 16:14845656-14845678 TCCTGTCCTTCTCTTCATGATGG + Intronic
1134698480 16:16244143-16244165 TCCTGTCCTTCTCTTCATGATGG + Intronic
1134973354 16:18550535-18550557 TCCTGTCCTTCTCTTCATGATGG - Intronic
1135166257 16:20141711-20141733 TTCTAATCTTCTCGTCATGGTGG - Intergenic
1135660945 16:24296106-24296128 TTCTGACCTTGTCATCCTGGGGG - Intronic
1135954479 16:26944826-26944848 TTCTTCCTTTCTCTTCTTGGGGG - Intergenic
1136945444 16:34645188-34645210 TTCTGTCCTTCTCCTCTTTGAGG - Intergenic
1137993581 16:53184909-53184931 TTATGTCCTTCTTCACATGGTGG - Intronic
1139440235 16:66963117-66963139 TTCACTCCTTCCCCTCATGGGGG + Intronic
1139478158 16:67213521-67213543 TTCTTTCCTTCCCTTCATTCTGG + Intronic
1139891003 16:70253312-70253334 TTCTGCCATGCTCTTCACGGTGG - Exonic
1140920798 16:79535923-79535945 CTCTGTCCTTGACTTCATGGCGG - Intergenic
1141055077 16:80806072-80806094 TTTTTTCCTTATCTTCATGCGGG - Intergenic
1143064616 17:4236244-4236266 TTCTGTCTTTCTCTCCCTGATGG - Intronic
1143888201 17:10082264-10082286 TTCTTTCCTTCTCTTCCTGGAGG - Intronic
1145293094 17:21565339-21565361 TTCAGTTCTTGTCTTCTTGGAGG + Intronic
1146216684 17:30982111-30982133 TTGTGTCCTTCCCTTCATGGTGG + Intronic
1146635729 17:34502981-34503003 TTCTGTCCCTCTCTAAATGTTGG + Intergenic
1146831022 17:36069784-36069806 TGCTGTCCTTTTCTTCACTGAGG + Intronic
1148090783 17:45021445-45021467 TTCTCTCTCTCTCCTCATGGGGG - Intergenic
1148984432 17:51609458-51609480 TTCTGTCCTGAGCTTCAGGGAGG + Intergenic
1149184311 17:53979308-53979330 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1149239858 17:54636135-54636157 TGGTGTCCTTCCCTTCAAGGTGG - Intergenic
1149906322 17:60529377-60529399 GTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1150013968 17:61534581-61534603 TTCCGTCTTTCTCTAAATGGAGG - Intergenic
1150220376 17:63492627-63492649 TTCTGTCATTCTCATCGGGGAGG - Intronic
1150550446 17:66204684-66204706 TTGTGTCCCTCCCTTCAGGGTGG - Intergenic
1150871107 17:68911513-68911535 CTGTGTCCTTCCCTTTATGGTGG - Intronic
1151029654 17:70721762-70721784 TTTTGTCCTTCTTCACATGGTGG - Intergenic
1153183192 18:2459156-2459178 TTATATCCTTCCCTTCAGGGTGG + Intergenic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155597373 18:27503069-27503091 TTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1156094329 18:33510834-33510856 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1156614741 18:38769994-38770016 TCCTTTCATTCTATTCATGGAGG - Intergenic
1156636234 18:39032831-39032853 TTTTGTCCTTATCTTCATGTAGG - Intergenic
1156759358 18:40568963-40568985 TTCTGTCTTTCTCTTAATTATGG + Intergenic
1158401242 18:57123211-57123233 TTCCAGCCTTCTTTTCATGGAGG + Intergenic
1158878127 18:61752211-61752233 TTCTGTGCTTCCTTTCAAGGGGG - Intergenic
1158948930 18:62474276-62474298 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1159260284 18:66004808-66004830 TTGTGTTCTTCTCTTCAGGGCGG - Intergenic
1162306659 19:9878791-9878813 TTCTGTGCTTCCCTGCATCGTGG - Intronic
1162692940 19:12449028-12449050 TTGTTTCCTTCCCTTCAGGGTGG + Intronic
1163144902 19:15373601-15373623 TTCCTTGCTTTTCTTCATGGCGG - Intronic
1163924591 19:20327884-20327906 TTATATCTTTATCTTCATGGAGG + Intergenic
1166757351 19:45201541-45201563 TTGTGTCCTTCCCTTCAGGATGG + Intronic
1166872284 19:45878022-45878044 TTCTGTCATTGTCTTCTTTGTGG + Intergenic
1168605784 19:57759039-57759061 TTATGTCCTTCCCTTCAGAGTGG - Intergenic
925046889 2:778962-778984 TTCTGTCCTTACATTCCTGGGGG - Intergenic
925183634 2:1832552-1832574 ATCTGTCCTTCCTTTCATGTTGG + Intronic
925604018 2:5639842-5639864 TTAAGTCCTTATCTTCATGGTGG - Intergenic
925698866 2:6613128-6613150 TTATGTCCTTCCCTTCAGGATGG + Intergenic
927309710 2:21616989-21617011 CTGTGTCCTTCACTTCAGGGTGG + Intergenic
927919906 2:26964213-26964235 ATCTGTGCTTCTCTTCATAGTGG - Intergenic
928215449 2:29357583-29357605 TTCTGTCCTCCTGGTCATAGTGG + Intronic
928715458 2:34055465-34055487 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
928783659 2:34854982-34855004 CTATGTCCTTCCCTTCATGGTGG - Intergenic
929195090 2:39177022-39177044 TTCTATCCACCTCTGCATGGTGG - Intronic
929281646 2:40086992-40087014 TTGTGTCCTTCCCTTCATGGTGG + Intergenic
930159300 2:48137955-48137977 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
930288777 2:49467560-49467582 TTGTGTCCTTCGCTTCAGGGTGG + Intergenic
930670380 2:54143827-54143849 TTCCATCCTTCTCTTCATTCTGG + Intronic
931572346 2:63681612-63681634 CTGTGTCCTTCCCTTCAAGGTGG - Intronic
931637346 2:64352362-64352384 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
932502794 2:72198997-72199019 TTCTGCTCTGCTCTTCTTGGAGG - Intronic
933445608 2:82376733-82376755 ATATGTCCTTCTCCACATGGTGG - Intergenic
933538017 2:83602053-83602075 TTCTGTTCTTTTTTTCAAGGTGG - Intergenic
934183224 2:89648325-89648347 GCCTGTCCTTCTCTCCAAGGAGG - Intergenic
934293504 2:91722495-91722517 GCCTGTCCTTCTCTCCAAGGAGG - Intergenic
935478528 2:103556585-103556607 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
936607213 2:113970570-113970592 TTGTGTCATTCTCAGCATGGAGG + Intergenic
936901262 2:117484542-117484564 TTGTGTCCTTCTCTTCAAGGTGG + Intergenic
937146703 2:119652585-119652607 TTCTCTCCTTCTCTCCATCAGGG + Intronic
937537432 2:122907722-122907744 TTATGCCCTTATCTTCTTGGGGG - Intergenic
937552205 2:123108040-123108062 CTATGTCCTACTCTTCAAGGTGG + Intergenic
937637233 2:124169939-124169961 TCTTGTCCTTCTCTTCATGTGGG + Intronic
938425501 2:131183229-131183251 TTCTTTCGTTCTCTTTCTGGGGG - Intronic
938438520 2:131303191-131303213 TTTTGTCCTTCTCCCCATGTAGG - Intronic
938486824 2:131720044-131720066 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
939244731 2:139609415-139609437 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
940738730 2:157482546-157482568 TTCTGGCCTTCTCTTCCTATAGG - Intronic
941745881 2:169087044-169087066 TTGTGTCCTTCCCTTCGGGGTGG + Intronic
942110985 2:172682546-172682568 TCCTGTCCTCCTCTGCATGCAGG + Intergenic
943237163 2:185337597-185337619 ATGTGTCCTTCCCTTCATGGTGG + Intergenic
943427810 2:187758740-187758762 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
943633176 2:190277295-190277317 TACTGTGCTACTCTTCATGGTGG + Intronic
944751911 2:202717869-202717891 TTGTGTCCTTTCCTTCCTGGTGG + Intronic
944760459 2:202808532-202808554 TTGTGTCGTTCTCTTCAGGGTGG - Intronic
944854995 2:203759270-203759292 TTGTGTCTTTTTCTTCAGGGAGG + Intergenic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
945739682 2:213644923-213644945 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
946157364 2:217815771-217815793 TTCTGCCCTCATCTTCATGGTGG - Intronic
946443503 2:219717626-219717648 TTCTTTTTTTCTCTTCAAGGTGG - Intergenic
1169617886 20:7470897-7470919 CTGTGTCCTTCACTTCAAGGCGG + Intergenic
1169628692 20:7600824-7600846 TTGTGTCCTTCCCTTTAGGGTGG - Intergenic
1170311555 20:14997678-14997700 TTCTGTCTTTCCCTTCAGGGTGG - Intronic
1172455507 20:35069385-35069407 TTCTCCTCTTCTCTCCATGGAGG - Exonic
1172924351 20:38517635-38517657 TACTGTGCTTGTCTTCATGGTGG - Exonic
1173134707 20:40429161-40429183 GTCTCTCCTTCTCTTGGTGGTGG + Intergenic
1173824868 20:46041675-46041697 TTCTGTCCTTGGCATCAGGGAGG + Intronic
1176105123 20:63382277-63382299 TTCTGTCCTTATCAAGATGGGGG + Intergenic
1177314414 21:19438033-19438055 TTTTGTCCCCCTCTTCATAGAGG + Intergenic
1177592301 21:23185925-23185947 TTTTTTCCTTCCCTTCAGGGTGG - Intergenic
1177658986 21:24057467-24057489 CTCTCTCCTCCGCTTCATGGCGG + Intergenic
1177736836 21:25101518-25101540 TGCTGTCCTTCTCCACATTGGGG - Intergenic
1178007317 21:28235584-28235606 TTATGTTCTTCCCTTCAGGGCGG - Intergenic
1178103188 21:29291937-29291959 TTCAGTACTTCTTCTCATGGTGG + Intronic
1178899530 21:36588077-36588099 TTATCCCCTTCTCTTCCTGGTGG + Intergenic
1179449174 21:41456371-41456393 TTCTGGCCTGCTCTTCCTGCTGG - Intronic
1180466665 22:15617388-15617410 TTCTTTCTTTCTCTTTCTGGGGG - Intergenic
1180491033 22:15848946-15848968 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1185075756 22:48681251-48681273 TTCTGTGCTTCTCCTAATTGGGG - Intronic
949293196 3:2489492-2489514 TTCTGTGTTTCTCTTCATTTTGG - Intronic
949829172 3:8196385-8196407 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
951032153 3:17894975-17894997 CTGTGTCCTTCCTTTCATGGTGG + Intronic
951204451 3:19910529-19910551 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
951279466 3:20731112-20731134 TTGTGTTCTTCCCTTCAGGGTGG + Intergenic
951436898 3:22675969-22675991 TTGTGTACTTCTCTTCAGGGTGG + Intergenic
951744020 3:25956676-25956698 TTCATTCCTTCTGTCCATGGAGG - Intergenic
951904381 3:27689186-27689208 CTCTGTCCTTCCCCTCAGGGTGG - Intergenic
952486218 3:33813456-33813478 TTTTGTCCTTTTTTTCATGGTGG + Intronic
952639855 3:35580154-35580176 CTGTGTCCTTACCTTCATGGTGG - Intergenic
953309437 3:41863020-41863042 GCCTGTCCTTCCCTTCAGGGCGG + Intronic
954461966 3:50632247-50632269 ATCTGTGCTCCTCTTCATGGGGG + Intronic
956804122 3:72791506-72791528 TTTTTTATTTCTCTTCATGGGGG - Intronic
957120924 3:76091134-76091156 TTATCTTCTCCTCTTCATGGTGG - Intronic
957925523 3:86805594-86805616 TTATTTTCTTCCCTTCATGGTGG - Intergenic
958876766 3:99625267-99625289 CTTTGTCCTTCACTTCAGGGTGG - Intergenic
959099913 3:101998647-101998669 TTCTTTCCTTCTCTTCCTGAGGG + Intergenic
959113532 3:102149371-102149393 TTGTGTCCTTCCATTCAGGGTGG - Intronic
959216124 3:103452215-103452237 TTCTGTCTTTCTTTTCATGAAGG - Intergenic
959547360 3:107612812-107612834 TTGTGTCCTTCTGTTCAGGGTGG + Intronic
959841722 3:110984132-110984154 TTGTGTCCTTCTCTTCAGCGTGG - Intergenic
960404231 3:117239275-117239297 CTGTGTCCTTCTCTTCAGGTTGG - Intergenic
960435025 3:117615606-117615628 TTCTGTCTTTCTGTCCATGAGGG + Intergenic
961530118 3:127535566-127535588 TTCTCTGCCTCTCTTCCTGGGGG - Intergenic
961974489 3:131008852-131008874 CTCTGACTTTCTCTACATGGGGG - Intronic
962015234 3:131432171-131432193 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
962698931 3:137978505-137978527 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
963310168 3:143700743-143700765 TTGTATCCTTCCCTTCAAGGTGG - Intronic
964349894 3:155791906-155791928 TTGTGTCCTTCTCTTCTGGGTGG - Intronic
964398356 3:156272272-156272294 TTTTGTCCTTCCTTTCAGGGTGG + Intronic
964626463 3:158764574-158764596 TTCCCTCCTATTCTTCATGGTGG + Intronic
965059929 3:163772759-163772781 TTGTGTCCTTCCCTTCTGGGTGG + Intergenic
965526981 3:169731170-169731192 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
965844598 3:172946770-172946792 TTGCGTCCTTCCCTTCAGGGTGG - Intronic
965938288 3:174143361-174143383 TTCTGTCATTCTCTTCACTTTGG - Intronic
966151188 3:176869092-176869114 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
966312960 3:178615340-178615362 CTCTGTCCTTCCCTTCAGGATGG + Intronic
966907249 3:184535917-184535939 TTCTTCCCTTCTTTTCATTGAGG - Intronic
967123816 3:186407162-186407184 CTCGGCCCTTCTCTTCAGGGAGG - Intergenic
967464299 3:189785611-189785633 TTTTGTCCTTCTGTTCATTCCGG - Intronic
968096228 3:195932673-195932695 TTGTGTCTTTCTTTTCAGGGCGG - Intergenic
969371693 4:6735409-6735431 TTCTGACCTTGTCTTCATTACGG - Intergenic
970915462 4:21328649-21328671 TTATTTCCTTCCCTTCAGGGCGG + Intronic
971859819 4:32088819-32088841 TTCAGTTCTTCTCTCCATGCAGG - Intergenic
971937555 4:33172042-33172064 TTCTTTTCTGCTTTTCATGGTGG + Intergenic
972104078 4:35461190-35461212 CTATGTCCTTCCCTTCAAGGCGG + Intergenic
972579336 4:40380723-40380745 TTGTGTTCTTCCCTTCAAGGTGG - Intergenic
972851691 4:43057832-43057854 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
973077199 4:45944057-45944079 TTCTGCAATTCTCATCATGGTGG - Intergenic
973919723 4:55673077-55673099 TTGTGTCCTTCCCTTCAGAGAGG + Intergenic
974267024 4:59598637-59598659 TTTTGTCCTTCCCTTCAAGGTGG - Intergenic
974978141 4:68917637-68917659 TTCTGCTCTTCTGTTCATGCTGG + Intergenic
975911075 4:79267655-79267677 TTGTGTCCTCCTCTTCTTGGGGG + Intronic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
977184964 4:93925469-93925491 TTCTGTCCTTCCCTTCAATGTGG - Intergenic
978008570 4:103651122-103651144 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
978082859 4:104616097-104616119 TTTTGTCCTGCCCTTCAGGGTGG + Intergenic
978116250 4:105023073-105023095 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
978968902 4:114777777-114777799 TTCTTTCCTTCTATTTTTGGGGG + Intergenic
979073388 4:116240578-116240600 TTATGTCCTTCCCTTCAGGGAGG + Intergenic
979213205 4:118132131-118132153 TTGTGTCCTTCCCTTCAGAGCGG + Intronic
979573071 4:122252729-122252751 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
979669303 4:123345318-123345340 TTCTGTCCTCCTCCTCTTAGAGG - Intergenic
980597005 4:134967185-134967207 TTGTGTCTTTCTTTTCAGGGAGG - Intergenic
980960480 4:139470117-139470139 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
982441486 4:155441260-155441282 TTCTTTCCTTCTCTTTTTTGAGG - Intergenic
982531824 4:156554918-156554940 TTCTTTTCTTCTCTTCATTTTGG + Intergenic
982544584 4:156718223-156718245 TTCTTTCCTTGTCTTCATTTTGG - Intergenic
982918482 4:161244798-161244820 TTCTGCTCTTCTCTTCATGGAGG + Intergenic
983017307 4:162628922-162628944 TTTTGTCCTTCCCTTTAGGGTGG - Intergenic
983493191 4:168412601-168412623 TGGTGTCCTTTTCTTCAAGGTGG - Intronic
984305155 4:177979854-177979876 TTCTGCTCTTGTCTTCAAGGTGG + Intronic
985257119 4:188081347-188081369 TGCTGTCCCTATCTTCATTGTGG - Intergenic
985696452 5:1343588-1343610 TTCTGGCCTCCCCTTCATGGAGG + Intronic
985888848 5:2700356-2700378 GTCTGTCCTTGTCCTCATGTGGG - Intergenic
986051471 5:4094369-4094391 TGCTCGCCTACTCTTCATGGGGG - Intergenic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
986899280 5:12412482-12412504 CTCTGTCCTTCTTTTCAGGGTGG + Intergenic
987047833 5:14124186-14124208 TTCTGCCCTTCTCTTCCTCCAGG - Intergenic
987368758 5:17174086-17174108 GTCTGACTGTCTCTTCATGGTGG - Intronic
987631540 5:20478681-20478703 TTGTGTCCTACCCTTCAGGGTGG - Intronic
988064727 5:26219267-26219289 TTGTGTCTTTCTCTTCAGGGTGG - Intergenic
989671642 5:43924554-43924576 TTATGTCCTTCCCTTCAGGATGG + Intergenic
989677975 5:43994636-43994658 TTCTGTCTTTCTCTGGCTGGAGG + Intergenic
989970669 5:50520962-50520984 TCGTGTCCTTCCCTTCAGGGTGG + Intergenic
990328184 5:54698747-54698769 TTCTCTCCTCTTCTCCATGGGGG - Intergenic
991209063 5:64083976-64083998 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
991703364 5:69335517-69335539 TTCTTTCCTTATCTGCATGCTGG - Intergenic
992291459 5:75283834-75283856 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
992345273 5:75869584-75869606 CTTTGTCCTTCTCTTCAGGGTGG - Intergenic
992672570 5:79074959-79074981 TACTGTCCTCCTCAGCATGGGGG - Intronic
993140893 5:84031928-84031950 TTTTGTGCTTCTCTTCATTATGG - Intronic
994235537 5:97358171-97358193 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
994860317 5:105184552-105184574 TTGTGTGCTTCTTTTCTTGGAGG - Intergenic
994974185 5:106780544-106780566 TTGTTTCCTTCTCTTCAGGGTGG - Intergenic
995096444 5:108240635-108240657 TTGTATCCTTCCCTTCAGGGTGG - Intronic
995697720 5:114899152-114899174 TTGTCTCCTTCCCTTCAGGGTGG + Intergenic
995770686 5:115665795-115665817 TTATGTCCTTCCCTTCAGTGGGG - Intergenic
996116332 5:119624201-119624223 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
996161702 5:120174268-120174290 CTATGTCCTTCCCTTCATGGAGG - Intergenic
996927619 5:128846577-128846599 TTGTGTCCTTCCCTTCAGGATGG - Intronic
997186328 5:131885107-131885129 TTATGTCCTTCCCTGCAGGGTGG - Intronic
998840800 5:146251584-146251606 TTCTGTACTTCTATTCCTGTTGG + Intronic
1000273505 5:159710355-159710377 CTCAGTCCCTCGCTTCATGGCGG - Intergenic
1000910484 5:167015948-167015970 CTCTCTCCTTCTTTTAATGGTGG - Intergenic
1001014645 5:168129042-168129064 TGGTGTCCTTTTCTTAATGGGGG - Intronic
1001119344 5:168966808-168966830 TTCTGTCCTCACGTTCATGGGGG - Intronic
1002301992 5:178262564-178262586 GCCTGTCCTTCCCTTCATTGTGG - Intronic
1002406942 5:179041980-179042002 TTCTGCACATCTCTTCATGAAGG + Intergenic
1002776574 6:333029-333051 TTCAGTCCTTTCCTTCGTGGAGG - Intronic
1003209052 6:4043201-4043223 TTCTGTCCTTCACTCCAACGTGG - Intronic
1003952242 6:11127203-11127225 TTCTGTCCTTCCCATTAGGGTGG + Intronic
1006436376 6:34027893-34027915 TTCTGTCCTGCCCCTCCTGGTGG - Intronic
1006462856 6:34173598-34173620 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1006818208 6:36868005-36868027 TTCTGTCCTTCTGTTGGTTGTGG - Intronic
1006863866 6:37192605-37192627 TTCTGTCCTTGGCTTTTTGGAGG + Intergenic
1006892600 6:37441922-37441944 ATCTGCCCTTCCCTTTATGGTGG - Intronic
1007905321 6:45454028-45454050 ATCTCTCCTTCTCTTCATTCAGG - Intronic
1008314781 6:50026323-50026345 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1008940600 6:57041419-57041441 TTGTTTCCTTCCCTTCAGGGTGG - Intergenic
1009373452 6:62938149-62938171 TTCTGTCTTTCCCTTCAGGATGG + Intergenic
1010328144 6:74588503-74588525 CTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1010370856 6:75105647-75105669 TTTTGTCCTTCACTTCATTCAGG + Intronic
1010377625 6:75190596-75190618 ATCTTTCCTTCTCTCTATGGTGG + Intronic
1010845094 6:80696807-80696829 TTCTGCCCTTCTCTCAGTGGAGG - Intergenic
1011019037 6:82789832-82789854 TTGTGTTCTTCCCTTCATGGAGG - Intergenic
1011026166 6:82871868-82871890 TTCTGTCCTTCTTCACATGGTGG - Intergenic
1011033282 6:82945041-82945063 TTGTGTTCTTCCCTTCAGGGTGG - Intronic
1011271168 6:85580928-85580950 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1011917758 6:92530006-92530028 TCCTGGCCTTTTCTTTATGGGGG - Intergenic
1012773457 6:103472781-103472803 TTCTGACCTTTTCAGCATGGTGG - Intergenic
1012940556 6:105410240-105410262 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1013644171 6:112119311-112119333 TATTGTCCTTCTCTTCATCCAGG - Exonic
1013687533 6:112602110-112602132 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1014021594 6:116596852-116596874 TTTTTTTCTTCCCTTCATGGAGG - Exonic
1014840723 6:126217816-126217838 TTGTGTCCTTCCTTTCAGGGCGG + Intergenic
1014865175 6:126520824-126520846 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1015030390 6:128587208-128587230 CTGTGTCCTTTTCTTCAGGGTGG - Intergenic
1015382491 6:132585771-132585793 TCCTTCCCTTCTCTTCATTGAGG + Intergenic
1016136806 6:140554488-140554510 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1016231002 6:141803933-141803955 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1016727818 6:147395837-147395859 GTCTTTCCTCCTCTTCATGGTGG - Intergenic
1017387456 6:153902115-153902137 TTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1018748325 6:166780034-166780056 TCCTCTGCTTTTCTTCATGGTGG + Intronic
1019570613 7:1710253-1710275 TTCTCTCCTTCATTACATGGGGG + Intronic
1020574736 7:9912741-9912763 TTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1021214513 7:17900380-17900402 TTGTGTCCTTCCCTTCAAGGTGG + Intronic
1021316139 7:19149722-19149744 TTCTTTCCTTTTCTTGTTGGTGG + Intergenic
1021604159 7:22393765-22393787 TTCTGATTTTCTCTTGATGGTGG - Intergenic
1021793417 7:24228683-24228705 TTTTCTCCTTCTCTGCATGGAGG - Intergenic
1022541945 7:31145899-31145921 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1022734027 7:33059434-33059456 TTTTTTCCTTCTCTTCATCTTGG + Intronic
1023364282 7:39447707-39447729 TTCTTTCCTTTCCTTCCTGGAGG - Intronic
1024415092 7:49096858-49096880 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1026065431 7:67067964-67067986 TTCTGTCTCTCTCTTTTTGGGGG + Intronic
1026401330 7:70016624-70016646 TTCTCCCTTTCTCTCCATGGTGG - Intronic
1026571372 7:71534237-71534259 ATGTGTCCTTCTTTACATGGGGG + Intronic
1027524154 7:79245709-79245731 TCATGTCCTTCCCTTCAGGGTGG - Intronic
1028037134 7:85999123-85999145 TTGTGTCCTTCCCTTAATAGCGG + Intergenic
1028161009 7:87484324-87484346 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1030222534 7:107111332-107111354 TTGTGTCCTTCCCTTCATGGTGG - Intronic
1030598958 7:111571151-111571173 CTGTGTCCTTCCCTTCAGGGAGG - Intergenic
1031753889 7:125613154-125613176 TTGTGTCCTTCTCTTCAGGGCGG - Intergenic
1032434640 7:131889937-131889959 TGCTGTGCTTCTCTCAATGGCGG - Intergenic
1032942426 7:136810377-136810399 CTGTGTCCTTCTTTTCAAGGCGG - Intergenic
1032972009 7:137175154-137175176 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034018970 7:147619756-147619778 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1034126488 7:148676109-148676131 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034293014 7:149947341-149947363 TTCTGAACTGCTCTTCTTGGGGG - Intergenic
1034813059 7:154149532-154149554 TTCTGAACTGCTCTTCTTGGGGG + Intronic
1036586200 8:10126077-10126099 TACTTTCATTCTCTTCTTGGAGG + Intronic
1037295719 8:17397649-17397671 ATGTGTCCTTCCCTTCAGGGTGG - Intronic
1037739253 8:21592289-21592311 CTCTGTCCTTCTGCTCATGCTGG - Intergenic
1038275957 8:26120908-26120930 TTCTGTCTTTCTCTTCTTTCTGG + Intergenic
1038820271 8:30945476-30945498 TTCTGTCCTTTGCTTCACAGTGG + Intergenic
1039325790 8:36484041-36484063 TTCTTTCCTTTGCTTCAAGGGGG + Intergenic
1039647380 8:39302935-39302957 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1042132677 8:65603952-65603974 TACTGTGCTTTTCTTCATGAAGG - Exonic
1042839247 8:73107386-73107408 CTCTGTTCTCCTCTTCCTGGTGG - Intronic
1043340200 8:79229165-79229187 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1044016536 8:87053508-87053530 TTCTGTCTTTTTCTCCATGCTGG - Intronic
1045159556 8:99523292-99523314 TTGTGTCCTTCCCTTCAGAGTGG - Intronic
1045207175 8:100055082-100055104 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1045598954 8:103692274-103692296 TTTTGTCCTTTTCTTCAGGATGG + Intronic
1045931522 8:107632761-107632783 TCCTTAACTTCTCTTCATGGGGG - Intergenic
1046818814 8:118614772-118614794 TCCTGTCCTGCTCTTCACGCGGG + Intronic
1047165415 8:122432830-122432852 TTCTGTCTCTCTCTACCTGGAGG - Intergenic
1047255487 8:123210516-123210538 TTCTCTCATGTTCTTCATGGTGG - Intergenic
1048303729 8:133269024-133269046 TTCTGTCCTTCTGTCCCTGCGGG + Intronic
1050103718 9:2144364-2144386 TTGTGTCCTTCGCTGGATGGGGG + Intronic
1050143965 9:2545915-2545937 ATCTGTTCTTCTCTGTATGGTGG + Intergenic
1050276720 9:4008403-4008425 TTCTGTCCTCCTCTTCACTTTGG - Intronic
1050355957 9:4782626-4782648 CTATGTCCTTCACTTCAAGGTGG - Intergenic
1050578657 9:7027659-7027681 TTGTGTCCTGCCCTTCATGATGG + Intronic
1051306805 9:15718403-15718425 TTGTGTCCTTCTCCTCAAGATGG - Intronic
1052732977 9:32311105-32311127 TTCTGTCCTTCCCTCCAGAGTGG - Intergenic
1054997223 9:71406360-71406382 TTCTGTCCTTTTATTCCTTGAGG - Intronic
1055171500 9:73264946-73264968 TCTTGTCCTTCAATTCATGGTGG - Intergenic
1055302133 9:74892613-74892635 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1058522715 9:105828201-105828223 TTGTATCCTTCCTTTCATGGTGG + Intergenic
1059839173 9:118192440-118192462 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1185635184 X:1547079-1547101 TTCTGTCCCTCTCTTCCTCCAGG - Intergenic
1186266015 X:7834639-7834661 CTCTCTCCTTTTCTTCATAGAGG - Intergenic
1187314903 X:18183937-18183959 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1188365335 X:29308709-29308731 ATCTGTCCTTGACTTCATTGTGG + Intronic
1188421047 X:29991395-29991417 TTATGTTCTTCTCTTTAGGGTGG + Intergenic
1188972221 X:36632370-36632392 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1188999015 X:36923076-36923098 TTATTTCCTTCTTTTCAGGGTGG + Intergenic
1189411798 X:40779370-40779392 TTCCGTCCTTCTCTTCAGAGTGG + Intergenic
1189628256 X:42921980-42922002 TTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1189854343 X:45208990-45209012 TTGTGTCCTTTCCTTCATGGTGG + Intergenic
1189874269 X:45419926-45419948 TTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1190037894 X:47042779-47042801 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1190368209 X:49717184-49717206 TTGTGTCCTTTCCTTCAGGGTGG + Intergenic
1191097635 X:56690350-56690372 TTCTTTCCTTCCTTTCATAGTGG + Intergenic
1192505565 X:71680087-71680109 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1192640791 X:72859914-72859936 TTCTGTCCTTACTTTCAGGGCGG - Intergenic
1192640920 X:72860862-72860884 TTCTGTCCTTACTTTCAGGGCGG + Intergenic
1192826641 X:74704287-74704309 TTGTGTCCTCCCCTTCAAGGTGG + Intergenic
1192891001 X:75390291-75390313 TTCTGTTCTTCCCTTCTGGGTGG - Intronic
1193213977 X:78840514-78840536 TTGTGTCCTTCCATTCAGGGTGG - Intergenic
1193366172 X:80636991-80637013 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193676148 X:84454653-84454675 TTGTGTCCTTTTCTTCAGGATGG - Intronic
1193689053 X:84617341-84617363 TTCTTTTCTTCTCCTCATAGAGG + Intergenic
1193911912 X:87316612-87316634 TTATGTCCTTGTCTTCAGGGTGG + Intergenic
1194112717 X:89854637-89854659 CTTTGTCTTTCCCTTCATGGTGG - Intergenic
1194136681 X:90152265-90152287 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1194526563 X:94984089-94984111 TTGTGTCCTTCCCTCCAGGGTGG - Intergenic
1194857789 X:98956015-98956037 CTCTGTCTTTCCCTTCAGGGAGG + Intergenic
1194892466 X:99397706-99397728 TTATGTCCTTCACTTCATGGTGG + Intergenic
1195595533 X:106683917-106683939 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1195601364 X:106752134-106752156 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1195823413 X:108970982-108971004 TTGTGAACTTCCCTTCATGGTGG - Intergenic
1195834817 X:109102498-109102520 CTATATCCTTCCCTTCATGGCGG + Intergenic
1195917305 X:109948313-109948335 TTGTGTCTTTCCCTTCAAGGTGG - Intergenic
1195971429 X:110477854-110477876 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1196247468 X:113416180-113416202 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1196357212 X:114809064-114809086 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1196479855 X:116135572-116135594 TTGTGTCCTTCCCATCAAGGTGG + Intergenic
1196619688 X:117807555-117807577 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197139201 X:123097259-123097281 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197361038 X:125504324-125504346 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1197382696 X:125765215-125765237 TTGTATCCTTCTCTTCAGGGTGG + Intergenic
1197469935 X:126855227-126855249 CTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1197594242 X:128448203-128448225 ATATGTCCTTCTTTACATGGTGG + Intergenic
1197623463 X:128778603-128778625 TTGTGTTCTTCTCTTCAGGGTGG + Intergenic
1197990304 X:132310460-132310482 TTTCCTCCTTCTCTTCCTGGCGG + Intergenic
1198051368 X:132956192-132956214 TTCTGTTTTTCTCTTCTTGCCGG - Intronic
1198430723 X:136564287-136564309 TTGTATCCTTCCCTTCAAGGTGG + Intergenic
1198487324 X:137100723-137100745 TTCTTTCCTTTTGTTCATGTTGG + Intergenic
1198841105 X:140859033-140859055 CTGTGTCCTTCCCTTCGTGGTGG - Intergenic
1198964558 X:142214248-142214270 TTGTGTCCTTCCCTTTACGGTGG + Intergenic
1199148379 X:144397934-144397956 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1199173671 X:144759262-144759284 CTGTTTCCTTCTCTTAATGGTGG - Intergenic
1199455113 X:148019974-148019996 TTGTATCCTTCCCTTCAGGGTGG + Intronic
1200059754 X:153479020-153479042 ATCTGTCTTTCTCTTCAGGTGGG + Intronic
1200465370 Y:3509448-3509470 CTTTGTCTTTCCCTTCATGGTGG - Intergenic
1200482428 Y:3722215-3722237 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic